Construction method and application of IL-17D and g-lysozyme gene co-expression recombinant pichia pastoris
By co-expressing the IL-17D and g-lysozyme genes in recombinant Pichia cerevisiae, the antibacterial function of fish immune factors and proteins is solved in the problem of antibiotic resistance, and effective antibacterial activity against a variety of bacteria is achieved, providing a new treatment plan for clinical practice.
Patent Information
- Application Number
- CN202311607392.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-29
- Publication Date
- 2025-05-30
AI Technical Summary
The problem of antibiotic resistance urgently requires new alternatives and treatments, and the prior art is difficult to effectively utilize the antibacterial functions of fish immune factors and proteins.
By co-expressing the IL-17D and g-lysozyme genes in recombinant Pichia cerevisiae, the efficient expression and purification of these two functional proteins are achieved using Pichia cerevisiae's high-efficiency protein expression system.
Effective antibacterial activities against a variety of bacteria (such as Streptococcus paramatrix, Staphylococcus pasteuris, Staphylococcus epidermis, Shivar, Vibrio parahaemolyticus, Vibrio hagimaris), providing new therapeutic ideas for the clinical prevention and treatment of bacterial diseases.
Smart Images

Figure CN120059982A_ABST
Abstract
Description
Technical Field
[0001] The present disclosure relates to the field of genetic engineering, and particularly to a method for constructing and applying a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes. Background Art
[0002] The problem of antibiotic resistance has become an important challenge in the global public health field. To address this issue, it is crucial to search for alternative antibiotics and develop new treatment methods. Against this backdrop, research in fields such as genetic engineering and immunotherapy has been making continuous progress.
[0003] Interleukin-17D (IL-17D) is an immunomodulatory factor that plays an important regulatory role in the immune response of fish. IL-17D can stimulate immune cells to produce various inflammatory factors, such as tumor necrosis factor (TNF) and interferon-γ (IFN-γ), which can enhance the activation and bactericidal ability of immune cells. IL-17D can also regulate the migration and inflammatory response of immune cells, promote the accumulation of inflammatory cells and the release of inflammatory factors, thereby enhancing the immune response.
[0004] g-type lysozyme (g-lysozyme) is an immune protein naturally present in fish, and it has antibacterial activity. When infected with pathogenic microorganisms, fish produce more g-type lysozyme, which can destroy the cell wall of bacteria, thereby resisting bacterial infection. g-type lysozyme has strong antibacterial activity against some bacteria such as Gram-positive bacteria and Gram-negative bacteria, and thus plays an important protective role in fish immunity.
[0005] By combining the co-expression of the two genes IL-17D and g-lysozyme, their respective antibacterial and immunomodulatory functions can be comprehensively utilized to improve the antibacterial effect and the efficacy of immunotherapy. Recombinant Pichia pastoris is a commonly used fungal expression system with high-efficiency protein expression ability and good folding and post-translational modification ability. If the genes IL-17D and g-lysozyme can be co-expressed in yeast cells, the high-efficiency expression and purification of these two functional proteins can be achieved, providing a new approach for alternative antibiotics and immunotherapy. Summary of the Invention
[0006] Based on this, the purpose of the present disclosure is to provide a method for constructing a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes.
[0007] To achieve the above object, the present disclosure adopts the following technical solutions:
[0008] A method for constructing a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes, comprising the following steps:
[0009] S1. Optimize the IL-17D gene sequence and the g-lysozyme gene sequence according to the preferred codons of Pichia pastoris, respectively, to obtain the optimized IL-17D gene sequence SEQ ID NO.7 and the optimized g-lysozyme gene sequence SEQ ID NO.8;
[0010] Connect the gene sequence SEQ ID NO.7 and the gene sequence SEQ ID NO.8 to obtain the IL-17D-g-lysozyme gene sequence SEQ ID NO.9;
[0011] S2. Perform PCR amplification on the gene sequence SEQ ID NO.9;
[0012] S3. Clone the gene obtained in S2 into the pPIC9K vector to obtain a recombinant vector;
[0013] S4. Transform the recombinant vector into Pichia pastoris GS115 to obtain recombinant Pichia pastoris GS115 / pPIC9K-IL-17D-g-lysozyme containing the gene sequence SEQ ID NO.7 and the gene sequence SEQ ID NO.8.
[0014] Preferably, in step S1, connect the gene sequence SEQ ID NO.7 and the gene sequence SEQ ID NO.8 through the T2A peptide.
[0015] Preferably, S3 includes the following steps:
[0016] S31. Double-digest the pPIC9K vector and the IL-17D-g-lysozyme with restriction endonucleases respectively;
[0017] S32. Connect the double-digested pPIC9K vector and the IL-17D-g-lysozyme with T4 ligase to obtain the recombinant vector;
[0018] S33. Transfer the recombinant vector in S32 into Escherichia coli JM109 competent cells to obtain recombinant plasmid pPIC9K-IL-17D-g-lysozyme.
[0019] More preferably, step S31 is carried out in the following system:
[0020]
[0021] More preferably, step S32 is carried out in the following system:
[0022]
[0023] Preferably, S4 includes the following steps:
[0024] S41. Single-enzyme digest the recombinant plasmid pPIC9K-IL-17D-g-lysozyme with a restriction endonuclease;
[0025] S42. Prepare competent cells of Pichia pastoris GS115;
[0026] S43. Electrotransform the single-enzyme digested product in S41 into the competent cells of Pichia pastoris GS115.
[0027] More preferably, step S41 is carried out in the following system:
[0028]
[0029]
[0030] More preferably, the parameters for electrotransformation in S42 are: 2000V, 25μF, 200Ω.
[0031] Another object of the present disclosure is to provide an application of a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes. To achieve the above object, the present disclosure adopts the following technical solutions:
[0032] An application of a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes in inhibiting bacteria, wherein the recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes is obtained by the construction method described in any one of the foregoing.
[0033] Preferably, the bacteria include Streptococcus parauberis, Staphylococcus pasteuri, Staphylococcus epidermidis, Shewanella spp., Vibrio parahaemolyticus and Vibrio harveyi.
[0034] The technical solutions claimed by the present disclosure have achieved the following beneficial effects:
[0035] 1) For the first time, IL-17D is combined with g-lysozyme to obtain GS115 / pPIC9K-IL-17D-g-lysozyme. The recombinant protein obtained by using the Pichia pastoris expression system combines the advantages of the two genes and shows good antibacterial activity against Streptococcus parauberis, Staphylococcus pasteuri, Staphylococcus epidermidis, Shewanella spp., Vibrio parahaemolyticus and Vibrio harveyi, providing new treatment ideas and experimental basis for the clinical prevention and treatment of bacterial diseases.
[0036] 2) The resources of natural IL-17D and g-lysozyme are limited, and it is very difficult to obtain them in large quantities. The cost of obtaining them by artificial synthesis is too high. In the present disclosure, the target genes IL-17D and g-lysozyme are linked together by T2A using genetic engineering methods, cloned into the expression vector pPIC9K, and a recombinant vector with high-efficiency and stable expression is obtained. GS115 / pPIC9K-IL-17D-g-lysozyme is constructed by Pichia pastoris, providing a new way to obtain the target protein at low cost and in large quantities. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only the embodiments of the present disclosure. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained according to the provided drawings.
[0038] Figure 1 It is the map of the recombinant plasmid pPIC9K-IL-17D.
[0039] Figure 2 It is the map of the recombinant plasmid pPIC9K-g-lysozyme.
[0040] Figure 3 It is the map of the recombinant plasmid pPIC9K-IL-17D-g-lysozyme.
[0041] Figure 4 It is the gene fragment amplification results of pPIC9K-IL-17D, pPIC9K-g-lysozyme and pPIC9K-IL-17D-g-lysozyme.
[0042] Figure 5 It is the double digestion results of pPIC9K-IL-17D, pPIC9K-g-lysozyme and pPIC9K-IL-17D-g-lysozyme.
[0043] Figure 6 It is the single digestion results of GS115 / pPIC9K-IL-17D, GS115 / pPIC9K-g-lysozyme and GS115 / pPIC9K-IL-17D-g-lysozyme.
[0044] Figure 7 It is the PCR identification results of GS115 / pPIC9K-IL-17D, GS115 / pPIC9K-g-lysozyme and GS115 / pPIC9K-IL-17D-g-lysozyme.
[0045] Figure 8 Results of recombinant protein identification Detailed implementation manners
[0046] To make the objectives, technical solutions and beneficial effects of the embodiments in the present disclosure clearer, the following will clearly and completely describe the technical solutions in the embodiments of the present disclosure with reference to the accompanying drawings in the embodiments of the present disclosure. Apparently, the described embodiments are some but not all of the embodiments of the present disclosure. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present disclosure without creative efforts shall fall within the protection scope of the present disclosure.
[0047] The main kits / reagents used in this embodiment and their sources are as follows:
[0048] High-purity plasmid miniprep kit (DP104): Tiangen Biochemical Technology (Beijing) Co., Ltd.;
[0049] EasyGeno rapid recombinant cloning kit: Tiangen Biochemical Technology (Beijing) Co., Ltd.;
[0050] Ordinary DNA product purification kit (DP204): Tiangen Biochemical Technology (Beijing) Co., Ltd.;
[0051] Pfu DNA polymerase (EP101): Tiangen Biochemical Technology (Beijing) Co., Ltd.;
[0052] Not I 1166S: Takara Bio;
[0053] EcoR I 1040S: Takara Bio;
[0054] Sal I 1080S: Takara Bio.
[0055] The gene sequences of SEQ ID NO.1 - SEQ ID NO.9 disclosed in this embodiment are as follows:
[0056] SEQ ID NO.1
[0057] TACGTAGAATTCATGATGTCGCGGCGGACC
[0058] SEQ ID NO.2
[0059] CCGTTCTTTCATACTCGCCGGCGCTTAATT
[0060] SEQ ID NO.3
[0061] TACGTAGAATTCATGATGTCGCGGCGGACC
[0062] SEQ ID NO.4
[0063] TTATTTTTGATAATTCGCCGGCGCTTAATT
[0064] SEQ ID NO.5
[0065] TACGTAGAATTCATGATGTCGCGGCGGACC
[0066] SEQ ID NO.6
[0067] TTATTTTTGATAATTCGCCGGCGCTTAATT
[0068] SEQ ID NO.7
[0069] ATGTCGCGGCGGACCCGCGTCCTCCTCCTGCTGCTGCTGCACCTGGCTGGACTCCTGCTGGGCTGGCCAGCTGAAGCGGTCCGGGTACGGAAAAAGGCCACCAGAACCCGGTCTTGCATGGACCTACCGGAGGAGATCTTGGAGCAGATGTTCGGGCGTCTCTCGGTGGGAGTAATGAGCGCTTTCCACCATGCCCTGCAGCTGGAGCCACAGGACAAACTCAACCTGACCTGCCCGAACACCGCACGGTCCCCGACCGACCGTAAGACCCGCCTCCCGGTCAACCTGCTCAGCATCTCGCCCTGGGCCTACAGGATCTCCTACGACCCGACCAGGTATCCCCGCAACATCCCCGAGGCTTACTGCCTGTGTAAGGGCTGCCTGATCGGACCGCACCGTGCGGAGAGCGACCAGCACCGCAGCACTCCGGTCTACGCTCCGTCCGTCATCCTGAAGAGAACCGGCTCCTGCGTCGGCGGCCGTCACTCGTACACCGAGATCTACGTCTCCATCGCGGTGGGGTGCACCTGTGTGCCGCTGCTGGAGAAGGAGCGGAGCGGCCAGAGAGGCAACCAGAGCCTGGAGAGAGCGGAGCCCAAAGCCGGACGCCTCATCTCTGCGGGCAAGAAAGTATGA
[0070] SEQ ID NO.8
[0071] ATGGGTTATGGAAACATTATGAGGGTTCAAACTACCGGTGCATCAGAGAAAACATCTCAGCAGGACAAACTGGGATACTCAGGTGTGAAGGCATCACAAGCAATGGCAGAATTAGATGCAGGCCGAATGGAAAAGTACAGATCTAAAATCAACAGTGTTGGACGTAGATATGATATCGATCCAGCTCTCATCGCTGCAATCATCTCCAGAGAATCTAGGGCTGGAAATGCACTAACTAATGGATGGGGAGACTATAGCCCAGCGAGAGGACAATACAACGCCTGGGGACTGATGCAGGTTGATGTCAATCCGCAGGGAGGTGGACACACTGCAAAGGGCGCGTGGGACAGTGAGGAACACCTCTGCCAAGCTACTGGGATCTTGGTTCATTTCATCAAAGTGATTCGCAACAAATTTCCTGGCTGGAGCACAGAGGAGCAGCTGAAAGGAGGGATAGCAGCATACAATATGGGGGATGGAAGTGTCGAGGACAGAGATGTGGATAAAAACACAACAGGTAGCGACTACTCCAATGATGTTGTTGCCAGAGCTCAGTGGTACAAAAACAATAAAAACTATTAA
[0072] SEQ ID NO.9
[0073]
[0074] The construction method of the recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme provided by this embodiment is specifically carried out as follows:
[0075] I. Construction and identification of pPIC9K-IL-17D-g-lysozyme plasmid
[0076] 1. The IL-17D gene sequence SEQ ID NO.7 and the g-lysozyme gene sequence SEQ ID NO.8 were optimized according to the preferred codons of Pichia pastoris. The optimized IL-17D gene sequence SEQ ID NO.7 and the optimized g-lysozyme gene sequence SEQ ID NO.8 were ligated using T2A to obtain the IL-17D-g-lysozyme gene sequence SEQ ID NO.9 including the IL-17D gene and the g-lysozyme gene.
[0077] 2. The above IL-17D gene sequence SEQ ID NO.7, g-lysozyme gene sequence SEQ ID NO.8, and IL-17D-g-lysozyme gene were PCR amplified using their corresponding primers. The PCR amplification primers are shown in Table 1.
[0078] Table 1 Primers for amplifying target fragments
[0079]
[0080] 3. The vector pPIC9K and plasmids IL-17D, plasmid g-lysozyme, and plasmid 17D-g-lysozyme were double digested using restriction endonucleases NotⅠ and EcoRⅠ respectively. The digested products containing restriction endonucleases and other impurities were purified using a DNA recovery kit and stored at -20°C for later use. The products of double digestion of IL-17D, g-lysozyme, and 17D-g-lysozyme with the eukaryotic expression vector pPIC9K were recovered using the TIANGEN column gel recovery kit and stored at -20°C for later use. The double digestion reaction system is shown in Table 2.
[0081] Table 2 Double digestion reaction system
[0082]
[0083] Note: Reaction procedure: 37°C, 15 min; 4°C, 1 h
[0084] 4. Respectively ligate the plasmids IL-17D, g-lysozyme, and 17D-g-lysozyme obtained by gel extraction after double digestion with the eukaryotic expression vector pPIC9K using T4 ligase at 16°C overnight. Then transform them into competent Escherichia coli JM109 cells respectively to obtain the recombinant plasmids pPIC9K-IL-17D, pPIC9K-g-lysozyme, and pPIC9K-IL-17D-g-lysozyme. The ligation system used in this step is shown in Table 4.
[0085] Table 3 Ligation System
[0086]
[0087] 5. Take the overnight cultured bacterial solutions in 4, and perform PCR identification using the primers described in Table 1 respectively. Electrophorese the PCR amplification products using 1.0% agarose gel at 90V for 40 min. Observe the DNA electrophoresis bands with a gel imaging analyzer. The results of detecting the target fragments are pPIC9K-IL-17D, pPIC9K-g-lysozyme, and pPIC9K-IL-17D-g-lysozyme respectively.
[0088] Extract the recombinant plasmids from the bacterial solutions with positive PCR identification results. According to the restriction enzyme cleavage sites introduced upstream and downstream of the target fragment during primer design, perform double digestion identification of the recombinant plasmids using the restriction enzymes NotⅠ and EcoRⅠ. Perform nucleotide sequence determination on the recombinant plasmids that are positive in both bacterial solution PCR and digestion identification, and compare the sequencing results with the standard sequence in NCBI by BLAST.
[0089] The reaction systems for PCR identification and double digestion identification in this step are shown in Table 4 and Table 5 respectively.
[0090] Table 4 PCR Reaction System
[0091]
[0092] Note: Reaction program: 94°C, pre-denaturation for 5 min; 35 cycles (95°C, 45 s; 55°C, 45 s; 75°C, 1 min), extension at 72°C for 15 min; store at 4°C for reserve
[0093] Table 5 Double Digestion Reaction System
[0094]
[0095] Note: Reaction program: 37°C, 15 min; 4°C, 1 h
[0096] II. Construction and Identification of Recombinant Pichia pastoris GS115 / pPIC9K-IL-17D-g-lysozyme
[0097] 1. Use the restriction endonuclease SalⅠ to perform single digestion on the correctly sequenced recombinant plasmid pPIC9K-IL-17D-g-lysozyme. Purify and concentrate the single-digested product by ethanol precipitation method. Prepare GS115 competent cells according to the Pichia pastoris expression manual, and electrotransform pPIC9K-IL-17D-g-lysozyme into GS115 competent cells. Among them, the electrotransformation parameters are: 2000V, 25μF, 200Ω.
[0098] After electroporation, add 1 mL of ice-precooled sorbitol solution with a concentration of 1 mol / L, incubate at 30℃ for 1 h with static, take 200 μL and spread it on YPDS medium containing 100 μg / mL Zeocin, and incubate it upside down in a 30℃ constant temperature incubator for 3 - 4 d until single colonies appear. Pick single colonies and inoculate them into 5 mL of YPDZ medium, shake culture at 28℃ and 250 r / min for 18 h, extract yeast genomic DNA, and perform PCR verification using the universal primers 5'AOX1 / 3'AOX1.
[0099] Among them, the single-digestion reaction system and PCR reaction system in this step are shown in Tables 6 and 7.
[0100] Table 6 Single-digestion Reaction System
[0101]
[0102] Note: Reaction procedure: 37℃, 25 min; 4℃, 1 h, store at 4℃ for backup
[0103] Table 7 PCR Reaction System
[0104]
[0105] Note: Reaction procedure: 94℃, pre-denaturation for 5 min; 35 cycles (95℃, 45 s; 55℃, 45 s; 75℃, 1 min), extension at 72℃ for 15 min; store at 4℃ for backup
[0106] Construct and identify GS115 / pPIC9K-IL-17D and GS115 / pPIC9K-g-lysozym in the same way.
[0107] III. Recombinant Protein Expression
[0108] Single Pichia pastoris transformants GS115 / pPIC9K-IL-17D, GS115 / pPIC9K-g-lysozyme, and GS115 / pPIC9K-IL-17D-g-lysozyme were separately picked and cultured overnight at 28 °C and 250 r / min in 5 mL of YPD medium (Yeast Extract Peptone Dextrose Medium). 200 μL of the bacterial solution was pipetted and inoculated into 20 mL of BMGY liquid medium, and cultured at 28 °C and 250 r / min for 24 h. The glycerol in the bacterial solution was washed away by centrifugation and replacement with ice-precooled sterile distilled water, repeated 3 times, and all the bacteria were inoculated into 200 mL of BMMY liquid medium. Methanol was added to the medium to 0.5% every 24 h. After the induction culture was completed, the supernatant was collected.
[0109] IV. Detection of in vitro antibacterial activity of recombinant proteins
[0110] 1. The minimal inhibitory concentration (MIC) of the exogenous proteins IL-17D, g-lysozyme, and IL-17D-g-lysozyme obtained in (III) was determined by the two-fold dilution culture method. Three Gram-positive bacteria (Streptococcus parauberis, Staphylococcus pasteuri, Staphylococcus epidermidis) and three Gram-negative bacteria (Shewanella sp., Vibrio parahaemolyticus, Vibrio harveyi) were selected as the test indicator bacteria.
[0111] The test strains stored at -80 °C were thawed at room temperature, cultured overnight at the culture temperature shown in Table 8, and streaked on the corresponding agar medium. Single colonies were picked and inoculated into the corresponding fresh liquid medium, and cultured overnight at 200 rpm in a constant temperature shaking incubator until the exponential growth phase.
[0112] Then the bacterial solution was diluted with fresh liquid medium. A small amount of the bacterial solution was washed and resuspended 3 times with PBS buffer, and the OD600 was measured with an enzyme-linked immunosorbent assay (ELISA) reader to be 0.3. After adjusting the concentrations of the three proteins, they were serially diluted. First, 60 μl of the diluted bacterial solution was added to a 96-well plate, and then 20 μl of different concentrations of protein dilutions were added and mixed in a sterile 96-well plate, so that the final concentration of the recombinant protein in each well was 800, 400, 200, 100, 50, 25, 12.5, 6.25 μg / mL. The liquid in each well of the 96-well plate was thoroughly mixed with a pipette and incubated at an appropriate temperature for 24 h. The absorbance of the culture was measured at 600 nm with an ELISA reader to evaluate the inhibitory effect of the three recombinant proteins on bacterial growth, and three replicates were set for each sample.
[0113] Table 8 Growth conditions of strains
[0114]
[0115] V. Result Analysis
[0116] 1. Construction and Identification of pPIC9K-IL-17D, pPIC9K-g-lysozyme and pPIC9K-IL-17D-g-lysozyme Plasmids
[0117] The maps of recombinant plasmids pPIC9K-IL-17D, pPIC9K-g-lysozyme and pPIC9K-IL-17D-g-lysozyme are shown in the appendix Figure 1-3 . Using specific primers, with plasmids pPIC9K-IL-17D, pPIC9K-g-lysozyme and pPIC9K-IL-17D-g-lysozyme as templates respectively, the PCR products were detected by electrophoresis, and target bands of 667, 612 and 1254 bp (including partial vector sequences) were amplified respectively, which were consistent with the expectations (see Figure 4 ).
[0118] Double digestion identification was carried out with restriction endonucleases NotⅠ and Eco RⅠ. By electrophoresis, pPIC9K of 9263 bp, IL-17D gene fragment of 646 bp, g-lysozyme gene fragment of 592 bp and IL-17D-g-lysozyme gene fragment of 1234 bp were obtained. The target bands were consistent with the expectations (see Figure 5 ).
[0119] The sequencing results were compared with the standard sequences in NCBI by BLAST analysis. The results showed that there were no base mutations, additions or deletions.
[0120] 2. Construction and Identification of Recombinant Pichia pastoris GS115 / pPIC9K-IL-17D, GS115 / pPIC9K-g-lysozyme, GS115 / pPIC9K-IL-17D-g-lysozyme
[0121] Using restriction endonuclease Sal I to perform single digestion on the correctly sequenced recombinant plasmids pPIC9K-IL-17D, pPIC9K-g-lysozyme and pPIC9K-IL-17D-g-lysozyme respectively. 4 μL of the digested products were taken for agarose gel electrophoresis detection. The results showed that target fragments of 9909 bp, 9855 bp and 10497 bp were obtained respectively, and there were no other bands of different sizes, indicating complete digestion. The results are shown in Figure 6 .
[0122] The recombinant transformants GS115 / pPIC9K-IL-17D, GS115 / pPIC9K-g-lysozyme, and GS115 / pPIC9K-IL-17D-g-lysozyme were identified by colony PCR using the primers 5′AOX1 / 3′AOX1. After agarose gel electrophoresis detection and observing the electrophoresis results using a gel imaging system, bands with sizes of 5855 bp, 5798 bp, and 6436 bp were amplified respectively, which were consistent with the expected sizes. The results are shown in Figure 7 .
[0123] 3. Expression of recombinant protein
[0124] According to the electrophoresis results, obvious bands were observed at 23.56 kDa and 22.24 kDa for the proteins expressed in the GS115 / pPIC9K-IL-17D group and GS115 / pPIC9K-g-lysozyme group respectively. For the co-expression group of GS115 / pPIC9K-IL-17D-g-lysozyme, obvious bands were observed at both 23.56 kDa and 22.24 kDa, which were consistent with the expected sizes. The results are shown in Figure 8 .
[0125] 2.4 Detection of in vitro antibacterial activity of recombinant protein
[0126] The proteins expressed by recombinant Pichia pastoris had antibacterial activity against Streptococcus parauberis, Staphylococcus pasteuri, Staphylococcus epidermidis, Shewanella spp., Vibrio parahaemolyticus, and Vibrio harveyi. The minimum inhibitory concentrations of each bacterial solution are shown in Table 9. The antibacterial effect of the protein with dual-gene co-expression was significantly higher than that of the protein with single-gene expression.
[0127] Table 9 Minimum inhibitory concentrations of each bacterial solution
[0128]
[0129] In this disclosure, IL-17D and g-lysozyme were first combined to obtain GS115 / pPIC9K-IL-17D-g-lysozyme. The recombinant protein obtained using the Pichia pastoris expression system combined the advantages of the two genes and showed good antibacterial activity against Streptococcus parauberis, Staphylococcus pasteuri, Staphylococcus epidermidis, Shewanella spp., Vibrio parahaemolyticus, and Vibrio harveyi, providing new treatment ideas and experimental basis for the clinical prevention and treatment of bacterial diseases.
[0130] Due to the limited resources of natural IL-17D and g-lysozyme, it is extremely difficult to obtain them in large quantities, and the cost of artificial synthesis is too high. In the present disclosure, the target genes IL-17D and g-lysozyme are linked together by T2A using genetic engineering methods and cloned into the expression vector pPIC9K to obtain a recombinant vector with high-efficiency and stable expression. Through Pichia pastoris, GS115 / pPIC9K-IL-17D-g-lysozyme is constructed, providing a new way to obtain the target protein at low cost and in large quantities.
[0131] The above-described embodiments and application examples are only exemplary descriptions of the present disclosure and do not limit the scope of the present disclosure. Without departing from the design spirit of the present disclosure, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present disclosure shall fall within the protection scope determined by the claims of the present disclosure.
Claims
1. A method for constructing a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes, characterized in that, it comprises the following steps: S1. Optimize the IL-17D gene sequence and the g-lysozyme gene sequence according to the preferred codons of Pichia pastoris, and obtain the optimized IL-17D gene sequence SEQ ID NO.7 and the optimized g-lysozyme gene sequence SEQ ID NO.8 respectively; Connect the gene sequence SEQ ID NO.7 and the gene sequence SEQ ID NO.8 to obtain the IL-17D-g-lysozyme gene sequence SEQ ID NO.9; S2. Perform PCR amplification on the gene sequence SEQ ID NO.9; S3. Clone the gene obtained in S2 into the pPIC9K vector to obtain a recombinant vector; S4. Transform the recombinant vector into Pichia pastoris GS115 to obtain a recombinant Pichia pastoris GS115 / pPIC9K-IL-17D-g-lysozyme containing the gene sequence SEQ ID NO.7 and the gene sequence SEQ ID NO.
8.
2. The method for constructing a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes according to claim 1, characterized in that, in step S1, connect the gene sequence SEQ ID NO.7 and the gene sequence SEQ ID NO.8 through a T2A peptide.
3. The method for constructing a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes according to claim 1, characterized in that, S3 comprises the following steps: S31. Double digest the pPIC9K vector and the IL-17D-g-lysozyme with restriction endonucleases respectively; S32. Use T 4 to ligate the double-digested pPIC9K vector and the IL-17D-g-lysozyme with a ligase to obtain the recombinant vector; S33. Transfer the recombinant vector in S32 into Escherichia coli JM109 competent cells to obtain a recombinant plasmid pPIC9K-IL-17D-g-lysozyme.
4. The method for constructing a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes according to claim 3, characterized in that, step S31 is carried out in the following system:
5. The method for constructing a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes according to claim 3, characterized in that, step S32 is carried out in the following system:
6. The method for constructing a recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes according to claim 3, characterized in that, S4 comprises the following steps: S41. Single digest the recombinant plasmid pPIC9K-IL-17D-g-lysozyme with a restriction endonuclease; S42. Prepare Pichia pastoris GS115 competent cells; S43. Electrotransform the single digestion product in S41 into the Pichia pastoris GS115 competent cells.
7. The construction method of the recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes according to claim 6, characterized in that, step S41 is carried out in the following system:
8. The construction method of the recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes according to claim 6, characterized in that, the parameters of electroporation in S42 are: 2000V, 25μF, 200Ω.
9. Application of the recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes in inhibiting bacteria, characterized in that, the recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes is obtained by the construction method according to any one of claims 1 to 8.
10. Application of the recombinant Pichia pastoris co-expressing IL-17D and g-lysozyme genes according to claim 9 in inhibiting bacteria, characterized in that, the bacteria include Streptococcus parauberis, Staphylococcus pasteuri, Staphylococcus epidermidis, Shewanella spp., Vibrio parahaemolyticus and Vibrio harveyi.