Insect-derived alpha-N-acetyl-galactosaminase with double-enzyme activity
By cloning and expressing the Ls-α-GalNAc gene from ash planthopper, the recombinant protein Ls-α-GalNAc-His with dual enzyme activity was developed, which solved the problem of insufficient development of insect-derived dual enzyme activity α-GalNAc, achieved high enzyme activity under different temperature conditions, and expanded its potential for application in multiple fields.
Patent Information
- Application Number
- CN202411350083.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-26
- Publication Date
- 2025-05-30
AI Technical Summary
In the prior art, insect-derived dual enzyme activity α-N-acetyl-galactosaminoase (α-GalNAc) has not been fully developed, limiting its application in the fields of medicine, agriculture and food processing.
The improvement of its dual enzyme activity was achieved by cloning the Ls-α-GalNAc gene from the rice pest Grey Plantohope and expressing and purifying the recombinant protein Ls-α-GalNAc-His in the insect cell line sf9.
The recombinant protein Ls-α-GalNAc-His exhibits strong α-N-acetyl-galactosaminoase activity at room temperature, and significantly improves enzyme activity at 46°C, providing a wider range of application scenarios.
Smart Images
Figure BDA0005062102260000051 
Figure HDA0005062102280000011 
Figure HDA0005062102280000012
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and relates to an insect-derived α-N-acetyl-galactosaminidase with dual enzyme activities. Background Art
[0002] α-Galactosidase (α-galactosidase, α-Gal) is a class of hydrolases that specifically hydrolyze galactoside bonds and widely exist in animals, plants, and microorganisms. Since it can hydrolyze galactosides on oligosaccharides or oligosaccharide chains of glycoproteins, α-Gal is widely used in medicine, agriculture, food, industry, etc. In livestock feed treatment, soybean products are important protein feeds. However, since most animals lack α-Gal in their intestines, oligosaccharide substances rich in feed such as raffinose and stachyose are difficult to be absorbed by the intestines, but are easily anaerobically digested by intestinal microorganisms. On the one hand, this leads to low food nutrient utilization rate, and on the other hand, it leads to a large amount of gas production, affecting animal digestion and absorption. After pretreatment of legume feeds with α-Gal, monosaccharides that can be absorbed by animals are produced, reducing the risk of gas production. In addition, in food processing, the addition of α-Gal can increase the effective absorption and utilization of legume products by humans. Different blood types have different glycosylation modifications on the surface of blood cells. In clinical medicine, the conversion of type B blood to type O blood has been successfully achieved using α-Gal. During organ transplantation, the donor organ recognizes the donor through α-1,3-galactoside bonds and forms an antigen-antibody complex, activating the immune rejection reaction of the recipient. Pretreatment of the donor tissue with α-Gal will effectively reduce the rejection reaction and improve the success rate of organ transplantation.
[0003] Another enzyme called α-N-acetylgalactosaminidase (α-GalNAc) belongs to the galactosaminidase class and has weak α-galactosidase activity, hydrolyzing N-acetyl-galactoside bonds. In blood type conversion, α-GalNAc is used to remove the excess α-N-acetyl-galactose residues on the surface of type A blood, converting type A blood into type O blood.
[0004] Currently, a variety of α-Gal and α-GalNAc have been screened out. Among them, bacteria and some molds in microorganisms are the main sources of producing α-Gal. In addition, some plants such as coffee, grapes, sugarcane, etc. are also sources of α-Gal or α-GalNAc. Insects, as a class of organisms with the richest species resources in nature, contain a variety of biological gene resources, such as antibacterial peptides and other substances that have been developed currently. Compared with microorganisms, there are still a large number of functional genes to be developed. Summary of the Invention
[0005] The technical problem solved by the present invention is to provide the dual enzyme activity function of the Ls-α-GalNAc gene derived from insects.
[0006] To solve the above technical problems, a first aspect of the present invention provides an application of a protein in any one of the following:
[0007] A1) As an α-galactosidase;
[0008] A2) As an α-N-acetyl-galactosaminidase;
[0009] A3) Preparing a product with α-galactosidase function;
[0010] A4) Preparing a product with α-N-acetyl-galactosaminidase function;
[0011] A5) Preparing a product with both α-galactosidase and α-N-acetyl-galactosaminidase functions;
[0012] A6) Hydrolyzing pNPG;
[0013] A7) Hydrolyzing pNPA;
[0014] A8) Hydrolyzing pNPG and pNPA;
[0015] The protein is any one of the following:
[0016] B1) The protein shown in Sequence 2;
[0017] B2) A protein with an amino acid sequence homology greater than 90% to the protein shown in B1) and derived from an insect with the same function;
[0018] B3) A fusion protein obtained by adding a tag protein to the end of the protein shown in B1) or B2).
[0019] In the above application, in B3), the tag protein is a His protein.
[0020] Furthermore, B3) is the protein shown in Sequence 4.
[0021] In a second aspect, the present invention provides an application of a biological material related to the protein in the first aspect in any one of the following:
[0022] C1) Preparing α-galactosidase;
[0023] C2) Preparing α-N-acetyl-galactosaminidase;
[0024] C3) Preparing a product with α-galactosidase function;
[0025] C4) Preparing a product with α-N-acetyl-galactosaminidase function;
[0026] C5) Preparing a product with α-galactosidase and α-N-acetyl-galactosaminidase functions;
[0027] C6) Hydrolyzing pNPG;
[0028] C7) Hydrolyzing pNPA;
[0029] C8) Hydrolyzing pNPG and pNPA;
[0030] The biomaterials related to the protein described in the first aspect include nucleic acid molecules encoding the protein, expression cassettes expressing the nucleic acid molecules, recombinant vectors, bacmids or cells;
[0031] The nucleic acid molecule encoding the protein is as follows D1) or D2) or D3) or D4):
[0032] D1) A DNA molecule whose nucleotide sequence is the DNA molecule shown in Sequence 1 or 3 in the sequence listing;
[0033] D2) A DNA molecule whose coding region is the DNA molecule shown in Sequence 1 or 3 in the sequence listing;
[0034] D3) A DNA molecule having 90% or more homology with the nucleotide sequence defined by D1) or D2), derived from an insect and encoding a protein with the same function;
[0035] D4) A DNA molecule that hybridizes with the nucleotide sequence defined by D1) or D2) under stringent conditions and encodes a protein with the same function.
[0036] In the above-mentioned application, the pH of the hydrolysis is 6 - 6.4.
[0037] In the above-mentioned application, the temperature of the hydrolysis is 40 - 50 °C;
[0038] And / or, the temperature of the hydrolysis is 46 °C.
[0039] In the third aspect, the present invention provides a method for hydrolyzing pNPG, comprising the following steps: using the protein described in the first aspect as an enzyme to hydrolyze pNPG.
[0040] In the above-mentioned method, the pH of the hydrolysis is 6 - 6.4.
[0041] In the above-mentioned application, the temperature of the hydrolysis is 40 - 50 °C;
[0042] And / or, the temperature of the hydrolysis is 46 °C.
[0043] In the fourth aspect, the present invention provides a method for hydrolyzing pNPA, comprising the following steps: using the protein described in the first aspect as an enzyme to hydrolyze pNPA.
[0044] In the method described above, the pH of the hydrolysis is 6 - 6.4;
[0045] Or, the temperature of the hydrolysis is room temperature.
[0046] Furthermore, the temperature of the hydrolysis is 25 °C.
[0047] The above product is an enzyme preparation, a drug, a composition, a health product, a functional food, a food for special medical purposes, or other biological products.
[0048] The Ls-α-GalNAc gene provided by the present invention is a gene derived from the rice pest Laodelphax striatellus, expressed and purified using the insect cell line sf9, and the enzyme activity of the recombinant protein was detected under normal temperature conditions. It was found that the protein has strong α-N-acetyl-galactosaminidase activity (971 U / mg) and weak α-galactosidase activity (50 U / mg) at normal temperature (25 °C). However, in the analysis of its α-galactosidase activity, it was found that Ls-α-GalNAc has the property of being heat-resistant, and at 46 °C, the enzyme activity was significantly increased to 429 U / mg. The dual enzyme activity provides a richer application scenario for the application of this protein. Description of the Drawings
[0049] Figure 1 Is the Ls-α-GalNAc-His recombinant protein expressed by sf9 (Coomassie staining).
[0050] Figure 2 Is the change in α-Gal enzyme activity of Ls-α-GalNAc-His under different pH reaction conditions.
[0051] Figure 3 Is the change in α-Gal enzyme activity of Ls-α-GalNAc-His under different temperature conditions.
[0052] Figure 4 Is the heat resistance of α-Gal of Ls-α-GalNAc-His.
[0053] Figure 5 Is the change in α-Gal enzyme activity of Ls-α-GalNAc-His under different conditions. Detailed Description of the Invention
[0054] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0055] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.
[0056] Unless otherwise specified, in the following examples, quantitative tests are all set with three repeated experiments, and the results are averaged.
[0057] Example 1: Cloning of α-GalNAc gene and preparation of recombinant protein Ls-α-GalNAc-His
[0058] I. α-GalNAc gene sequence
[0059] The α-GalNAc gene sequence derived from Laodelphax striatellus is named Ls-α-GalNAc, its ORF sequence is Sequence 1, the protein encoded by this gene is named Ls-α-GalNAc, and its amino acid sequence is Sequence 2.
[0060] The Ls-α-GalNAc protein contains 420 amino acid residues, with a relative molecular weight of 47928.71 and an isoelectric point of 5.09.
[0061] II. Expression of protein Ls-α-GalNAc in sf9 insect cell line
[0062] 1. Construction of baculovirus expression vector
[0063] The baculovirus expression vector pfast-gp67-Ls-α-GalNAc is obtained by inserting the Ls-α-GalNAc sequence (Sequence 3) shown in Sequence 1 with the His tag-encoding gene linked to the 3' end into the secreted protein expression vector pFastBac-gp67 of the expression vector to express the recombinant protein Ls-α-GalNAc-His, and the amino acid sequence of this recombinant protein is Sequence 4.
[0064] The specific method is as follows:
[0065] 1) Obtain Ls-α-GalNAc shown in Sequence 1 using gene synthesis method.
[0066] 2) Design Ls-α-Gal primers containing restriction enzyme sites: Ls-α-Gal-BamHI and Ls-α-Gal-HindIII. The Ls-α-Gal-HindIII primer sequence does not contain the stop codon of Ls-α-Gal.
[0067] Using Ls-α-Gal shown in Sequence 1 as a template, PCR amplification was performed with Ls-α-Gal-BamHI and Ls-α-Gal-HindIII primers to obtain the Ls-α-Gal fragment (Sequence 3).
[0068] Ls-α-Gal-BamHI: CGGCGCATTCTGCCTTTGCGGCGGATCCCatgcagtacaaagatgtggagtt
[0069] Ls-α-Gal-HindIII: ATGATCCTCTAGTACTTCTCGACAAGCTTgtgatggtgatggtgatgcgtgacaacggttgctttg
[0070] 3) Extract the baculovirus expression plasmid pFastBac-gp67 amplified from Escherichia coli DH5α, and digest it with BamHI and HindIII, and recover the digested plasmid by gel extraction.
[0071] The pFastBac-gp67 plasmid is a plasmid obtained by introducing the gp67 signal peptide sequence (the signal peptide sequence is atgctactagtaaatcagtcacaccaaggcttcaataaggaacacacaagcaagatggtaagcgctattgtttt atatgtgcttttggcggcggcggcgcattctgcctttgcg) at the BamH1 restriction site of pFastBac1 (10359 - 016 invitrogen).
[0072] 4) Perform a homologous recombination reaction on the Ls-α-Gal fragment obtained in 2) above and the digested plasmid obtained in 3) to obtain a recombinant product.
[0073] The reaction system is shown in Table 1.
[0074] Table 1 is the homologous recombination reaction system
[0075]
[0076] 50 °C, 10 min, and cool down to 4 °C.
[0077] 5) Add the recombinant product to DH5α competent cells and let it stand on ice for 30 min. Heat shock in a 42 °C water bath for 45 s, immediately cool on ice for 2 min. Add 600 μL of LB medium, resuscitate at 37 °C for 1 h, coat on a plate containing ampicillin resistance, and sequence and verify after inverted culture for 12 h to obtain the baculovirus expression vector pfast-gp67-Ls-α-Gal.
[0078] 2. Preparation of Bacmid
[0079] 1) Preparation of competent DH10Bac cells (Invitrogen, 10361 - 012): DH10Bac bacteria grown on a plate were transferred into 10 mL of LB medium containing 100 μg / mL kanamycin and shaken overnight at 37°C.
[0080] 2) Transfer 100 μL of DH10Bac into 10 mL of LB medium containing 100 μg / mL kanamycin and shake at 37°C for about 2 hours. Measure the OD value at a wavelength of 600 nm. Collect the bacteria when the OD value reaches 0.6 - 0.8.
[0081] 3) Centrifuge the bacterial solution at 3000 rpm for 10 min at 4°C, discard the supernatant, add 5 mL of pre - cooled 50 mM CaCl 2 , resuspend the pellet, and let it stand on ice for 15 min. Centrifuge at 3000 rpm for 15 min at 4°C, discard the supernatant, add 1 mL of 50 mM CaCl 2 , and gently pipette up and down to obtain competent DH10Bac cells.
[0082] 4) Heat - shock transformation of pfast - gp67 - Ls - α - Gal plasmid into DH10Bac cells: Add 100 μg of the plasmid to 100 μL of competent DH10Bac cells, incubate at 4°C for 30 min, heat - shock at 42°C for 90 s, and then incubate at 4°C for 2 min.
[0083] 5) Add 1 mL of LB liquid medium to the heat - shocked competent cells and shake at 37°C at 220 rmp for 4 h.
[0084] 6) Add 4 μL of 1 M IPTG and 40 μL of 20 mg / mL X - gal to the medium and spread it on a plate containing kanamycin (50 μg / mL), gentamicin (7 μg / mL), and tetracycline (50 μg / mL).
[0085] 7) Incubate the plate upside - down at 37°C for 48 h.
[0086] 8) Pick 20 white colonies, streak them, and perform colony PCR. A band of about 3600 bp size indicates a positive colony.
[0087] The above PCR primers are shown in Table 2 below.
[0088] Table 2 shows the PCR primers
[0089] DH10F CCCAGTCACGACGTTGTAAAACG DH10R AGCGGATAACAATTTCACACAGG
[0090] The above PCR reaction conditions are as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 1 min, 35 cycles, and final extension at 72°C for 5 min.
[0091] 9) Pick PCR-positive colonies and inoculate them into 10 mL of LB medium (containing kanamycin, gentamicin, and tetracycline), and shake the culture overnight.
[0092] 10) Plasmid extraction (FastPure EndoFree Plasmid Midi Kit; DC205-01 Vazyme Biotech Co., Ltd.): Centrifuge the bacterial solution at 12,000 rpm for 2 min and discard the supernatant. Add 600 μL of P1 and resuspend the pellet; add 600 μL of P2, invert to mix, and let stand at room temperature for 5 min; add 600 μL of P3, invert to mix, and let stand on ice for 5 min. Centrifuge at 12,000 rpm for 15 min, take the supernatant, add 0.8 volume of isopropanol, and let stand on ice for 10 - 20 min. Centrifuge at 12,000 rpm for 10 min, discard the supernatant, add 1 mL of 70% ethanol, centrifuge at 12,000 rpm for 5 min, discard the supernatant, air-dry, and then add 30 μL of ddH 2 O. The recombinant plasmid is obtained.
[0093] Measure the concentration of the recombinant plasmid using NanoDrop.
[0094] 3. Cell transfection
[0095] 1) Culture Sf9 cells (Invitrogen, 11496-015). When the cell density reaches about 0.8×10 6 , inoculate them into a six-well plate at 2 mL per well and culture at 27°C. Subsequent transfection and culture are also carried out at this temperature.
[0096] 2) After the cells adhere for 15 min, change the culture medium to 1 mL per well.
[0097] 3) Use LipoInsect TM transfection reagent (Beyotime). Take two sterile centrifuge tubes and add 100 μL of cell culture medium to each for diluting the recombinant plasmid and the transfection reagent. Add 16 μg of the plasmid to one tube and gently pipette to mix; add 8 μL of LipoInsect TM transfection reagent to the other tube and pipette to mix, then let stand at room temperature for about 5 min. Subsequently, add the diluted plasmid to the LipoInsect TM transfection reagent and let stand at room temperature for 30 min.
[0098] 4) Uniformly drip 200 μL of the mixture of the transfection reagent and the plasmid into the six-well plate.
[0099] 5) Replace the culture medium with fresh one 4 h after transfection.
[0100] 6) Continue culturing for about 96 h, collect the culture medium in each well, centrifuge at 500 g for 5 min, and the obtained supernatant is the baculovirus of passage 1 (P1). To obtain baculovirus with a higher titer, 10 mL of Sf9 cells can be infected with 300 μL of the P1 virus to obtain the P2 virus after culturing for 72 h, and a large amount of the P3 virus can be obtained in the same way for standby.
[0101] 4. Protein expression
[0102] 1) Expand the culture of Sf9 cells to 500 mL, with an initial seeding concentration of 0.5×10 6 cells / mL.
[0103] 2) Culture at 28 °C and 130 rpm until the cell density reaches 2 - 3×10 6 cells / mL.
[0104] 3) Add 30 mL of the P3 virus to the culture medium.
[0105] 4) Culture for 3 - 4 days, and the protein is expressed and secreted into the culture medium.
[0106] 5. Protein extraction and purification
[0107] 1) Collect the cell culture, centrifuge at 7000 rpm for 30 min, and collect the supernatant.
[0108] 2) Filter the collected supernatant through a 0.2 - μm filter membrane.
[0109] 3) Pass the supernatant solution through the equilibrated Ni column at a flow rate of 2 mL / min.
[0110] 4) After the protein binds, pass PBS (pH 6.8) containing 10 mM imidazole at a final concentration through the Ni column with a volume 10 times that of the column.
[0111] 5) Pass 50 mM and 300 mM imidazole with a volume 10 times that of the column through the Ni column in sequence, and collect the eluate in sequence.
[0112] 6) Take 20 μL of the eluate, add 5 μL of SDS - Loading, boil the sample, separate by SDS - PAGE electrophoresis, and stain with Coomassie Brilliant Blue to observe the protein collection amount and purity.
[0113] 7) Take the liquid in the collection tube with high protein purity, dialyze to remove imidazole, and concentrate the protein to 5 mg / mL.
[0114] Obtain the recombinant protein Ls - α - GalNAc - His (Sequence 4).
[0115] The purified recombinant protein Ls-α-GalNAc-His was detected by electrophoresis, and the results are as Figure 1 shown. It can be seen that the target protein with a size of 49 KD was obtained.
[0116] Example 2: Enzyme Activity Detection
[0117] I. Dual Enzyme Activity Assay
[0118] The optimal survival temperature of Laodelphax striatellus is around 25 °C. Therefore, under normal temperature conditions, the enzyme activity of Ls-α-GalNAc-His was detected. 4-Nitrophenyl-α-N-acetylgalactosamine (pNPA) was used as the substrate to detect the α-N-acetyl-galactosaminidase α-GalNAc activity, and 4-nitrophenyl-α-galactoside (pNPG) was used to detect the α-galactosidase α-Gal activity.
[0119] 1) Preparation of the standard curve:
[0120] 100 mM, 50 mM, 25 mM, 12.5 mM, and 6.25 mM p-nitrophenol were prepared. 100 μL was taken, and the absorbance value was detected at OD405 on an enzyme-linked immunosorbent assay (ELISA) reader. Using the amount of 100 μL substrate (μmoL) as the abscissa and OD as the ordinate, a standard curve was made, and the slope ε (extinction coefficient of the substrate) was calculated.
[0121] 2) Detection of enzyme activity
[0122] The 100 μL reaction system included 50 μL of 5 mM p-NPG or p-NPA mother liquor (final concentration of 2.5 mM), 10 μL of pH 6.4 buffer, 38 μL of ddH 2 O, and finally 2 μL of the recombinant protein Ls-α-GalNAc-His prepared in Example 1 at 1 μg / μL was added, and the reaction was carried out at room temperature of 25 °C. The OD values at 0 min and 30 min were read, and △OD was calculated.
[0123] Calculation of specific enzyme activity
[0124] The amount of enzyme required to convert 1 micromole of substrate per minute is one enzyme activity unit. The number of enzyme activity units per milligram of enzyme protein is the specific activity. Substitute into the following formula to calculate the specific activity
[0125] Enzyme activity (μg) = Mεt / △OD
[0126] Specific activity = 1000 / enzyme activity
[0127] M is the amount of enzyme added (μg) in the 100 μL system, t is the reaction time (min), ε is the substrate extinction coefficient calculated from the standard curve, and △OD represents the difference between the initial absorbance value and the absorbance value after a period of time.
[0128] The results are as follows:
[0129] At 25 °C, pH 6.4, and a substrate concentration of 2.5 mM, the amount of enzyme (enzyme activity U) required for Ls-α-GalNAc-His to digest pNPA to produce 1 μM p-nitrophenol per minute is 1.03 μg, and the specific enzyme activity is 971 U / mg. That is, the α-GalNAc enzyme-active protein of Ls-α-GalNAc-His is 1.03 μg, and the specific activity is 971 U / mg.
[0130] At 25 °C, pH 6.4, and a substrate concentration of 2.5 mM, the amount of enzyme (enzyme activity U) required for Ls-α-GalNAc-His to digest pNPG to produce 1 μM p-nitrophenol per minute is 20 μg, and the specific enzyme activity is 50 U / mg. That is, the α-Gal enzyme-active protein of Ls-α-GalNAc-His is 20 μg, and the specific activity is 50 U / mg.
[0131] In summary, Ls-α-GalNAc-His has a high activity of α-N-acetyl-galactosaminidase and a weak activity of α-galactosidase at room temperature.
[0132] Therefore, the reaction conditions of α-galactosidase of Ls-α-GalNAc-His are explored and optimized below.
[0133] II. Detection of the Optimal Reaction pH of α-Galactosidase
[0134] 1) Use citric acid and disodium hydrogen phosphate to prepare buffer solutions with pH values of 3 - 8, and prepare NaHCO 3 buffer solutions with pH 8.5 and pH 9.0.
[0135] 2) In a 100 μL reaction system, include 50 μL of 5 mM pNPG stock solution, 10 μL of 10× buffer solutions with different pH values, 39 μL of ddH 2 O, and 1 μL of the recombinant protein Ls-α-GalNAc-His prepared in Example 1 at 1 μg / μL.
[0136] 3) Incubate at room temperature (25 °C) for 30 min, and detect the absorbance value with an enzyme-labeled instrument. Use the reaction solution without adding enzyme as the calibration control.
[0137] 4) Calculate the specific activity of the enzyme under different pH reaction conditions, and take the relative enzyme activity at the optimal pH as 100%, and calculate the change in specific activity under other pH conditions.
[0138] The results are as Figure 2As shown, by comparing the α-galactosidase catalytic reaction activities of Ls-α-GalNAc-His in different acid-base environments, it was found that the α-galactosidase activity was the strongest in a slightly acidic environment close to neutral, and the optimal reaction pH was 6 - 6.4.
[0139] III. Detection of the Optimal Reaction Temperature of α-Galactosidase
[0140] 1) The 100 μL reaction system contained 50 μL of 5 mM pNPG stock solution, 10 μL of pH 6.4 buffer (6.15 ml of 0.1 M citric acid; 13.85 ml of 0.2 M disodium hydrogen phosphate solution), 39 μL of ddH 2 O and 1 μL of the recombinant protein Ls-α-GalNAc-His prepared in Example 1 at 1 μg / μL.
[0141] 2) Using a PCR instrument, set the temperature gradient and incubate for 30 min.
[0142] 3) Detect the absorbance value with an enzyme-labeling instrument. And use the reaction solution without adding the enzyme as the calibration control.
[0143] 4) Calculate the specific activity of the enzyme at different temperatures, and take the relative enzyme activity at the optimal temperature as 100%, and calculate the change in enzyme activity under other temperature conditions.
[0144] The results are as Figure 3 shown. Under the optimal pH condition (pH 6.4), the effect of the reaction temperature on the enzyme activity was detected. At 46 °C, the enzyme activity was the strongest. When the temperature reached 50 °C and above, the enzyme activity decreased sharply.
[0145] IV. Thermal Stability Analysis of α-Galactosidase
[0146] 1) 1 μL of the recombinant protein Ls-α-GalNAc-His prepared in Example 1 at 1 μg / μL was placed in 9 μL of pH 6.4 buffer and incubated at different temperatures for 10 min, 30 min, and 60 min respectively;
[0147] 2) 100 μL of the reaction
[0148] system was added with 50 μL of 5 mM pNPG stock solution, 9 μL of pH 6.4 buffer stock solution, 31 μL of ddH 2 O and 10 μL of the incubated enzyme or an equal amount of the enzyme that had not been pre-incubated.
[0149] 2) Incubate at 46 °C for 30 min.
[0150] 3) Detect the absorbance value with an enzyme-labeling instrument. And use the reaction solution without adding the enzyme as the calibration control.
[0151] 4) Calculate the specific activity of the enzyme in the untreated group, and take the relative enzyme activity measured by the unpretreated enzyme as 100%, and calculate the change in enzyme activity in different treatment groups.
[0152] The results are as Figure 4 shown. Before participating in the reaction, the enzyme was incubated at 46 °C, 50 °C and 53 °C for 10 min, 30 min and 60 min respectively, and then the change in enzyme activity was detected under the optimal reaction conditions. Incubating the enzyme at 46 °C for 1 h did not affect the enzyme activity; incubating at 50 °C for 10 min did not affect the enzyme activity, and the enzyme activity decreased to about 70% after incubating for 30 min; the activity decreased by 50% after incubating at 53 °C for 10 min.
[0153] V. Substrate concentration of α-galactosidase
[0154] According to the detected optimal α-Gal activity conditions (46 °C, pH 6.4), the α-galactosidase activity of Ls-α-GalNAc-His was detected according to the above method.
[0155] Specifically as follows:
[0156] The 100 μL reaction system contained 50 μL of 5 mM or 20 mM pNPG mother liquor, 10 μL of pH 6.4 citrate buffer, 38 μL of ddH 2 O, and finally 2 μL of the recombinant protein Ls-α-GalNAc-His prepared in Example 1 at 1 μg / μL was added, and the reaction was carried out at 46 °C. The final substrate concentrations in the system were 2.5 mM and 10 mM respectively. Using the addition of 50 μL of 2.5 mM pNPG mother liquor at room temperature 25 °C as a control.
[0157] Detect the enzyme activity and specific enzyme activity according to the aforementioned method.
[0158] The results are as Figure 5 shown. The specific enzyme activity of the enzyme at the optimal temperature of 46 °C was greater than that at 25 °C. When reacting at the optimal temperature of 46 °C and the substrate concentration was 2.5 mM, the amount of enzyme required to digest pNPG to produce 1 μM p-nitrophenol per minute (enzyme activity U) was 6.17 μg, and the specific enzyme activity was 162 U / mg. When the substrate concentration was increased to 10 mM, the amount of enzyme required to digest pNPG to produce 1 μM p-nitrophenol per minute (enzyme activity U) was 2.33 μg, and the specific enzyme activity was 429 U / mg.
[0159] In summary, under the optimal reaction conditions, the enzyme activity of α-Gal of Ls-α-GalNAc-His increased significantly.
[0160] The above has described the present invention in detail. For those skilled in the art, without departing from the gist and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, in accordance with the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application and are made using conventional techniques known in the art. Some basic features can be applied within the scope of the following appended claims.
Claims
1. The use of protein in any of the following: A1) as α-galactosidase; A2) as α-N-acetyl-galactosaminidase; A3) preparing a product having α-galactosidase function; A4) preparing a product having α-N-acetyl-galactosaminidase function; A5) preparing a product having α-galactosidase and α-N-acetyl-galactosaminidase functions; A6) hydrolysis of pNPG; A7) hydrolysis of pNPA; A8) hydrolyzing pNPG and pNPA; The protein is any of the following: B1) The protein shown in sequence 2; B2) a protein with an amino acid sequence homology greater than 90% with the protein shown in B1) and having the same function and originating from insects; B3) A fusion protein obtained by adding a tag protein to the end of the protein shown in B1) or B2).
2. The use according to claim 1, characterized in that: B3) is the protein shown in Sequence 4.
3. Use of a biological material related to the protein of claim 1 in any of the following: C1) preparing α-galactosidase; C2) preparing α-N-acetyl-galactosaminidase; C3) preparing a product having α-galactosidase function; C4) preparing a product having α-N-acetyl-galactosaminidase function; C5) preparing a product having α-galactosidase and α-N-acetyl-galactosaminidase functions; C6) hydrolyze pNPG; C7) hydrolyzes pNPA; C8) hydrolyze pNPG and pNPA; The biological material related to the protein of claim 1 includes a nucleic acid molecule encoding the protein, an expression cassette expressing the nucleic acid molecule, a recombinant vector, a bacmid or a cell; The protein encoding nucleic acid molecule is as follows D1) or D2) or D3) or D4): D1) The nucleotide sequence is the DNA molecule shown in Sequence 1 or 3 in the sequence list; D2) The coding region is a DNA molecule shown in sequence 1 or 3 in the sequence list; D3) a DNA molecule that has 90% or more homology with the nucleotide sequence specified in D1) or D2), is derived from an insect and encodes a protein with the same function; D4) A DNA molecule that hybridizes with the nucleotide sequence defined in D1) or D2) under stringent conditions and encodes a protein having the same function.
4. The use according to any one of claims 1 to 3, characterized in that: The pH of the hydrolysis is 6-6.
4.
5. The use according to any one of claims 1 to 4, characterized in that: The hydrolysis temperature is 40-50°C; And / or, the hydrolysis temperature is 46°C.
6. A method for hydrolyzing pNPG, comprising the following steps: using the protein according to claim 1 as an enzyme to hydrolyze pNPG.
7. The method according to claim 6, characterized in that: The pH of the hydrolysis is 6-6.
4.
8. The use according to claim 6 or 7, characterized in that: The hydrolysis temperature is 40-50°C; And / or, the hydrolysis temperature is 46°C.
9. A method for hydrolyzing pNPA, comprising the following steps: using the protein according to claim 1 as an enzyme to hydrolyze pNPA.
10. The use according to claim 9, characterized in that: The pH of the hydrolysis is 6-6.4; Alternatively, the hydrolysis temperature is room temperature.