Mutant sucrose phosphorylase and application thereof in catalytic synthesis of 2-O-alpha-glycerol glucoside

Abstract

The invention provides mutant sucrose phosphorylase and application thereof in catalytic synthesis of 2-O-alpha-glycerol glucoside, and belongs to the technical field of enzyme catalyst preparation, the mutant sucrose phosphorylase is obtained by point mutation of wild sucrose phosphorylase, and the amino acid sequence of the wild sucrose phosphorylase is as shown in SEQ ID NO.1; the mutant sucrose phosphorylase is characterized in that the mutation site of the mutant sucrose phosphorylase is selected from one or two of the following sites: V23L, D30S, V26L, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, E455K and R413L. The mutant sucrose phosphorylase with various different optimal reaction temperatures, high catalytic activity and strong thermal stability is provided, and high-yield and large-scale industrial production of 2-O-alpha-glycerol glucoside is realized under the conditions of different reaction temperatures, high substrate concentration and high viscosity.

Description

Technical Field

[0001] The present invention belongs to the technical field of enzyme catalyst preparation, and particularly relates to a mutant sucrose phosphorylase and its application in the catalytic synthesis of 2-O-α-glucosylglycerol. Background Art

[0002] The preparation of high-value natural products by biological methods has the advantages of environmental friendliness, simple operation mode, mild reaction conditions, etc. The preparation of 2-O-α-glycosylglycerol by biological methods is a synthesis method based on sucrose phosphorylase, which clones and expresses the sucrose phosphorylase gene in engineering bacteria and uses sucrose and glycerol as substrates. At present, the highest yield of 2-O-α-glycosylglycerol prepared by whole-cell catalysis is 351.8 g / L (Efficient 2-O-α-D-glucopyranosyl-sn-glycerol production by single whole-cell biotransformation through combined engineering and expression regulation with novel sucrose phosphorylase from Leuconostoc mesenteroides ATCC 8293, Bioresource Technology, 2023, 385, 129399). This method heterologously expresses the wild-type sucrose phosphorylase from Leuconostoc mesenteroides ATCC 8293 in Corynebacterium glutamicum, and the whole-cell catalytic reaction is carried out at 30 °C for 20 h, with a sucrose conversion rate of 98%. The whole-cell catalysis method has problems such as large substrate mass transfer resistance and poor cell stability. It is easy to breed miscellaneous bacteria during the enzyme-catalyzed reaction at 30 °C, resulting in a more cumbersome subsequent separation and purification process of the product. The highest yield of 2-O-α-glycosylglycerol prepared by the enzyme-catalysis method is 452 g / L (High-Yield Biosynthesis of Glucosylglycerol through Coupling Phosphorolysis and Transglycosylation Reactions, J. Agric. Food Chem, 2020, 68, 15249-15256.). This method constructs a double-enzyme cascade system composed of sucrose phosphorylase and glycosylglycerol phosphorylase. In a 100 mL reaction system, 2.4 M glycerol, 2 M sucrose, 40 U / mL sucrose phosphorylase, and 20 U / mL glycosylglycerol phosphorylase are added, and the reaction is carried out for 48 h, with a yield of 2-O-α-glycosylglycerol as high as 452 g / L. The preparation of 2-O-α-glycosylglycerol by double-enzyme cascade catalysis has great industrial application potential, but the total concentration of the two enzymes required for the catalytic reaction is 60 U / mL, resulting in a high industrialization cost, which is an urgent problem to be solved. Therefore, there is an urgent need for a sucrose phosphorylase with high catalytic activity and strong environmental adaptability to meet the needs of large-scale industrial production. Summary of the Invention

[0003] In view of this, the object of the present invention is to provide a mutant sucrose phosphorylase and its application in the catalytic synthesis of 2-O-α-glucoside; the present invention provides a variety of mutant sucrose phosphorylases with different optimal reaction temperatures, high catalytic activities and strong thermal stabilities, and realizes the high-yield and large-scale industrial production of 2-O-α-glucoside under different reaction temperatures, high substrate concentrations and high viscosity conditions.

[0004] The present invention provides a mutant sucrose phosphorylase, which is obtained by point mutation of wild-type sucrose phosphorylase, and the amino acid sequence of the wild-type sucrose phosphorylase is shown in SEQ ID NO.1;

[0005] The mutation sites of the mutant sucrose phosphorylase are selected from one or two of the following sites: V23L, D30S, V26L, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, E455K, R413L.

[0006] Preferably, when the mutation sites are two, the mutation sites are A55I / V23L, A55I / V70I, V93I / R413I, T264L / R404L or N191D / Q317E.

[0007] The present invention also provides the coding gene of the mutation site of the mutant sucrose phosphorylase (see Table 1).

[0008] The present invention also provides the application of the mutant sucrose phosphorylase in the catalytic synthesis of 2-O-α-glucoside.

[0009] The present invention also provides a method for catalytically synthesizing 2-O-α-glucoside by using mutant sucrose phosphorylase, which comprises the following steps:

[0010] Mix sucrose, mutant sucrose phosphorylase and glycerol to obtain a reaction system, and prepare 2-O-α-glucoside by enzymatic catalysis reaction;

[0011] The concentration of glycerol in the reaction system is 1-9.6 mol / L.

[0012] Preferably, the temperature of the reaction is 20°C to 60°C, the time of the reaction is 12 h to 72 h, the pH value of the reaction is 5 to 9; the volume of the reaction system is 5 to 50 L.

[0013] Preferably, the mutant sucrose phosphorylase is applied in the form of a crude enzyme solution, and the concentration of the mutant sucrose phosphorylase in the crude enzyme solution is 0.5-6 mg / mL.

[0014] Preferably, the concentration of sucrose in the reaction system is 1-8 mol / L.

[0015] Preferably, the method for preparing the crude enzyme solution of the mutant sucrose phosphorylase comprises the following steps:

[0016] 1) Transfer the plasmid containing the coding gene into Escherichia coli for expression, culture, and collection;

[0017] 2) Disrupt the bacterial cells and centrifuge to collect the supernatant to obtain the crude enzyme solution.

[0018] Compared with the prior art, the present invention has the following beneficial effects: By predicting and screening beneficial mutation sites, the present invention obtains a variety of mutant sucrose phosphorylases, which have significant advantages over the wild-type sucrose phosphorylase in terms of reaction temperature, catalytic activity, thermal stability, etc. The mutant sucrose phosphorylase provided by the present invention can achieve high-yield and large-scale industrial production of 2-O-α-glucosylglycerol under different reaction temperatures, high substrate concentrations, and high-viscosity conditions.

[0019] Furthermore, the mutant sucrose phosphorylase V93I / R413I provided by the present invention has an optimal reaction temperature as high as 50 °C, a temperature half-life of 50 min at 60 °C, and can almost completely convert 2.1 M sucrose and 2.52 M glycerol into 2-O-α-glucosylglycerol within 24 h in a 5 L enzymatic hydrolysis reaction tank, and the highest yield can reach 487 g / L; this mutant sucrose phosphorylase can tolerate high-temperature and high-viscosity reaction environments, and the reaction conditions are mild, efficient, green, and safe, showing a bright industrial prospect. Description of the Drawings

[0020] Figure 1 is the viscosity of the enzymatic hydrolysis reaction solution at different temperatures.

[0021] Figure 2 is the relative activity of the wild-type sucrose phosphorylase and the mutant sucrose phosphorylase at different temperatures. Detailed Embodiments

[0022] The present invention provides a mutant sucrose phosphorylase, which is obtained by point mutation of the wild-type sucrose phosphorylase. The amino acid sequence of the wild-type sucrose phosphorylase is shown in SEQ ID NO.1, specifically as follows:

[0023] MEIQNKAMLITYADSLGKNLKDVHQVLKEDIGDAIGGVHLLPFFPSTGDRGFAPADYTRVDAAFGDWADVEALGEEYYLMFDFMINHISRESVMYQDFKKNHDDSKYKDFFIRWEKFWAKAGENRPTQADVDLIYKRKDKAPTQEITFDDGTTENLWNTFGEEQIDIDVNSAIAKEFIKTTLEDMVKHGANLIRLDAFAYAVKKVDTNDFFVEPEIWDTLNEVREILTPLKAEILPEIHEHYSIPKKINDHGYFTYDFALPMTTLYTLYSGKTNQLAKWLKMSPMKQFTTLDTHDGIGVVDARDILTDDEIDYASEQLYKVGANVKKTYSSASYNNLDIYQINSTYYSALGNDDAAYLLSRVFQVFAPGIPQIYYVGLLAGENDIALLESTKEGRNINRHYYTREEVKSEVKRPVVANLLKLLSWRNESPAFDLAGSITVDTPTDTTIVVTRQDENGQNKAVLTADAANKTFEIVENGQTVMSSDNLTQN

[0024] The mutation sites of the mutant sucrose phosphorylase are selected from one or two of the following sites: V23L, D30S, V26L, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, E455K, R413L.

[0025] In the present invention, preferably, beneficial mutants of wild-type sucrose phosphorylase are predicted by a neural network model. Specifically, the prediction method of the neural network model includes: submitting the amino acid sequence of sucrose phosphorylase from Leuconostoc pseudomesenteroides on the online website https: / / protein.org.cn / ddg.html, outputting the DDG value after saturation mutation of each amino acid, selecting mutants with a DDG value greater than 0.5, performing PCR amplification, gel recovery, and transformation of the coding genes of the mutants to obtain mutant sucrose phosphorylase, and performing performance screening; thereby obtaining the above-mentioned mutant sucrose phosphorylase.

[0026] In the present invention, when there are two mutation sites, the mutation sites are preferably A55I / V23L, A55I / V70I, V93I / R413I, T264L / R404L, N191D / Q317E. In the specific implementation process of the present invention, the mutant sucrose phosphorylase V93I / R413I has a high optimal reaction temperature, a long half-life, and a high tolerance to substrate concentration.

[0027] The present invention also provides the coding gene of the mutant sucrose phosphorylase. In the present invention, the nucleotide sequence of the coding gene of the wild-type sucrose phosphorylase is as shown in WP_010279952.1 in the NCBI database, specifically as follows:

[0028] ATGGAAATCCAGAACAAAGCGATGCTGATTACCTATGCGGATAGCCTGGGCAAAAATCTGAAAGATGTGCATCAGGTGCTGAAAGAAGATATTGGCGATGCGATTGGCGGCGTGCATCTGCTGCCTTTTTTTCCGAGCACCGGCGATCGCGGTTTTGCGCCAGCAGATTATACCCGTGTTGATGCGGCGTTTGGCGATTGGGCGGATGTTGAAGCGCTGGGCGAAGAATATTATCTGATGTTTGATTTCATGATCAACCACATCAGCCGCGAGAGCGTGATGTATCAGGATTTTAAAAAAAACCACGACGACAGCAAGTACAAGGACTTCTTCATTCGCTGGGAGAAGTTTTGGGCGAAAGCGGGCGAAAATCGCCCGACCCAAGCGGATGTTGATCTGATTTATAAACGCAAAGACAAGGCGCCGACCCAGGAAATTACCTTTGATGATGGCACCACCGAAAATCTGTGGAATACCTTTGGCGAAGAACAGATTGATATTGACGTGAATAGCGCGATTGCGAAAGAATTTATTAAGACCACCCTGGAGGATATGGTGAAACATGGCGCGAATCTGATTCGCCTGGATGCGTTTGCGTATGCGGTGAAAAAAGTGGATACCAATGATTTCTTTGTGGAGCCGGAAATTTGGGACACCCTGAATGAAGTGCGCGAAATTCTGACCCCGCTGAAAGCGGAAATTCTGCCGGAAATTCATGAACATTATAGCATCCCGAAAAAGATCAACGACCATGGCTATTTTACCTACGATTTTGCGCTGCCGATGACCACCCTGTATACCCTGTATAGCGGCAAAACCAATCAGCTGGCGAAATGGCTGAAAATGAGCCCGATGAAACAGTTTACCACCCTGGATACCCATGATGGCATTGGCGTGGTGGATGCGCGCGATATTCTGACCGATGATGAAATTGATTATGCGAGCGAACAGCTGTATAAAGTGGGCGCGAATGTGAAAAAAACCTATAGCAGCGCGAGCTATAATAACCTGGATATTTATCAGATCAACAGCACCTACTACAGCGCGCTGGGCAATGATGATGCGGCGTATCTGCTGAGCCGCGTGTTTCAGGTTTTTGCGCCGGGTATTCCGCAGATTTATTATGTGGGCCTGCTGGCGGGCGAAAATGATATTGCGCTGCTGGAAAGCACCAAAGAAGGCCGCAATATTAATCGCCATTATTACACCCGCGAAGAGGTGAAAAGCGAAGTGAAACGCCCGGTGGTGGCGAATCTGCTGAAACTGTTGAGCTGGCGCAATGAAAGCCCGGCGTTTGATCTGGCGGGCAGCATTACCGTTGATACCCCGACCGATACCACCATTGTGGTGACCCGCCAAGATGAAAATGGCCAGAATAAAGCGGTGCTGACCGCGGATGCGGCGAATAAAACCTTTGAAATTGTGGAAAATGGCCAGACCGTGATGAGCAGCGATAATCTGACCCAGAATTAA

[0029] The coding gene of the mutant sucrose phosphorylase is obtained by mutation on the basis of WP_010279952.1, and the codons of the specific mutation sites are shown in Table 1.

[0030] The present invention also provides an application of the mutant sucrose phosphorylase in the catalytic synthesis of 2-O-α-glucoside glycerol.

[0031] The present invention also provides a method for catalytically synthesizing 2-O-α-glucoside glycerol by using mutant sucrose phosphorylase, which comprises the following steps: mixing sucrose, mutant sucrose phosphorylase and glycerol to obtain a reaction system, and preparing 2-O-α-glucoside glycerol by enzymatic catalytic reaction; the concentration of glycerol in the reaction system is 1-9.6 mol / L.

[0032] In the present invention, the mutant sucrose phosphorylase is applied in the form of crude enzyme solution, and the concentration of mutant sucrose phosphorylase in the crude enzyme solution is 0.5-6 mg / mL, preferably 1-3 mg / mL; in the present invention, the preparation method of the crude enzyme solution of the mutant sucrose phosphorylase comprises the following steps: 1) transferring the pET28a plasmid containing the coding gene into Escherichia coli for expression; 2) disrupting the bacterial cells and collecting the supernatant as the crude enzyme solution. The present invention has no special limitation on the specific method and parameters for transferring the coding gene into Escherichia coli for expression, and the conventional methods for transferring and expressing foreign genes in the art can be adopted. In the specific implementation process of the present invention, preferably, PCR is used to perform mutant amplification on the pET28a plasmid containing the wild-type sucrose phosphorylase gene, and the obtained pET28a plasmid containing the mutant sucrose phosphorylase gene is transferred into Escherichia coli for protein expression; then, preferably, high-pressure homogenization is used to disrupt Escherichia coli, and the supernatant is collected to obtain the crude enzyme solution.

[0033] In the present invention, sucrose, mutant sucrose phosphorylase and glycerol are mixed to obtain a reaction system, and 2-O-α-glucoside glycerol is prepared by enzymatic catalytic reaction. In the present invention, the concentration of sucrose in the reaction system is preferably 1-9 mol / L, more preferably 1-5 mol / L; the concentration of glycerol in the reaction system is preferably 5-7 mol / L.

[0034] In the present invention, the temperature of the reaction is 20°C to 60°C, preferably 40-50°C, and specifically can be 20, 30, 40, 50°C; the reaction time is preferably 12 h to 72 h, more preferably 24-60 h; the pH value of the reaction is preferably 5-9. In the present invention, the volume of the reaction system is preferably 5-50 L.

[0035] The technical solutions provided by the present invention are described in detail below with reference to the examples, but they should not be construed as limiting the protection scope of the present invention.

[0036] Example 1

[0037] In this example, a mutant of sucrose phosphorylase was constructed. Using the site-directed mutagenesis strategy, the pET28a plasmid containing the wild-type sucrose phosphorylase gene was used as the DNA template, and site-directed mutagenesis primers were designed using SnapGene software. The PCR system was as follows: 1.2 μL of upstream primer, 1.2 μL of downstream primer, 1 μL of plasmid, 11.6 μL of ultrapure water, and 15 μL of Primer starMax. The PCR program was: pre-denaturation at 95 °C for 3 min; denaturation at 98 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 1 min, for 29 cycles. The PCR product was digested with DMT restriction endonuclease, and the digested product was recovered by gel extraction and then transformed into competent Escherichia coli BL21(DE3). After resistance screening and sequencing verification, recombinant Escherichia coli BL21(DE3) expressing mutant sucrose phosphorylase was obtained.

[0038] The mutation sites of the mutant sucrose phosphorylase, as well as the corresponding amino acid sequences and nucleotide sequences, are shown in Table 1.

[0039] Table 1 Amino acid sequences and nucleotide sequences of mutation sites

[0040]

[0041] Example 2

[0042] In this example, the optimal temperatures of wild-type sucrose phosphorylase (WT) and different mutant sucrose phosphorylases were determined. The specific method was as follows: 500 μL of 1 mg / mL WT, V23L, D30S, V26L, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, E455K, R413L, A55I / V23L, A55I / V70I, V93I / R413I, T264L / R404L, N191D / Q317E were respectively added to the reaction system, 200 μL of deionized water, 150 μL of 6 M glycerol, and 150 μL of 5 M sucrose. The reactions were carried out in a metal bath at 20 °C, 30 °C, 40 °C, 50 °C, and 60 °C for 30 min, and the reactions were terminated at 100 °C for 10 min. During the reaction, the viscosities of the reaction system at different reaction temperatures were measured, and the results are as Figure 1 shown; the peak areas of 2-O-α-glucosylglycerol in the supernatant were detected by HPLC (75% acetonitrile, RID-20A detector, Honey amino column, flow rate 1 mL / min, column temperature 40 °C), and the relative activities of wild-type and different mutant sucrose phosphorylases at different temperatures were calculated based on the product peak areas ( Figure 2 ) as shown in Table 2. The optimal temperature of WT was 30 °C, and the optimal temperature of V93I / R413I was 50 °C. The optimal temperature of sucrose phosphorylase changed significantly after mutation.

[0043] Table 2 Optimal Temperatures of Wild-Type Sucrose Phosphorylase and Mutant Sucrose Phosphorylase

[0044]

[0045]

[0046] Example 3

[0047] In this example, the half-life curves of wild-type sucrose phosphorylase (WT), mutant sucrose phosphorylases V23L, D30S, V26L, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, E455K, R413L, A55I / V23L, A55I / V70I, V93I / R413I, T264L / R404L, and N191D / Q317E at 60 °C were determined. The specific method was as follows: 500 μL of 1 mg / mL WT, V23L, D30S, V26L, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, E455K, R413L, A55I / V23L, A55I / V70I, V93I / R413I, T264L / R404L, and N191D / Q317E were taken and placed in a 60 °C metal bath for 0 min, 10 min, 20 min, 30 min, 40 min, 50 min, and 60 min respectively. After being placed for different times, 200 μL of deionized water, 150 μL of 6 M glycerol, and 150 μL of 5 M sucrose were added to the reaction system, and the reaction was carried out for 30 min at the optimal temperature (the optimal temperature determined in Table 2 of Example 2), and the reaction was terminated at 100 °C for 10 min. The content of 2-O-α-glucoside in the supernatant was detected by HPLC (75% acetonitrile, RID-20A detector, Honey amino column, flow rate 1 mL / min, column temperature 40 °C). The relative activity of the 0 min group was defined as 100%, and the relative activities of wild-type sucrose phosphorylase and mutant sucrose phosphorylases at different times were calculated. The time when the relative activity was 50% was the temperature half-life. As shown in Table 3, the calculated temperature half-lives of WT, V23L, V26L, D30S, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, R413L, E455K, A55I / V23L, A55I / V70I, V93I / R413I, T264L / R404L, and N191D / Q317E were 20 min, 24 min, 18 min, 39 min, 23 min, 30 min, 16 min, 20 min, 58 min, 28 min, 18 min, 60 min, 47 min, 55 min, 16 min, 60 min, 40 min, and 16 min. The temperature half-lives of R413 and V93I / R413I were 60 min, which was 300% of that of WT, and the other mutants all had varying degrees of improvement.

[0048] Table 3 Half-lives of wild-type sucrose phosphorylase and mutant sucrose phosphorylases at 60 °C

[0049]

[0050]

[0051] Example 4

[0052] In this example, the yields of 2-O-α-glucoside prepared by wild-type sucrose phosphorylase (WT), mutant sucrose phosphorylases V23L, D30S, V26L, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, E455K, R413L, A55I / V23L, A55I / V70I, V93I / R413I, T264L / R404L, and N191D / Q317E at high substrate concentrations were determined. The specific method was as follows: In a 5 L enzymatic hydrolysis reaction tank, 1.5 L of crude enzyme solutions of 2 mg / mL WT, V23L, D30S, V26L, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, E455K, R413L, A55I / V23L, A55I / V70I, V93I / R413I, T264L / R404L, and N191D / Q317E were added respectively, 2693.25 g of sucrose, and 870 g of glycerol. The total reaction volume was 3 L. The reaction was carried out at the optimal temperature (the optimal temperature determined in Table 2 of Example 2) for 48 h, and the reaction was terminated by sampling at 100 °C for 10 min. The content of 2-O-α-glucoside in the supernatant was detected by HPLC (75% acetonitrile, RID-20A detector, Honey amino column, flow rate 1 mL / min, column temperature 40 °C). As shown in Table 4, the yield of 2-O-α-glucoside catalyzed by V93I / R413I was the highest, reaching 487 g / L, which was 1.85 times that of WT.

[0053] Table 4 Yields of 2-O-α-glucoside by wild-type sucrose phosphorylase and mutant sucrose phosphorylases

[0054]

[0055] Example 5

[0056] In this example, the yields of 2-O-α-glucoside prepared by wild-type sucrose phosphorylase (WT), mutant sucrose phosphorylases A55I / V23L, V93I / R413I, and T264L / R404L at high substrate concentrations were determined. The specific method was the same as that in Example 4, except that the addition amount of sucrose was 5386.5 g and the addition amount of glycerol was 1740 g.

[0057] The results are shown in Table 5. The yield of 2-O-α-glucoside catalyzed by V93I / R413I was the highest, reaching 486 g / L, which was 1.88 times that of WT.

[0058] Table 5 Yields of 2-O-α-glycosylglucose by wild-type sucrose phosphorylase and mutant sucrose phosphorylases

[0059]

[0060] Example 6

[0061] In this example, the yields of 2-O-α-glycosylglucose prepared by wild-type sucrose phosphorylase (WT), mutant sucrose phosphorylases A55I / V23L, V93I / R413I, and T264L / R404L at high substrate concentrations were determined. The specific method was the same as that in Example 4, except that the addition amount of sucrose was 8079.75 g and the addition amount of glycerol was 2610 g.

[0062] The results are shown in Table 6. The yield of 2-O-α-glycosylglucose catalyzed by V93I / R413I was the highest, reaching 487 g / L, which was 1.84 times that of WT.

[0063] Table 6 Yields of 2-O-α-glycosylglucose by wild-type sucrose phosphorylase and mutant sucrose phosphorylases

[0064]

[0065] As can be seen from the above examples, the various mutant sucrose phosphorylases provided by the present invention have significant improvements in terms of reaction temperature, catalytic activity, thermal stability, etc., compared with the wild-type sucrose phosphorylase. In particular, the optimal temperature of the mutant sucrose phosphorylase V93I / R413I is as high as 50 °C and it has strong thermal stability, enabling the high-yield preparation of 2-O-α-glycosylglucose at extremely high substrate concentrations, and has broad application prospects.

[0066] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can still be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A mutant sucrose phosphorylase, characterized in that: The mutant sucrose phosphorylase is obtained by point mutation of wild-type sucrose phosphorylase, and the amino acid sequence of the wild-type sucrose phosphorylase is shown in SEQ ID NO.1; The mutation site of the mutant sucrose phosphorylase is selected from one or two of the following sites: V23L, D30S, V26L, A55I, V70I, V93I, N191D, T264L, Q317E, R404L, E455K, and R413L.

2. The mutant sucrose phosphorylase according to claim 1, characterized in that When there are two mutation sites, the mutation sites are A55I / V23L, A55I / V70I, V93I / R413I, T264L / R404L or N191D / Q317E.

3. A gene encoding the mutant sucrose phosphorylase according to claim 1 or 2.

4. Use of the mutant sucrose phosphorylase according to claim 1 or 2 and the encoding gene according to claim 3 in catalyzing the synthesis of 2-O-α-glycerol glucoside.

5. A method for synthesizing 2-O-α-glycerol glucoside using mutant sucrose phosphorylase, characterized in that: The following steps are involved: Sucrose, mutant sucrose phosphorylase and glycerol are mixed to obtain a reaction system, and 2-O-α-glycerol glucoside is prepared by enzyme-catalyzed reaction; The concentration of the glycerol in the reaction system is 1-9.6 mol / L.

6. The method according to claim 5, characterized in that The reaction temperature is 20° C. to 60° C., the reaction time is 12 h to 72 h, the reaction pH is 5 to 9, and the volume of the reaction system is 5 to 50 L.

7. The method according to claim 5, characterized in that The mutant sucrose phosphorylase is used in the form of a crude enzyme solution, and the concentration of the mutant sucrose phosphorylase in the crude enzyme solution is 0.5-6 mg / mL.

8. The method according to claim 6 or 7, characterized in that: The concentration of the sucrose in the reaction system is 1-8 mol / L.

9. The method according to claim 7, characterized in that: The method for preparing the crude enzyme solution of the mutant sucrose phosphorylase comprises the following steps: 1) transferring the coding gene of claim 3 into Escherichia coli for expression; 2) Break the bacterial cells and collect the supernatant as the crude enzyme solution.

Images