Rhodosporidium toruloides strain with high homologous recombination efficiency as well as construction method and application of rhodosporidium toruloides strain

Abstract

The invention discloses a rhodosporidium toruloides strain with high homologous recombination efficiency as well as a construction method and application thereof, and belongs to the field of oil-producing yeast engineering bacteria. According to the rhodosporidium toruloides strain, the rhodosporidium toruloides strain NP11-SaCas9-1 is used as an original strain, and an RAD52 gene is over-expressed. The modified yeast engineering bacterium provided by the invention can realize high homologous recombination through CRISPR system mediation, the homologous recombination efficiency reaches 90-100%, a multi-gene editing platform can be constructed on the basis, and the modified yeast engineering bacterium can be applied to the fields of synthetic biology, metabolic engineering, genetic engineering and the like, so that the modified yeast engineering bacterium is simpler, quicker, more convenient and more accurate in the genetic modification process. And the homologous recombination activity of the rhodosporidium toruloides can be improved by expressing the homologous recombination related protein Rad52, and the genetic engineering strategy can be used for modifying other unconventional yeasts.

Description

Technical Field

[0001] The present application relates to a Rhodosporidium toruloides strain with high homologous recombination efficiency, a construction method thereof and applications, and belongs to the field of oleaginous yeast engineering bacteria. Background Art

[0002] In the current situation where fossil energy is increasingly exhausted, the development of environmentally friendly renewable energy has become an urgent task. Yeast is considered to be an ideal oil-producing host. Among them, Rhodosporidium toruloides can use cheap agricultural wastes and other biomass as substrates, further reducing the cost of yeast oil production, and can produce downstream high-value-added products such as carotenoids and terpenoid compounds, having broad industrial application prospects. To improve its production traits and optimize its metabolic pathways, an effective genetic operation system needs to be established. In recent years, multiple omics information of R. toruloides has been obtained, and genetic operation methods of R. toruloides based on Agrobacterium tumefaciens-mediated transformation (ATMT), electroporation transformation (ET), and CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats-Cas9 Systems) have been established. Currently, random gene insertion and knockout can be achieved (FEMS Yeast Res. 2020; 20(5): foaa038.).

[0003] With the development of technology, people's understanding of the essence of genes has become increasingly profound. The method of studying the genotype based on the phenotype of organisms can no longer meet the needs of scientific development, and it has gradually entered the stage of reverse genetics. Gene knockout of the target gene through homologous recombination is a basic means of studying the function of the target gene. One of the main advantages of the model organism Saccharomyces cerevisiae as the preferred host for producing various chemicals is that its homologous recombination efficiency can approach 100%, and homologous arms of 40 - 60 bp can be used for precise gene targeting and control of the integration site, thereby reducing the chance of disrupting essential genes for growth (World J Microbiol Biotechnol. 2019; 35(7): 111.). Gene targeting technology is mainly based on homologous recombination (HR) and is a conventional method for targeted mutagenesis and gene knock-in strategies. However, efficient targeted gene integration in non-conventional yeasts is more difficult compared to model organisms: in non-conventional yeasts, non-homologous end joining (NHEJ) is usually superior to homologous recombination (HR), which often leads to the integration of the expression cassette into a random locus (Biotechnol Adv. 2021; 47: 107695.). Similarly, in Rhodosporidium toruloides, the NHEJ mechanism dominates and the homologous recombination efficiency is very low, which is the main reason for the low gene targeting efficiency in this species (Biotechnol Lett. 2017; 39(7): 1001 - 1007.). Therefore, one strategy to improve the homologous recombination efficiency of Rhodosporidium toruloides is to improve the homologous recombination pathway, and another strategy is to inhibit or eliminate the non-homologous recombination pathway, thereby forcing the transformed DNA to integrate into the yeast chromosome through HR to achieve stable expression. Koh et al. first reported the establishment of an efficient targeted gene deletion method in R. toruloides ATCC 10657 (MAT a), constructing a Ku70-deficient mutant strain. When using a homologous sequence length of at least 1 kb, more than 90% of the transformants could achieve true knockout (BMC Microbiol. 2014; 14: 50.). However, the transformants of the KU70 gene knockout strain would be greatly reduced, and there was a possibility of large fragment loss at the chromosome ends (FEMS Yeast Res. 2018; 18(7): foy074.). Therefore, improving the homologous recombination efficiency without interfering with NHEJ is an urgent need for constructing the Rhodosporidium toruloides cell factory.

[0004] In summary, constructing an engineered strain with improved homologous recombination is an essential part of the synthetic biology transformation research of Rhodotorula, further improving the genetic operation platform, and providing new tools and ideas for carrying out related industrial applications using its unique properties. Summary of the Invention

[0005] According to one aspect of the present application, there is provided a Rhodosporidium toruloides strain with high homologous recombination efficiency, and the homologous recombination efficiency reaches 90-100%. It solves the problems of low homologous recombination efficiency of Rhodosporidium toruloides itself and stability problems caused by disrupting the non-homologous end joining mechanism. A multi-gene editing platform can be constructed based on this, and it can be applied to fields such as synthetic biology, metabolic engineering, and genetic engineering, making it more concise, rapid, convenient, and accurate in the genetic transformation process. Moreover, it is confirmed that the homologous recombination activity of Rhodosporidium toruloides can be improved by expressing the homologous recombination-related protein Rad52, and this genetic engineering strategy can be used to transform other unconventional yeasts.

[0006] The Rhodosporidium toruloides strain with high homologous recombination efficiency described in the present application uses the Rhodosporidium toruloides strain NP11-SaCas9-1 as the starting strain and overexpresses the RAD52 gene.

[0007] The Rhodosporidium toruloides strain NP11-SaCas9-1 has established a CRISPR / Cas9 system.

[0008] For the Rhodosporidium toruloides strain NP11-SaCas9-1 described in the present application and the promoter and vector construction method used for the knockout vector, reference can be made to the records in the literature Biotechnol J. 2019; 14(7): e1900036 and the patent 201910005293.5.

[0009] Optionally, the RAD52 gene is derived from the RAD52 gene of Saccharomyces cerevisiae S288C or the RAD52 gene of Rhodosporidium toruloides NP11;

[0010] The GeneBank number of the RAD52 gene of Saccharomyces cerevisiae S288C is: NC_001145.3;

[0011] The GeneBank number of the RAD52 gene of Rhodosporidium toruloides NP11 is: RHTO_00644.

[0012] Optionally, the DNA fragment containing the RAD52 gene also contains a promoter, a resistance gene, and a terminator.

[0013] Optionally, the promoter is selected from P GPD 、P FBA 、P PGK 、P PGI 、P TPI 、P LDP 、P ACC 、P FAS 、P THI 、P CTR 、P DAO 、P NAR 、PICL , P MET , P ADH2 , P PHO89 , P GAL1 One of them; preferably, the promoter is P PGK or P ADH2 .

[0014] Optionally, the terminator is selected from T GPD , T HSP , T NOS , T 35S , T SV40 One of them; preferably, the terminator is T HSP .

[0015] The above gene elements can be obtained by PCR amplification using the Rhodosporidium toruloides genome as a template or by artificial gene synthesis.

[0016] Optionally, the resistance gene is selected from one or more of the nourseothricin resistance gene (NAT), bleomycin resistance gene (BLE), hygromycin resistance gene (HYG), geneticin resistance gene (NEO), green fluorescent protein (GFP), red fluorescent protein (mRuby2), luciferase (Luc) (FEMS Yeast Res. 2020, 20(5): foaa038).

[0017] Optionally, the DNA fragment containing the RAD52 gene is selected from P PGK -ScRAD52-P2A-NAT-T HSP , P PGK -NAT-T NOS , P ADH2 -ScRAD52-T HSP , P PGK -RtRAD52-P2A-NAT-T HSP , P PGK -NAT-T NOS , P ADH2 -RtRAD52-T HSP Any one or more of them.

[0018] Optionally, the nucleotide sequence of the ScRAD52 gene is as shown in SEQ ID NO.1.

[0019] Another aspect of the present application provides a method for constructing the Rhodosporidium toruloides strain, including the following steps:

[0020] (1) The Cas9 nuclease gene was randomly integrated into the genome of Rhodosporidium toruloides NP11, and the expression of Cas9 protein was verified by protein expression verification to obtain the Rhodosporidium toruloides strain NP11-SaCas9-1;

[0021] (2) The RAD52 gene was introduced into the genome of the strain NP11-SaCas9-1 obtained in step (1) to obtain the strain SAS52, which is the Rhodosporidium toruloides strain.

[0022] Optionally, the Cas9 nuclease gene is derived from Staphylococcus aureus, and after optimization according to the codon preference of Rhodosporidium toruloides, it is commissioned to be synthesized by Suzhou Hongxun Company.

[0023] The synthesis method is as follows:

[0024] The SaCas9 fragment was amplified by corresponding primers, and then the target fragment and the target vector pZPK-P PGK -Ble-T NOS -P GPD -mcs-T HSP were digested with EcoRV / SpeI double enzymes, and then ligated by the DNALigation Kit to obtain pZPK-P PGK -BLE-T NOS -P GPD -SaCas9-T HSP . The vector obtained by digestion and ligation was directly transformed into electrocompetent Escherichia coli. The details are recorded in the literature Biotechnol J. 2019; 14(7): e1900036.

[0025] Optionally, the introduction method is selected from any one of Agrobacterium tumefaciens-mediated transformation method, electroporation, lithium acetate transformation, and protoplast transformation.

[0026] Another aspect of the present application provides an application of the Rhodosporidium toruloides strain in integrating genes of heterologous synthesis pathways.

[0027] Optionally, when integrating genes of heterologous synthesis pathways, homologous recombination is used for integration, and the length of the homologous arm used for homologous recombination is 1000 bp.

[0028] A method for modifying a Rhodosporidium toruloides strain, comprising the following steps:

[0029] (1) Construct an sgRNA(Sa) vector carrying donor DNA: Using the genomic DNA of Rhodosporidium toruloides NP11 as a template, fragments UP and DN were amplified by primers respectively, and then the fragments were cloned by RF and integrated into the plasmid pZPK-PGPD -HYG-Tnos-P 5S-tRNA - onto -X-sgRNA(Sa), to obtain plasmid pZPK-UP-P with donor DNA GPD -HYG-Tnos-DN-P 5S-tRNA - onto -X-sgRNA(Sa), and linearize the vector by PCR amplification;

[0030] (2) Overexpress the knockout vector with the above donor DNA by lithium acetate transformation, and screen for the target recombinant bacteria by PCR.

[0031] Optionally, step (1) is specifically: using Rhodosporidium toruloides genomic DNA as a template, amplify two fragments UP and DN of about 1000 bp respectively through primers. Then clone the fragments by RF and integrate them into plasmid pZPK-P GPD -HYG-Tnos-P 5S-tRNA - onto -X-sgRNA(Sa), to obtain plasmid pZPK-UP-P with donor DNA GPD -HYG-Tnos-DN-P 5S-tRNA - onto -X-sgRNA(Sa), and linearize the vector by PCR amplification;

[0032] Optionally, step (2) includes: picking monoclonal colonies, culturing, centrifuging, washing with water, resuspending to obtain competent cells; removing the supernatant, resuspending, incubating, heat shocking, collecting cells, culturing to obtain transformants, and verifying positive strains by PCR.

[0033] Optionally, the specific process of step (2) is: pick monoclonal colonies from a fresh YPD plate and culture them overnight in 5 mL YPD; transfer to 100 mL fresh YPD medium until OD = 0.2, and culture for 4 - 6 h until OD 600Reach 0.6 - 1.0; centrifuge the bacterial liquid at 4000g for 5 min, wash twice with sterile water, wash once with 10 mL of 100 mM LiAc (pH 7.6), and then resuspend with 1 mL of 100 mM LiAc (pH 7.6) to obtain competent cells; remove the supernatant at 8000g for 30 s, resuspend with the pre-prepared mixture [240 μl PEG3350, 36 μl 1M lithium acetate, 10 μl 10 mg / ml salmon sperm DNA, 1 - 2 μg linear DNA, and ddH2O to 360 μL], incubate at 30 °C / 200 rpm for 30 min; add 36 μL of DMSO to the system, heat shock at 37 °C for 60 min, collect the cells, wash once with YPD, resuspend in 2 mL of YPD, and incubate at 30 °C / 200 rpm overnight; collect the cells, resuspend in 200 μL of YPD, and spread. Incubate at a constant temperature of 30 °C for 3 - 4 days to obtain transformants. Verify by PCR to obtain positive strains.

[0034] This application provides a new reporter gene ADE2 in Rhodosporidium toruloides. ADE2 encodes phosphoribosylaminoimidazole carboxylase in the sixth step of the yeast purine biosynthesis pathway. Mutations in this gene produce red or pink colonies. Because in mutants, pigments related to adenine synthesis accumulate in the vacuole, making the yeast colonies show characteristic red. Rhodosporidium toruloides itself is red. After knocking out the ADE2 gene (GeneBank: RHTO_02297), the colonies show rust red, which is darker than red and can be clearly distinguished from the red of Rhodosporidium toruloides itself. Use the CRISPR / Cas9 system to knock out this site. The gene target site Protospacer sequence (CCGCGCTCAAGGAGGTTGCGG) and sgRNA (Sa) are obtained by artificial gene synthesis, and the vector pZPK-P used is obtained by RF cloning with specific primers designed. GPD -HYG-Tnos-P 5S-tRNA -ade2.1-sgRNA(Sa). Introduce the plasmid constructed above into Rhodosporidium toruloides NP11-SaCas9-1. Through phenotypic screening and PCR verification, knockout strains are obtained. The change in this color phenotype is obvious and can be used as a reporter gene.

[0035] The beneficial effects that this application can produce include:

[0036] The engineered yeast strain provided by this application can achieve high homologous recombination mediated by the CRISPR system, with a homologous recombination efficiency of 90-100%. A multi-gene editing platform can be constructed based on this, and it can be applied to fields such as synthetic biology, metabolic engineering, and genetic engineering, making the genetic modification process more concise, rapid, convenient, and accurate. It has also been demonstrated that the homologous recombination activity of Rhodosporidium toruloides can be improved by expressing the homologous recombination-related protein Rad52, and this genetic engineering strategy can be used to modify other unconventional yeasts. Brief Description of the Drawings

[0037] Figure 1 It is a schematic diagram of the knockout vector in Example 3 of this application.

[0038] Figure 2 It is the homologous recombination efficiency at different sites in this application.

[0039] Figure 3 It is the PCR result in Example 2 of this application.

[0040] Figure 4 It is the sequencing result in Example 2 of this application.

[0041] Figure 5 It is a schematic diagram of the metabolism of the mevalonate pathway in R. toruloides of this application. Detailed Description of the Embodiments

[0042] The following describes this application in detail with reference to the embodiments, but this application is not limited to these embodiments.

[0043] The haploid NP11 strain of Rhodosporidium toruloides was deposited at the Guangdong Provincial Microbial Culture Collection Center on September 16, 2020, with the deposit number GDMCC No. 2.224 and the taxonomic name Rhodosporidium toruloides. This strain has been publicly reported in the literature Nat Commun. 2012; 3: 1112.

[0044] Escherichia coli is used to construct and clone plasmid vectors, and Agrobacterium tumefaciens is used for Agrobacterium-mediated transformation. Escherichia coli is cultured in LB medium, and the formula is: yeast extract 5 g / L, tryptone 10 g / L, sodium chloride 10 g / L. Rhodosporidium toruloides is cultured in YPD medium, and the formula is: glucose 20 g / L, peptone 20 g / L, yeast extract powder 10 g / L. The culture conditions for the strains are: Escherichia coli is cultured at 37 °C, and yeasts and other fungi are cultured at 30 °C. When cultured in liquid, the shaking speed of the shaker is 200 rpm.

[0045] All plasmid construction methods use RF cloning: Using a vector with a known complete sequence, insert the sequence of the target fragment you need into a specific site on the vector or replace the target fragment of others on the vector to obtain the complete sequence of the target construction vector (J Biochem Biophys Methods. 2006; 67(1): 67-74.), and then pick colonies for PCR verification and sequencing verification.

[0046] In all the primer synthesis and sequencing work in the following examples, if not otherwise specified, they were all completed by Shanghai Sangon Biotech Co., Ltd. The experimental methods in the following examples are all conventional methods if not otherwise specified. The experimental materials used in the following examples were all purchased from regular biochemical reagent companies if not otherwise specified.

[0047] Example 1: Construction, screening and application of haploid engineering bacteria of Rhodosporidium toruloides expressing the recombinant enzyme RAD52 gene

[0048] (1) Construction of gene vectors related to homologous recombination:

[0049] The target vector was constructed by the RF cloning method.

[0050] Using the primers ADH2-ScRAD52-F, the sequence is shown in SEQ ID NO.2, (5’-CGTCTAGCTGACAGCTGCCACGTCTCCGACAGTCACAGATATCATGCACCA CCATCACCATCACAATGAAATTATG-3’) and ScRAD52-THSP-R, the sequence is shown in SEQ ID NO.3, (5’-GGCGTGGCTACACAGGTCGGATGCGAGGTGAGACGGGGCGGAATCGTAGT AGGCTTGCGTGCATGC-3’) to amplify the RAD52 (GenBank: NC_001145.3) gene from Saccharomyces cerevisiae S288C, and the expression cassette vector formed by connecting with the promoter P ADH2 and the terminator T HSP is pZPK-P PGK -NAT-T NOS -P ADH2 -ScRAD52-T HSP .

[0051] RF cloning method: Take 200 ng of the amplified fragment as the large primer for RF cloning, 50 ng of the target vector as the template, 25 μL of PrimeSTAR MAX, and supplement ddH2O to a total volume of 50 μL. The PCR program is as follows: pre-denaturation at 95°C for 5 min, 95°C for 10 s, 65°C for 15 s, 72°C for x min (determine the extension time x according to the size of the target vector, at a rate of 1 kb / min), decrease by 1°C per cycle, for a total of 10 cycles. Continue with 95°C for 10 s, 55°C for 15 s, 72°C for x min (determine the extension time x according to the size of the target vector, at a rate of 1 kb / min), for a total of 6 cycles, 72°C for 10 min, and finally hold at 4°C.

[0052] Digestion of RF cloning products: Add 1 μL of buffer and 1 μL of DpnI (20 U / μL) to 8 μL of RF cloning products, and digest at 37°C for 30 min. Electroporate 10 μL of the PCR digestion products into DH10B competent cells. The competent cells are prepared by the standard method (Molecular Cloning: A Laboratory Manual, Third Edition, written by Sambrook et al., translated by Huang Peitang et al., published by Science Press). Electroporation parameters: 2200 - 2500 V, 400 Ω, 25 uF, 0°C, 4 - 8 ms. Select Kan-resistant transformants for enrichment culture, plasmid extraction, and use primers ScRAD52-F, with the sequence shown in SEQ ID NO.4, (5’AAGAAGGCAATTGACTAAAGT-3’) and ScRAD52-R, with the sequence shown in SEQ ID NO.5, (5’TACTTGATTCCCAGCCCCTTCT-3’) for colony PCR identification. The positive recombinant vectors identified are sent for sequencing to obtain the correct vectors.

[0053] (2) Transformation of haploid strains of Rhodosporidium toruloides with homologous recombination-related genes

[0054] Use a plasmid extraction kit to extract the vector plasmid pZPK-P PGK -NAT-T NOS -P ADH2 -ScRAD52-T HSP constructed successfully in Escherichia coli described in (1), and then introduce it into Agrobacterium competent AGL1 by electroporation. The Agrobacterium transformants containing the recombinant plasmid are transformed by Agrobacterium-mediated transformation (ATMT) with the expression cassette pZPK-P PGK -NAT-T NOS -P ADH2 -ScRAD52-T HSPThe Rhodosporidium toruloides cells NP11-SaCas9-1 were separately introduced and integrated with its chromosome (FEMS Yeast Res. 2014; 14(4): 547-555.), and screened on YPD plates containing 50 μg / mL nourseothricin. The obtained transformants were subcultured for 5 generations for stability verification; then the genomic DNA of the stably passaged engineered strain was extracted; the genomic DNA was amplified using the upstream and downstream primers of the gene ScRAD52-F, the sequence of which is shown in SEQ ID NO.4, (5’AAGAAGGCAATTGACTAAAGT-3’) and ScRAD52-R, the sequence of which is shown in SEQ ID NO.5, (5’TACTTGATTCCCAGCCCCTTCT-3’) to obtain the target engineered bacteria with correct insertion.

[0055] Example 2: Construction of different homologous vectors

[0056] (1) Construction of uracil auxotrophic vector

[0057] The URA3 (GeneBank: RHTO_02309) gene encodes orotidine-5’-monophosphate decarboxylase (OMP decarboxylase), which can convert orotidine-5’-monophosphate (OMP) into uridine-5’-monophosphate (UMP). This reaction is a key step in the pyrimidine biosynthesis pathway and is crucial for the synthesis of DNA and RNA. Existing studies have shown that the nutritional deficiency phenotype caused by the lack of OMP decarboxylase can be compensated by adding uracil to the medium; moreover, yeast strains lacking OMP decarboxylase can grow in a medium containing 5-fluoroootic acid (5-FOA), while wild-type strains can metabolize 5-FOA into the toxic substance 5-fluorouracil, making the cells unable to grow. Using this property, multiple genes in the genome can be continuously manipulated, avoiding the introduction of additional sequences into the genome, as well as the cumbersome operation and biosafety problems caused by the simultaneous use of multiple nutritional markers and antibiotic markers.

[0058] Using the vector pZPK-P GPD -HYG-Tnos-P 5S-tRNA -crt1.2-sgRNA(Sa) as a template, the URA3.2-sgRNA fragment was amplified using the primers 5S-tRNA-F and URA3.2-sgRNA-R. Then, the fragments were separately integrated into the target vector by the RF cloning method to obtain the plasmid pZPK-P GPD -HYG-Tnos-P 5S-tRNA-ura3.2-sgRNA(Sa). Then, using the genomic DNA of Rhodosporidium toruloides as a template, two fragments of approximately 1000 bp, URA3L (primers PZPK-URA3L-F and URA3L-PGK-R) and URA3R (primers UR3R-RF-F and UR3R-RF-R), were amplified by primers respectively. Then the fragments were integrated into the plasmid pZPK-P GPD -HYG-Tnos-P 5S-tRNA -ura3.2-sgRNA(Sa) through RF cloning to obtain the plasmid pZPK-URA3L-P GPD -HYG-Tnos-URA3R-P 5S-tRNA -ura3.2-sgRNA(Sa).

[0059]

[0060] (2) Construction of a homologous vector for blocking downstream carotenoid synthesis mediated by the CRISPR / Cas9 system

[0061] Rhodosporidium toruloides is not only a high-yield oil yeast, but also has a carotenoid synthesis pathway, so the strain has a red phenotype, indicating that the yeast has the mevalonate (MVA) pathway. Therefore, terpene synthase can be directly heterologously expressed to synthesize terpene compounds. In terpene synthesis, in order to increase the yield, downstream synthesis is often blocked. The key gene CRTI (GeneBank: RHTO_04602) in the carotenoid synthesis pathway encodes phytoene desaturase. The knockout of this gene ultimately blocks downstream carotenoid synthesis, which is beneficial to terpene accumulation.

[0062] Using the genomic DNA of Rhodosporidium toruloides as a template, two fragments of approximately 1000 bp, CRTIL (primers PZPK-CRTL-F and CRTL-PGK-R) and CRTIR (primers CRTR-RF-F and CRTR-RF-R), were amplified by primers respectively. Then the fragments were integrated into the plasmid pZPK-P GPD -HYG-Tnos-P 5S-tRNA -crt1.2--sgRNA(Sa) through RF cloning to obtain the plasmid pZPK-CRTIL-P GPD -HYG-Tnos-CRTIR-P 5S-tRNA -crt1.2--sgRNA(Sa).

[0063]

[0064] (3) Construction of a homologous vector for blocking the downstream lycopene synthesis mediated by the CRISPR / Cas9 system

[0065] CAR2 (GeneBank: RHTO_04605) in Rhodosporidium toruloides encodes a bifunctional enzyme (phytoene synthase and lycopene cyclase). The inactivation of this gene stops the mevalonate pathway of Rhodosporidium toruloides at the precursor GGPP (geranylgeranyl pyrophosphate). The specific metabolic schematic diagram is shown in Figure 5 . Among them, HMG-CoA: 3-hydroxy-3-methylglutaryl-CoA; HMGR, 3-hydroxy-3-methylglutaryl-CoA reductase; IDI1, isopentenyl pyrophosphate isomerase gene; ERG20, bifunctional FPP synthase gene; IPP, isopentenyl pyrophosphate; DMAPP, dimethylallyl pyrophosphate; GPP, geranyl pyrophosphate; FPP, farnesyl pyrophosphate; GGPP, geranylgeranyl pyrophosphate; CAR2, phytoene synthase / lycopene cyclase; CRTI, phytoene dehydrogenase.

[0066] Using the vector pZPK-P GPD -HYG-Tnos-P 5S-tRNA -crt1.2-sgRNA(Sa) as a template, the CAR2.1-sgRNA fragment was amplified using primers 5S-tRNA-F and CAR2.1-sgRNA-R. Then, the fragments were integrated into the target vector by RF cloning method to obtain the plasmid pZPK-P GPD -HYG-Tnos-P 5S-tRNA -car2.1-sgRNA(Sa). Again, using the genomic DNA of Rhodosporidium toruloides as a template, two fragments of about 1000 bp, CAR2L (primers PZPK-CAR2L-F and CAR2L-PGK-R) and CAR2R (primers CAR2-RF-F and CAR2-RF-R), were amplified by primers respectively. Then, the fragments were integrated into the plasmid pZPK-P GPD -HYG-Tnos-P 5S-tRNA -car2.1-sgRNA(Sa) by RF cloning to obtain the plasmid pZPK-CAR2L-P GPD -HYG-Tnos-CAR2R-P 5S-tRNA -car2.1-sgRNA(Sa).

[0067]

[0068] (4) Construction of the reporter gene ADE2 knockout vector

[0069] ADE2 encodes phosphoribosylaminoimidazole carboxylase, which is the sixth step in the purine biosynthesis pathway of yeast. Mutations in this gene produce red or pink colonies. In mutants, pigments related to adenine synthesis accumulate in the vacuole, causing the yeast colonies to exhibit a characteristic red color. Searching the NP11 gene bank for this gene, the phosphoribosylaminoimidazole carboxylase functional enzyme (GenBank: RHTO_02297) was "fished out", and it is speculated that this gene can perform the function of the ADE2 gene.

[0070] 1. Verification of the ADE2 reporter gene in Rhodosporidium toruloides using the CRISPR / Cas9 system (NHEJ)

[0071] Construct three target site knockout vectors in the exon region of the ADE2 gene. Using the plasmid pZPK-P GPD -HYG-Tnos-P 5S-tRNA -crt1.2-sgRNA(Sa) as a template, the ADE2.1-sgRNA fragment was amplified using the primers 5S-tRNA-F / ADE2.1-sgRNA-R. The ADE2.2-sgRNA fragment was amplified using the primers 5S-tRNA-F / ADE2.2-sgRNA-R. The ADE2.3-sgRNA fragment was amplified using the primers 5S-tRNA-F / ADE2.3-sgRNA-R.

[0072] Then, the fragments were integrated into the target vector pZPK-P GPD -HYG-Tnos-P 5S-tRNA -crt1.2-sgRNA(Sa) by RF cloning method to obtain the plasmids pZPK-P GPD -HYG-Tnos-P 5S-tRNA -ade2.1-sgRNA(Sa), pZPK-P GPD -HYG-Tnos-P 5S-tRNA -ade2.2-sgRNA(Sa) and pZPK-P GPD -HYG-Tnos-P 5S-tRNA -ade2.3-sgRNA(Sa).

[0073]

[0074] Target site design for the ADE2 gene

[0075]

[0076] Among them, the nucleotide sequence of ADE2.1 is shown in SEQ ID NO.26, the nucleotide sequence of ADE2.2 is shown in SEQ ID NO.27, and the nucleotide sequence of ADE2.3 is shown in SEQ ID NO.28.

[0077] The above binary vector was introduced into Rhodosporidium toruloides NP11-SaCas9-1 by ATMT. After the obtained transformants were extracted with genomic DNA, genotype identification and sequencing were performed.

[0078] Genomic DNA extraction method: The strain after stability verification was cultured in YPD medium at 30 °C for 24 h. Take 2-5 mL of the bacterial solution, centrifuge and wash it once with ultrapure water. Add 400 μL of TES buffer and an appropriate amount of glass beads, and use a cell disruptor to oscillate for 1 min and ice-bath for 1 min, repeat 2-3 times. Then add 400 μL of Tris-saturated phenol mixture (Tris-saturated phenol: chloroform: isoamyl alcohol = 25:24:1), invert and mix well repeatedly, and let it stand at room temperature for 5 min. Centrifuge at 4 °C, 15000g for 10 min, take 200 μL and transfer it to a new 1.5 mL centrifuge tube, add 1 / 10 volume of sodium acetate (3 mol / L pH 5.2), 2 volumes of ice-cold absolute ethanol, and precipitate at -20 °C for 30-60 min. Centrifuge at 4 °C, 15,000g for 10 min, discard the supernatant. After the precipitate was washed with ice-cold 75% ethanol, centrifuge and air-dry. Add an appropriate amount of TE buffer to dissolve it, and measure the concentration with NanoDrop for later use.

[0079] Use the upstream and downstream primers of the gene: ADE2-F and ADE2-R to amplify the genomic DNA, sequence the obtained PCR product, and obtain the gene deletion type ade2Δ engineering strain. It shows that this gene is indeed the phosphoribosylaminoimidazole carboxylase encoding the sixth step of the yeast purine biosynthesis pathway, and the knockout of this gene can cause yeast phenotypic changes.

[0080] The PCR results and sequencing results are as Figure 3-4 shown.

[0081] 2. Construction of a homologous vector for knocking out the ADE2 gene of Rhodosporidium toruloides mediated by the CRISPR / Cas9 system

[0082] Using the genomic DNA of Rhodosporidium toruloides as a template, two fragments of about 1000 bp, ADE2L (primers PZPK-ADE2L-F and ADE2L-PGK-R) and ADE2R (primers ADE2-RF-F and ADE2-RF-R), were amplified by primers respectively. Then the fragments were cloned by RF and integrated into the plasmid pZPK-P GPD-HYG-Tnos-P 5S-tRNA -ade2.1-sgRNA(Sa), obtaining plasmid pZPK-ADE2L-P with donor DNA GPD -HYG-Tnos-ADE2R-P 5S-tRNA -ade2.1-sgRNA(Sa).

[0083]

[0084] Example 3: Construction of uracil auxotrophic strain of Rhodosporidium toruloides

[0085] The process of strain construction is as follows: Use primers PZPK166-F and RB-R to linearize the Figure 1 indicated vector. After obtaining the corresponding fragment, the linearized fragment is introduced into engineering strains NP11-SaCas9-1 and SAS52 by the lithium acetate transformation method. The cells are spread on a hygromycin resistance plate at 20 ng / μL, and transformants are obtained after culturing at 30 °C for 3-4 days.

[0086] Fragment pZPK-URA3L-P GPD -HYG-Tnos-URA3R-P 5S-tRNA -ura3.2-sgRNA(Sa) is transferred into NP11-SaCas9-1 and SAS52. The obtained transformants are subjected to PCR amplification using two pairs of primers, URA3L-F and HYG147-R, and HYG20-F and URA3R-R. The amplified band indicates the uracil auxotrophic strain constructed by homologous recombination. This strain can grow on SD medium containing uracil and 5-FOA, while the wild strain cannot. The homologous recombination efficiency of the SAS52 engineering strain at this locus is 98%.

[0087] Example 4: Construction of strain blocking downstream carotenoid synthesis

[0088] The process of strain construction is the same as that in Example 3.

[0089] Fragment pZPK-CRTIL-P GPD -HYG-Tnos-CRTIR-P 5S-tRNA -crt1.2--sgRNA(Sa) is transferred into NP11-SaCas9-1 and SAS52. The obtained transformants are subjected to PCR amplification using two pairs of primers, CRTL-F and HYG147-R, and HYG20-F and CRTR-R. The amplified band indicates the target transformant constructed by homologous recombination. This strain blocks the synthesis of carotenoids, and the strain phenotype changes from red to white. The homologous recombination efficiency of the SAS52 engineering strain at this locus is 99%.

[0090] Example 5: Construction of a strain blocking the synthesis of downstream phytoene

[0091] The process of strain construction was the same as that in Example 3.

[0092] Fragment pZPK-CAR2L-P GPD -HYG-Tnos-CAR2R-P 5S-tRNA -car2.1-sgRNA(Sa) was transferred into NP11-SaCas9-1 and SAS52. The obtained transformants were subjected to PCR amplification using two pairs of primers, CAR2L-F and HYG147-R, and HYG20-F and CAR2R-R. The amplified bands were the target transformants constructed by homologous recombination. This strain blocked the synthesis of downstream phytoene. In subsequent applications, phytoene synthase from other sources could be supplemented to complete the blocking of carotenoid synthesis and achieve the purpose of increasing lycopene production. The homologous recombination efficiency of the SAS52 engineered strain at this locus was 96.3%.

[0093] Example 6: Construction of a strain with the ADE2 gene of Rhodotorula glutinis knocked out

[0094] The process of strain construction was the same as that in Example 3.

[0095] Fragment pZPK-ADE2L-P GPD -HYG-Tnos-ADE2R-P 5S-tRNA -ade2.1-sgRNA(Sa) was transferred into NP11-SaCas9-1 and SAS52. The obtained transformants were subjected to PCR amplification using two pairs of primers, URA3L-F and HYG147-R, and HYG20-F and URA3R-R. The amplified bands were those constructed by homologous recombination. The homologous recombination efficiency of the SAS52 engineered strain at this locus was 95%.

[0096]

[0097]

[0098] Example 7: Construction of an engineered strain for high-yield production of sesquiterpene farnesene

[0099] The process of strain construction was the same as that in Example 3.

[0100] Fragment pZPK-CRTIL-P GPD -HYG-P2A-FS1-Tnos-CRTIR-P 5S-tRNA -crt1.2-sgRNA(Sa) was the vector pZPK-CRTIL-P GPD -HYG-Tnos-CRTIR-P 5S-tRNA-crt1.2-sgRNA(Sa) was obtained by RF2 cloning. The FS gene (GenBank: NM_001293893) was optimized according to the codons of Rhodosporidium toruloides.

[0101] This fragment was transferred into SAS52. The obtained transformants were subjected to PCR amplification using two pairs of primers, CRTL-F and HYG147-R, and HYG20-F and CRTR-R. The amplified band was the target transformant constructed by homologous recombination. This strain simultaneously achieved the knockout of the downstream pathway and the expression of heterologous genes, obtaining a recombinant strain that could heterologously produce farnesene.

[0102] Example 8 Construction of an engineered strain for high-yield production of monoterpene terpineol

[0103] The strain construction process was the same as that in Example 3.

[0104] Fragment pZPK-CRTIL-P GPD -HYG-P2A-aTS-Tnos-CRTIR-P 5S-tRNA -crt1.2-sgRNA(Sa) was the vector pZPK-CRTIL-P GPD -HYG-Tnos-CRTIR-P 5S-tRNA -crt1.2-sgRNA(Sa) was obtained by RF2 cloning. The aTS gene (GenBank: AAS79352.1) was optimized according to the codons of Rhodosporidium toruloides.

[0105] This fragment was transferred into SAS52. The obtained transformants were subjected to PCR amplification using two pairs of primers, CRTL-F and HYG147-R, and HYG20-F and CRTR-R. The amplified band was the target transformant constructed by homologous recombination. This strain simultaneously achieved the knockout of the downstream pathway and the expression of heterologous genes, obtaining a recombinant strain that could heterologously produce terpineol.

[0106] Example 9 Construction of an engineered strain for high-yield production of lycopene

[0107] The strain construction process was the same as that in Example 3.

[0108] Fragment pZPK-CAR2L-P GPD -HYG-P2A-EgcrtB-Tnos-CAR2R-P 5S-tRNA -car2.1-sgRNA(Sa) was the vector pZPK-CAR2L-P GPD -HYG-Tnos-CAR2R-P 5S-tRNA-car2.1-sgRNA(Sa) was obtained by RF2 cloning. Among them, the EgcrtB gene (GenBank: BAU24764.1) was optimized according to the codons of Rhodosporidium toruloides.

[0109] This fragment was transferred into SAS52, and the obtained transformants were subjected to PCR amplification using two pairs of primers, CAR2L-F and HYG147-R, and HYG20-F and CAR2R-R. The bands that could be amplified were the target transformants constructed by homologous recombination. This strain simultaneously achieved the knockout of the downstream gene CAR2 and the expression of the heterologous gene crtB, obtaining a recombinant strain that could heterologously produce phytoene.

[0110] In summary, the SAS52 engineered bacteria constructed in the present invention can achieve knockout at different sites by homologous recombination mediated by the CRISPR / Cas9 system, and the knockout efficiency is above 95%.

[0111] The above are only several embodiments of the present application and do not impose any form of limitation on the present application. Although the present application is disclosed as above with preferred embodiments, it is not intended to limit the present application. Any person skilled in the art, without departing from the scope of the technical solution of the present application, making some changes or modifications using the technical content disclosed above is equivalent to equivalent implementation cases and all belong to the scope of the technical solution.

Claims

1. A Rhodosporidium toruloides strain with high homologous recombination efficiency, characterized in that, Using the Rhodosporidium toruloides strain NP11-SaCas9-1 as the starting strain, the RAD52 gene was overexpressed.

2. The Rhodosporidium toruloides strain with high homologous recombination efficiency according to claim 1, characterized in that, The RAD52 gene is derived from the RAD52 gene of Saccharomyces cerevisiae S288C or the RAD52 gene of Rhodosporidium toruloides NP11; The GeneBank number of the RAD52 gene of Saccharomyces cerevisiae S288C is: NC_001145.3; The GeneBank number of the RAD52 gene of Rhodosporidium toruloides NP11 is: RHTO_00644.

3. The Rhodosporidium toruloides strain with high homologous recombination efficiency according to claim 1, characterized in that, The DNA fragment containing the RAD52 gene also contains a promoter, a resistance gene, and a terminator.

4. The Rhodosporidium toruloides strain with high homologous recombination efficiency according to claim 3, characterized in that, The promoter is selected from P GPD , P FBA , P PGK , P PGI , P TPI , P LDP , P ACC1 , P FAS , P THI , P CTR , P DAO , P NAR , P ICL , P MET , P ADH2 , P PHO89 , P GAL1 ; Preferably, the terminator is selected from one of T GPD , T HSP , T NOS , T 35S , T SV40 ; Preferably, the resistance gene is selected from one or more of the nourseothricin resistance gene, bleomycin resistance gene, hygromycin resistance gene, geneticin resistance gene, green fluorescent protein, red fluorescent protein, luciferase.

5. The Rhodosporidium toruloides strain with high homologous recombination efficiency according to claim 4, characterized in that, The DNA fragment containing the RAD52 gene is selected from P PGK -ScRAD52-P2A-NAT-T HSP 、P PGK -NAT-T NOS -P ADH2 -ScRAD52-T HSP 、P PGK -RtRAD52-P2A-NAT-T HSP 、P PGK -NAT-T NOS -P ADH2 -RtRAD52-T HSP any one or more of them; Preferably, the nucleotide sequence of the ScRAD52 gene is as shown in SEQ ID NO.

1.

6. A method for constructing a Rhodosporidium toruloides strain with high homologous recombination efficiency according to any one of claims 1-5, characterized in that, It includes the following steps: (1) The Cas9 nuclease gene was randomly integrated into the genome of Rhodosporidium toruloides NP11, and the expression of the Cas9 protein was confirmed by protein expression verification to obtain the Rhodosporidium toruloides strain NP11-SaCas9-1; (2) The RAD52 gene was introduced into the genome of the strain NP11-SaCas9-1 obtained in step (1) to obtain the strain SAS52, which is the Rhodosporidium toruloides strain.

7. The method for constructing a Rhodosporidium toruloides strain with high homologous recombination efficiency according to claim 6, characterized in that, The method of introduction is selected from one of the Agrobacterium tumefaciens-mediated transformation method, electroporation, lithium acetate transformation, and protoplast transformation.

8. The method for constructing a Rhodosporidium toruloides strain with high homologous recombination efficiency according to claim 6, characterized in that, The Cas9 nuclease gene is derived from Staphylococcus aureus.

9. A method for modifying a Rhodosporidium toruloides strain with high homologous recombination efficiency according to any one of claims 1-5, characterized in that, It includes the following steps: (1) Construct the sgRNA(Sa) vector with donor DNA: Using the Rhodosporidium toruloides NP11 genomic DNA as a template, fragments UP and DN were amplified separately by primers, and then the fragments were integrated into the plasmid pZPK-P GPD -HYG-Tnos-P 5S-tRNA -X-sgRNA(Sa) through RF cloning to obtain the plasmid pZPK-UP-P GPD -HYG-Tnos-DN-P 5S-tRNA -X-sgRNA(Sa), and the vector was linearized by PCR amplification; (2) The knockout vector with donor DNA described in step (1) was overexpressed by lithium acetate transformation, and the target recombinant bacteria were screened by PCR.

10. Use of the Rhodosporidium toruloides strain according to any one of claims 1-5 in integrating genes of a heterologous synthetic pathway.

Images