DNA hydrogel and application thereof in lead ion detection

By designing the hairpin structure and trigger probe of DNA hydrogel, combined with capillary detection, efficient identification and specific detection of lead ions are achieved, and the complex and cost-effective detection of detection methods in the prior art is solved, and rapid, simple and economical detection of heavy metal ions is achieved.

CN120060243APending Publication Date: 2025-05-30KUNMING UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510298768.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The existing heavy metal ion detection technology requires expensive equipment and complex operations, making it difficult to achieve high sensitivity, fast and selective detection methods.

Method used

Using a detection method based on DNA hydrogel, the hairpin structure and trigger probe of H1 and H2 chains were designed, and the responsive DNA hydrogel was synthesized using hybrid chain reactions, and the capillary detection method was combined with capillary detection to achieve rapid visual detection of lead ions.

Benefits of technology

It realizes efficient identification and specific detection of lead ions. The detection method is simple and low-cost, and does not require complex instruments. It is suitable for on-site operation and has high sensitivity and selectivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060243A_ABST
    Figure CN120060243A_ABST
Patent Text Reader

Abstract

The DNA hydrogel is prepared by adopting a hairpin structure of an H1 chain, a hairpin structure of an H2 chain and a trigger probe to perform a hybridization chain reaction, the DNA hydrogel is applied to lead ion detection, specifically, a to-be-detected sample is added into the DNA hydrogel, after standing, liquid in the mixture is sucked by a capillary tube, and when the volume of the liquid in the capillary tube is obviously higher than that of the added to-be-detected sample, it is indicated that the to-be-detected sample contains lead ions; the preparation method is simple, the detection method is visual, field operation is convenient, detection can be achieved without complex instruments, and the kit is low in cost, rapid, simple, convenient, economical, high in sensitivity and good in specificity; a powerful guarantee is provided for research and development of a heavy metal ion sensing technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of heavy metal ion detection, and particularly relates to a DNA hydrogel and its application in rapid visual detection of lead ions. Background Art

[0002] The increase in modern industrial activities has led to the problem of toxic heavy metal pollution such as lead (Pb 2+ ). It is necessary to analyze and detect heavy metals. Atomic absorption and ICP-MS are the best detection technologies in terms of sensitivity and selectivity, but instrumental analysis usually requires expensive equipment, complex pretreatment or cumbersome operations. Many researchers are committed to developing a heavy metal detection method with high sensitivity, rapidity and good selectivity.

[0003] Great research progress has been made in the detection of heavy metal ions by DNA hydrogels. Stimuli-responsive DNA hydrogels have received extensive attention in biosensors due to their advantages such as programmability, portability and easy storage. DNA hydrogels can quickly respond to external environmental stimuli (pH, heavy metal ions, biomolecules, etc.). The sensing ability of DNA hydrogels can be achieved by changing volume swelling, mechanical properties, crosslinking density and releasing signal substances. In recent years, targeted-responsive DNA hydrogels, due to the gel-to-sol transition, combined with the characteristics of DNA sequence designability, specific recognition and catalytic activity, provide a sensitive, stable, portable, selective and visual detection platform for biosensors. Many researchers have constructed different DNA hydrogel visual detection platforms for detecting various ions, chemical molecules and biomolecules. These methods have high specificity and selectivity. At the same time, the encapsulation process is essential, and a large amount of DNA hydrogel is required for each sample. Based on this, a biosensing system for visual detection of DNA hydrogels can be designed by using target heavy metal ions to cause hydrogel collapse. Summary of the Invention

[0004] The present invention provides a DNA hydrogel and its application in the detection of lead ions, and the present invention realizes the efficient recognition and rapid detection with high sensitivity of lead ions.

[0005] To achieve the above object, the technical scheme adopted by the present invention is as follows: 1. Preparation of the hairpin structure of H1 strand or the hairpin structure of H2 strand After dissolving the H1 strand or H2 strand with 1×TAE-Mg 2+ buffer solution, denature at 95°C for 10 min, quickly cool to -4°C and keep for 1 h to obtain the hairpin structure of H1 strand or the hairpin structure of H2 strand; The nucleotide sequence of the H1 strand is GATCGCGATCCTCACTATrAGGAAGAGATGCAGTCAGTCATCTCTTCC; The nucleotide sequence of the H2 strand is CATCTCTGAAGTAGCGCCGCCGTATAGTGAGGGAAGAGATGACTGACTG.

[0006] 2. Preparation of DNA hydrogel Mix the hairpin structure of the H1 strand at a concentration of 320 - 640 μmol / L, the hairpin structure of the H2 strand at a concentration of 320 - 640 μmol / L, and the trigger probe at a concentration of 12 - 100 μmol / L, and incubate at 37 °C for 12 h for hybridization chain reaction to obtain the DNA hydrogel, where the addition amounts of the hairpin structure of the H1 strand and the hairpin structure of the H2 strand are equal; The nucleotide sequence of the trigger probe is CATCTCTGA AGTAGCGCCGCCGTATAGTGAG.

[0007] 3. Application of DNA hydrogel in lead ion detection Add the sample to be detected to the DNA hydrogel. After standing for 50 - 70 min, suck the liquid in the mixture with a capillary. When the volume of the liquid in the capillary is significantly higher than the volume of the sample to be detected added, it indicates that the sample to be detected contains lead ions. The lead ions specifically cleave the hybridization chain reaction product, destroying the hydrogel network structure and forming a sol liquid.

[0008] Compared with the prior art, the present invention has the following beneficial effects: Based on the substrate strand and enzyme strand of the lead ion DNAzyme, the present invention designs the H1 strand and the H2 strand, prepares the hairpin structure with the H1 strand or the H2 strand, and synthesizes the responsive DNA hydrogel through hybridization chain reaction (HCR). Applying the DNA hydrogel of the present invention in the detection of lead ions, the experimental results show that the DNA hydrogel has strong recognition ability and selectivity for lead ions and can achieve specific detection of lead ions; adopting the capillary detection method, the change in the volume of the sample to be detected can be visually observed, and thus it can be judged whether the sample to be detected contains lead ions. The method of the present invention is simple to prepare, the detection method is intuitive and convenient for on-site operation, can be detected without complex instruments, and has low cost, providing a strong guarantee for the research and development of rapid, simple and economical heavy metal ion sensing technology. Description of the drawings

[0009] Figure 1 It is a schematic diagram of the morphological structure of the DNA hydrogel of Example 1; Figure 2 It is the fluorescence scanning result after the HCR product is cleaved by lead ions; Figure 3Schematic diagram of the morphological structure of the DNA hydrogel in Example 2; Figure 4 Schematic diagram of the morphological structure of the DNA hydrogel in Example 3; Figure 5 Specific detection result diagram of the present invention; Figure 6 Sensitivity detection result diagram of the present invention, where Figure a is the fluorescence detection diagram and Figure b is the standard curve between fluorescence intensity and lead ion concentration; Figure 7 Specificity diagram of the visual detection system of the DNA hydrogel combined with a capillary, where Figure a is a columnar statistical chart and Figure b is the capillary observation result; Figure 8 Sensitivity diagram of the visual detection system of the DNA hydrogel combined with a capillary; Figure 9 Schematic diagram of the result of detecting lead ions in actual samples by the DNA hydrogel combined with a capillary, where the upper scale is blank, the middle scale is wine, and the lower scale is tea extract. Detailed implementation mode

[0010] The content of the present invention is further illustrated by the following examples, but these examples do not limit the protection scope of the present invention. The methods in the examples are all conventional methods without special instructions, and the reagents used are all conventional commercially available reagents or reagents prepared according to conventional methods without special instructions; Example 1: Preparation of DNA hydrogel 1. Refer to the literature and design the H1 strand, H2 strand, and trigger probe according to the DNAzyme sequence of Pb 2+ , which are synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the sequences are as follows: H1 strand: GATCGCGATCCTCACTATrAGGAAGAGATGCAGTCAGTCATCTCTTCC (SEQ ID NO:1); H2 strand: CATCTCTGAAGTAGCGCCGCCGTATAGTGAGGGAAGAGATGACTGACTG (SEQ ID NO:2); Trigger probe: CATCTCTGAAGTAGCGCCGCCGTATAGTGAG (SEQ ID NO:3); 2. Preparation of DNA hydrogel The synthesized H1 strand, H2 strand, and trigger probe are attached to the centrifuge tube wall in a very light dry film state. Centrifuge at 1000 r / min for 5 min to prevent loss. According to the DNA synthesis report form, use 1×TAE-Mg2+ Dissolve the H1 chain and H2 chain in buffer to prepare an H1 chain solution and an H2 chain solution with a concentration of 600 μmol / L; denature the H1 chain solution and H2 chain solution at 95 °C for 10 min respectively, quickly cool to 4 °C and keep for 1 h to prepare a hairpin structure of the H1 chain or a hairpin structure of the H2 chain with a concentration of 600 μmol / L.

[0011] According to the volume ratio of 5:5:1, mix 45 μL of the hairpin structure of the H1 chain with a concentration of 600 μmol / L, 45 μL of the hairpin structure of the H2 chain with a concentration of 600 μmol / L, and 9 μL of a 12 μmol / L trigger probe (prepared with 1×TAE-Mg 2+ buffer). Incubate at 37 °C for 12 h for hybridization chain reaction to obtain a DNA hydrogel. Judge whether the hydrogel is formed according to the water stain on the filter paper. Place the DNA gel and water on the filter paper respectively. It can be seen from Figure 1 this that the DNA hydrogel will not have a water stain on the filter paper, while water will form a water stain on the filter paper.

[0012] 3. Verification experiment that the DNA hydrogel (HCR product) can be specifically cleaved by lead ions (1) Design the H3 chain and H4 chain according to the enzyme chain and substrate chain of the DNAzyme of Pb 2+ ; Substrate chain: CTCACTATrAGGAAGAGATGTCTGT; Enzyme chain (I): ACAGACATCTCTGAAGTAGCGCCGCCGTATAGTGAG; H3 chain: CTCACTATrAGGAAGAGATGCAGTCAGTCATCTCTTCC; H4 chain: FAM-CATCTCTGAAGTAGCGCCGCCGTATAGTGAGGGAAGAGATGACTGACTG-BHQ1; The synthesized H3 chain, H4 and enzyme chain are attached to the centrifuge tube wall in a very light dry film state. Centrifuge at 1000 r / min for 5 min to prevent loss. According to the DNA synthesis report form, dissolve the H3 chain, H4 chain and enzyme chain with 1×TAE-Mg 2+ buffer to prepare an H3 chain solution and an H4 chain solution with a concentration of 250 μmol / L, and an enzyme chain solution with a concentration of 250 μmol / L; Mix 400 μL of 250 μmol / L H3 chain solution, 400 μL of H4 chain solution, and 80 μL of 250 μmol / L enzyme chain solution, denature at 95 °C for 10 min, conduct HCR reaction. After the reaction ends, slowly cool to room temperature and stand for 2 h to obtain HCR products; Add 40 μL of 250 μmol / L lead ion solution to the HCR products. At the same time, set 40 μL of distilled water added to the HCR products as a negative control, and the HCR products without adding any substances as a blank control; After standing for 60 min, the fluorescence of the 3 samples was scanned at a wavelength of 521 nm to detect the fluorescence signal intensity. The results are as Figure 2 shown. It can be seen from the figure that the fluorescence intensities of the experimental group with added lead ions and the negative control group are higher than those of the blank control group. And when lead ions are present, the HCR products are cleaved, fluorescence resonance energy transfer disappears, and the fluorescent groups are exposed in the solution to emit fluorescence signals, resulting in the fluorescence intensity of the experimental group being higher than that of the negative control group, indicating that the HCR products can be specifically cleaved by lead ions.

[0013] Example 2: Preparation of DNA hydrogel The synthesized H1 chain or H2 chain adheres to the centrifuge tube wall in a very light dry film form. Centrifuge at 1000 r / min for 5 min to prevent loss. According to the DNA synthesis report, use 1×TAE-Mg 2+ buffer solution to prepare H1 chain solution, H2 chain solution with a concentration of 320 μmol / L, and trigger probe with a concentration of 50 μmol / L; Denature the H1 chain solution and H2 chain solution at 95 °C for 10 min, and quickly cool to -4 °C and keep for 1 h to prepare a hairpin structure of H1 chain or H2 chain with a concentration of 320 μmol / L; Mix 45 μL of the hairpin structure of 320 μmol / L H1 chain, 45 μL of the hairpin structure of 320 μmol / L H2 chain, and 9 μL of 50 μmol / L trigger probe according to the volume ratio of 5:5:1, incubate at 37 °C for 12 h for hybridization chain reaction to obtain DNA hydrogel. The results are shown in Figure 3 , and it can be seen from the figure that no water stain is produced on the filter paper by the DNA hydrogel, indicating that the method of this example can form a hydrogel.

[0014] Example 3: Preparation of DNA hydrogel The synthesized H1 chain or H2 chain adheres to the centrifuge tube wall in a very light dry film form. Centrifuge at 1000 r / min for 5 min to prevent loss. Use 1×TAE-Mg 2+Prepare H1 chain solution and H2 chain solution with a concentration of 640 μmol / L by dissolving them in buffer, and a trigger probe with a concentration of 100 μmol / L; denature the H1 chain solution and H2 chain solution at 95 °C for 10 min, quickly cool to -4 °C and maintain for 1 h to obtain a hairpin structure of H1 chain or H2 chain with a concentration of 640 μmol / L.

[0015] Mix 45 μL of the hairpin structure of H1 chain with a concentration of 640 μmol / L, 45 μL of the hairpin structure of H2 chain with a concentration of 640 μmol / L, and 9 μL of the trigger probe with a concentration of 100 μmol / L according to the volume ratio of 5:5:1, and incubate at 37 °C for 12 h for hybridization chain reaction to obtain a DNA hydrogel. The results are shown in Figure 4 , and it can be seen from the figure that the DNA hydrogel does not produce water stains on the filter paper, indicating that the method of this example can form a hydrogel.

[0016] Example 4: Specificity detection experiment of the detection system To verify the specificity of the detection system of the present invention for Pb 2+ , mix 400 μL of 250 μmol / L H3 chain solution, 400 μL of 250 μmol / L H4 chain solution, and 80 μL of 250 μmol / L enzyme chain, and carry out HCR reaction by denaturing at 95 °C for 10 min. After the reaction, the system is slowly cooled to room temperature and left standing for 2 hours to obtain an HCR product. Add 40 μL of Pb 2+ solution with a concentration of 10 μM to the HCR product, leave standing for 60 min, and then detect with an enzyme-labeled instrument and analyze through fluorescence signal values; At the same time, measure the specificity of other different heavy metal ions (Cu 2+ , Zn 2+ , Ca 2+ , Fe 3+ , Ni 2+ , Cr 2+ , K + , Cd 2+ , Mn 2+ ) and the mixed solution on the detection system under the same above conditions; the mixed solution is a liquid obtained by mixing the above 10 metal ions according to the above concentrations.

[0017] The results are shown in Figure 5 , and it can be seen from the figure that when the concentration of Pb 2+ is 10 μM and the concentrations of other metal ions are 1 mM, when adding Pb 2+The fluorescence intensity of the experimental group was significantly higher than that of the experimental groups adding other metal ions. In the case of mixed detection, the fluorescence intensity of the mixed solution group was also significantly higher than that of the experimental groups adding other metal ions. The experimental results show that the detection system of the present invention has specificity and anti-interference ability for lead ions. Therefore, the constructed detection system can specifically detect the target heavy metal ions.

[0018] Example 5: Sensitivity detection experiment of the detection system To verify the sensitivity of the developed detection system, Pb 2+ solutions were prepared into solutions with different concentrations, with concentrations of 0, 70 nM, 80 nM, 90 nM, 100 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, and 800 nM. The preparation of the HCR product in this example was the same as that in Example 4. Add the above-mentioned concentrations of Pb 2+ solutions to the HCR product. After standing for 60 min, use a microplate reader to detect the fluorescence intensity at a wavelength of 521 nm. By measuring the fluorescence intensities of a series of samples with known lead ion concentrations, a standard curve between the fluorescence intensity and the lead ion concentration was plotted to obtain a linear equation.

[0019] The results are shown in Figure 6 a. In the concentration range of 0 - 800 nM, the fluorescence intensity of the reaction product decreased with the decrease in the concentration of Pb 2+ . When the concentration of Pb 2+ was 100 - 800 nM, △F showed a linear relationship with the concentration, as shown in Figure 6 b. The linear equation for the detection system of Pb 2+ was Y = 91.94647X + 22486.9704 (X is in nM units), the linear correlation coefficient was R 2 = 0.99903, and the detection limit was 42.67 nM. The detection system of the present invention has high sensitivity and a wide detection limit.

[0020] Example 6: Visual detection of DNA hydrogel combined with capillary 1. Prepare the DNA hydrogel according to the method in step 2 of Example 1. 2. Add 10 μL of a Pb 2+ solution with a concentration of 10 μM to the DNA hydrogel, and at the same time add other metal ion solutions with the same concentration (Cu 2+ , Zn 2+ , Ca 2+ , Fe 3+ , Ni 2+ , Cr 2+ , K + , Cd 2+ , Mn2+ 10 μL, and at the same time, a blank control without adding the metal solution was set. After standing for 60 min, the liquid after the reaction was aspirated with a capillary, and the capillary was placed above the scale for reading, with two decimal places reserved. The results are shown in Figure 7 , it can be seen from the figure that in the experimental group after adding the lead ion solution, the increase in the solution in the capillary was significantly higher than that in the control group adding other metal ions, indicating that lead ions have a specific cleavage effect on the HCR product in the DNA hydrogel, destroying the DNA hydrogel network structure and forming a sol liquid.

[0021] 3. To verify the detection sensitivity of the DNA hydrogel and capillary binding detection system, lead ion solutions with concentrations of 0.03, 0.05, 0.07, 0.09, 0.1, 0.3, 0.5, 0.7, 0.9, 1, 3, 5 μM were added to the DNA hydrogel. After standing for 60 min, the liquid after the reaction was aspirated with a capillary, and the capillary was placed above the scale for reading, with two decimal places reserved. A standard curve was plotted based on the liquid flow distance in the capillary and the lead ion concentration, and the linear regression equation Y = 0.55736X + 1.2654 (R 2 = 0.99672) was obtained. The results are shown in Figure 8 , it can be seen from the figure that there is a good linear relationship between the Pb 2+ concentration between 0.1 - 0.9 μM. The results show that the liquid flow distance in the capillary can be used to determine the lead ion concentration in the sample to be detected, achieving the purpose of quantitative detection.

[0022] Example 7: Detection of actual samples using DNA hydrogel 1. The DNA hydrogel was prepared by referring to the method in step 2 of Example 1; 2. Green tea and wine were selected as the detection samples. After grinding the tea leaves and sieving to remove the stems, 0.05 g was weighed, dissolved in 1 mL of ultrapure water, and extracted at 90 °C in a constant temperature mixer at 600 r / min for 30 min, cooled to room temperature, centrifuged at 10000 r / min for 15 min, and filtered through a 0.22 μM filter to obtain 1 mL of extract; the wine was used as the detection sample with the original solution; the pH of the green tea extract and wine was adjusted to 7.4 - 8.0.

[0023] 3. Detection of the combination of DNA hydrogel and capillary Add 20 μL of tea extract or wine to the prepared DNA hydrogel, and set up a blank control with 20 μL of distilled water added. Shake well and let stand at room temperature for 60 min. Pipette the reacted liquid with a capillary tube. If the tea extract or wine contains lead ions, it will cut the DNA hydrogel. Finally, pipette out the amount of collapsed DNA hydrogel with a capillary tube, place the capillary tube above a scale for reading, and retain two decimal places. To ensure the accuracy and reliability of the constructed detection system, perform three repetitions. The capillary results are shown in Figure 9 , and it can be clearly seen that the flow distances of the tea soup and wine are significantly higher than those of the blank control group, indicating that metallic lead ions are detected in the tea soup and wine.

Claims

1. A DNA hydrogel, characterized in that: DNA hydrogel is prepared by hybridization chain reaction using the hairpin structure of H1 chain, the hairpin structure of H2 chain and trigger probe; The nucleotide sequence of the H1 chain is GATCGCGATCCTCACTATrAGGAAGAGATGCAGTCAGTC ATCTCTTCC; The nucleotide sequence of the H2 chain is CATCTCTGAAGTAGCGCCGCCGTATAGTGAGGGAAGAGATGACTGACTG; The nucleotide sequence of the trigger probe was CATCTCTGA AGTAGCGCCGCCGTATAGTGAG.

2. The DNA hydrogel according to claim 1, characterized in that: The hairpin structure of the H1 chain or the hairpin structure of the H2 chain is obtained by mixing the H1 chain or the H2 chain with 1×TAE-Mg 2+ After the buffer solution is dissolved, it is denatured at 95°C for 10 min, rapidly cooled to -4°C and kept for 1 h.

3. The DNA hydrogel according to claim 1, characterized in that: The hairpin structure of the H1 chain at a concentration of 320-640 μmol / L, the hairpin structure of the H2 chain at a concentration of 320-640 μmol / L, and the trigger probe at a concentration of 12-100 μmol / L were mixed and incubated at 37°C for 12 h for hybridization chain reaction to obtain DNA hydrogel, in which the added amounts of the hairpin structure of the H1 chain and the hairpin structure of the H2 chain were equal.

4. Use of the DNA hydrogel according to any one of claims 1 to 3 in lead ion detection.

5. The use according to claim 4, characterized in that: The sample to be tested is added to the DNA hydrogel, and after standing, the liquid in the mixture is absorbed by a capillary. When the volume of the liquid in the capillary is significantly higher than the volume of the added sample to be tested, it indicates that the sample to be tested contains lead ions.