Dsfar2@zif-8 nanocomposite, preparation method thereof and application thereof in control of quadraspidiotus perniciosus

Abstract

The application belongs to the technical field of biotechnology, and particularly discloses a dsFAR2@ZIF-8 nano-complex, a preparation method thereof and application of the dsFAR2@ZIF-8 nano-complex in control of cassava mealybug. The dsFAR2@ZIF-8 nano-complex is prepared by combining RNAi technology and nano materials and by wrapping dsRNA with ZIF-8 nanoparticles, and can effectively inhibit expression of a key gene FAR2 for wax synthesis of the cassava mealybug, significantly improve mortality of the cassava mealybug and significantly reduce the reproductive capacity of the cassava mealybug. Moreover, the FAR2 gene only plays a role when the cassava mealybug feeds on plants, and has obvious species specificity. Therefore, the dsFAR2@ZIF-8 nano-complex for the key gene for wax synthesis of the cassava mealybug has good advantages such as species specificity, safety and high efficiency in control of the cassava mealybug, has a good market application prospect and potential economic and ecological benefits in green control of the cassava mealybug, and can provide a new target technology and a new idea for innovative control methods of mealybugs.

Description

Technical Field

[0001] This invention relates to the field of dsFAR2@ZIF-8 nanocomposite, its preparation method, and its application in the control of cassava mealybug. Background Technology

[0002] Cassava mealybug ( Phenacoccus manihoti Matile-Ferrero Cassava mealybugs, belonging to the order Hemiptera, family Mealycidae, and genus *Cassava*, are one of the four major pests of cassava. They often cause yield reductions of over 50%, and in severe cases, lead to the death of the entire plant and total crop failure, resulting in annual losses exceeding US$2 billion. Given the widespread and severe occurrence and damage caused by cassava mealybugs in major cassava-producing areas of my country, such as Hainan, Guangdong, Guangxi, and Yunnan, particularly their ability to cause outbreaks throughout the entire growth cycle, and the scarcity of currently registered effective chemical pesticides, finding green and efficient control methods for cassava mealybugs has become a major challenge urgently needing to be addressed in the development of the cassava industry.

[0003] Mealybugs have a waxy coating on their bodies, which helps prevent moisture loss, reduces the penetration of harmful substances such as chemicals into the insects, protects them from pathogens and predators, and influences the behavior of parasitic wasps. Therefore, the waxy coating is a crucial factor limiting the effectiveness of mealybug control. Breaking down the waxy barrier is the key to effective control of mealybugs. FAR2 is the most characteristic key gene for wax synthesis in cassava mealybugs that we have identified, but its function and application are rarely reported.

[0004] RNA interference (RNAi) is a technique that introduces dsRNA (double-strand RNA) homologous to the target gene into a living organism, causing gene silencing. Compared to other research methods, it offers advantages such as specificity, safety, and high efficiency, and is widely recognized both domestically and internationally as a promising approach for pest control and resistance management. Identifying highly efficient functional genes and constructing stable double-stranded RNA (dsRNA) delivery systems are crucial for enhancing the application potential of RNAi technology.

[0005] If RNAi technology and nanomaterials can be combined, encapsulating dsRNA with ZIF-8 nanoparticles may inhibit the expression of the FAR2 gene, a key gene for wax synthesis in cassava mealybugs, significantly increasing the mortality rate of cassava mealybugs and significantly reducing their reproductive capacity.

[0006] Therefore, there is an urgent need to develop a dsFAR2@ZIF-8 nanocomposite. Summary of the Invention

[0007] In order to solve the above technical problems, the application provides a dsFAR2@ZIF-8 nano-complex, a preparation method thereof and application of the dsFAR2@ZIF-8 nano-complex in control of Pseudaulacaspis pentagona.

[0008] In order to achieve the above object, the application is implemented according to the following technical scheme:

[0009] The first technical scheme provided by the application is a preparation method of a dsFAR2@ZIF-8 nano-complex, comprising the following steps:

[0010] S1, synthesizing dsFAR2 according to the gene sequence of a wax synthesis key gene of Pseudaulacaspis pentagona FAR2 The dsFAR2 is as described in SEQ ID NO. 2, and the primer includes:

[0011] ds FAR2 -F: taatacgactcactatagggTGTTCGCCTTACCACTAT;

[0012] vsFAR2-R: taatacgactcactatagggCGATCATAAATCCCACAG;

[0013] S2, dissolving 1 g of Zn(NO3)2·6H2O in 10 mL of deionized water, and magnetically stirring to obtain solution A;

[0014] S3, adding 100 mg of dsFAR2 to the solution A and stirring uniformly to obtain solution B;

[0015] S4, dissolving 13.76 g of 2-methylimidazole in 90 mL of deionized water to obtain solution C;

[0016] S5, adding the solution C to the solution B, magnetically stirring at room temperature for 30 minutes, centrifuging to collect the nanoparticles, and washing with deionized water for 3 times to obtain the dsFAR2@ZIF-8 nano-complex.

[0017] Further, in the step S5, the centrifugal force for centrifuging to collect the nanoparticles is 10000 g.

[0018] The second technical scheme provided by the application is a dsFAR2@ZIF-8 nano-complex prepared by the above method.

[0019] The third technical solution provided by the application is an application of the dsFAR2@ZIF-8 nano-complex in the prevention and control of cassava mealybugs, wherein the dsFAR2@ZIF-8 nano-complex is dissolved in water to obtain a dsFAR2@ZIF-8 aqueous solution, and the dsFAR2@ZIF-8 aqueous solution is sprayed on the upper leaves of cassava plants.

[0020] Preferably, the concentration of the dsFAR2@ZIF-8 aqueous solution is 500 ng / mL or 1000 ng / mL.

[0021] The fourth technical solution provided by the application is a cassava mealybug prevention and control agent, which is composed of a dsFAR2@ZIF-8 aqueous solution with a concentration of 500 ng / mL or 1000 ng / mL.

[0022] Compared with the prior art, the application combines RNAi technology and nanomaterials, and the dsFAR2@ZIF-8 nano-complex prepared by wrapping dsRNA with ZIF-8 nanoparticles can effectively inhibit the expression of the wax synthesis key gene FAR2 of cassava mealybugs, significantly improve the mortality of cassava mealybugs, and significantly reduce the reproductive capacity of cassava mealybugs; moreover, the FAR2 gene only plays a role when the cassava mealybugs feed on plants, and has obvious species specificity. Therefore, the application of the dsFAR2@ZIF-8 nano-complex of the wax synthesis key gene of cassava mealybugs in the prevention and control of cassava mealybugs has good species specificity, safety and high efficiency, and has a good market application prospect and potential economic and ecological benefits in the green prevention and control of cassava mealybugs, and can provide a new target technology and new ideas for innovative mealybug control methods. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 It is a PCR amplification electrophoretogram of the wax synthesis key gene FAR2 of cassava mealybugs of the application, wherein M represents a DNA marker, and 1 represents FAR2.

[0024] Figure 2 It is the inhibition effect of aqueous solutions of different concentrations of dsFAR2@ZIF-8 nano-complexes on the expression of the wax synthesis key gene FAR2 of cassava mealybugs.

[0025] Figure 3 It is the inhibition effect of aqueous solutions of different concentrations of dsFAR2@ZIF-8 nano-complexes on the reproductive capacity of cassava mealybugs.

[0026] Figure 4 It is the lethal effect of aqueous solutions of different concentrations of dsFAR2@ZIF-8 nano-complexes on cassava mealybugs.

[0027] Figure 5The field control effect of the water solution of 500 ng / mL dsFAR2@ZIF-8 nanocomposites on cassava mealybug.

[0028] Figure 6 Figures for physicochemical performance characterization of ZIF-8 nanoparticles and dsFAR2@ZIF-8 nanocomposites: (A) scanning electron microscope image of ZIF-8 nanoparticles; (B) scanning electron microscope image of dsFAR2@ZIF-8 nanocomposites; (C) particle size distribution diagram of ZIF-8 nanoparticles and dsFAR2@ZIF-8 nanocomposites; (D) Zeta potential of ZIF-8 nanoparticles and dsFAR2@ZIF-8 nanocomposites. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application is further described in detail below in combination with examples. The specific examples described herein are only used to explain the present application and do not limit the present application.

[0030] Example 1, synthesis of dsFAR2@ZIF-8 nanocomposites

[0031] The sequence of the key gene FAR2 for wax synthesis is obtained by cassava mealybug non-reference transcriptome analysis, and the sequence of FAR2 (see SEQ ID NO. 3) is as follows:

[0032] AATAAATTTTCTTCTTTCGTACGCTCGTGGTGCGAATTAGATACGAAAATGGTATAGAGTTTCCAATTTGTTCGTACTAATAGAGAAATTGTGGAGTAATTTGTTACGATTAGCCGGATCAAGGTAAACATTTACCATCCAATTTAGCCAAACATGGAAGAATCGATCGAGCATTTCTTCGACGGACGTTCGCTGTTCATCACCGGCGGCACCGGGTTTATGGGTAAAGTGCTGATCGAGAAGTTGCTACGCTCGTGCCCGGGTATCGAGAGAATTTACGTACTCGTTAGACCCTCCAGGGAAGGCAAATGCGCCGCAGATAAGCTCAAAGATT TGTTCGCCTTACCACTATACGATCGGCTGAAACGAGAA AAAACCGAGCAGATTTTCAAAAAGGTGTATCCAATCGCCGGCGATATCAGGCAAATCGGTCTCGGCATTTCCGCCG AAGATAGGAAGGTGTTAACGGAAAACGTATCGGTGATATTTCACGCAGCCGCCAGCGTCAGATTCGACGATCCCAT CCACGAGGCTATTATCGTGAATACCCGAGGAACCAGGGAAGTAGTCGCGTTGGCCAAAGAGATCAAGAATATCGCG GTTTTAGTTCATGTATCGACTACATACTGTAATTGCTATCGTAAAGTGGTGGAGGAAAAGATTTATCCTCCGCCGA TGGATTGGAGAGAGGCGATAGCTATGGCGGAGAATTGCGATCCCGTTATCACAAATTTACTATCGAAGAAGTACTT GGGAGAGTTCCCGAATTCTTATGTTTTCACGAAAAATCTCGCGGAACACGTTCTACAGGACGAATGCAAAAATATA CCGGTAGTCATATTCAGACCATCGATAGTAATATCTTCGTTCAAAGAACCGGTACCAGGTTGGATCGATAATTTCA ACGGACCTGTGGGATTTATGATCG

[0033] In the above sequence, the sequence in the shaded part is the CDS sequence of FAR2 (see SEQ ID NO. 1), and the sequence in double underlined part is the dsFAR2 fragment (see SEQ ID NO. 2), which is a part of the CDS.

[0034] Primers for synthesizing dsRNA carrying T7 promoter were designed using the primer design website E-RNAi (https: / / www.dkfz.de / signaling / e-rnai3 / idseq.php):

[0035] dsFAR2-F: taatacgactcactatagggTGTTCGCCTTACCACTAT (see SEQ ID NO. 4);

[0036] vsFAR2-R: taatacgactcactatagggCGATCATAAATCCCACAG (see SEQ ID NO. 5);

[0037] dsFAR2 as shown in SEQ ID NO. 2 was synthesized according to the MEGAscript RNAi Kit instruction (Thermo Scientific, Wilmington, DE, USA) (https: / / www.thermofisher.com / cn / zh / home / references / protocols / rnai-epigenetics-and-gene-regulation / rnai-protocol / megascript-rnai-kit.html).

[0038] 1 g of Zn(NO3)2·6H2O was dissolved in 10 mL of deionized water, and after magnetic stirring to dissolve, solution A was obtained; 100 mg of dsFAR2 was added to the above solution A and stirred uniformly to obtain solution B; 13.76 g of 2-methylimidazole was dissolved in 90 mL of deionized water to obtain solution C; solution C was added to the above solution B, and magnetic stirring was performed at room temperature for 30 minutes; 10000 g centrifugation was performed to collect the nanoparticles, and after washing with deionized water for 3 times, dsFAR2@ZIF-8 nanocomposites were obtained.

[0039] Comparative Example 1: Synthesis of ZIF-8 nanoparticles

[0040] Dissolve 1 g Zn(NO3)2·6H2O in 10 mL deionized water, and after dissolution, obtain solution A by magnetic stirring; dissolve 13.76 g 2-methylimidazole in 90 mL deionized water to obtain solution C; add solution C to solution A above, and magnetically stir at room temperature for 30 minutes; collect the nanoparticles by centrifugation at 10,000 g, and obtain ZIF-8 nanoparticles after washing with deionized water for 3 times.

[0041] The physical and chemical performance characterization graphs of the prepared ZIF-8 nanoparticles and dsFAR2@ZIF-8 nanocomposites are as shown in Figure 6 , where Figure 6 (A) shows that ZIF-8 is a stable three-dimensional porous network structure with a smooth surface; (C) shows that the particle size of ZIF-8 is 317.4 nm; and (D) shows that the Zeta potential is 22.3 mV. Figure 6 , where Figure 6 (B) shows that the surface of dsFAR2@ZIF-8 becomes rough; (C) shows that the particle size becomes 367.0 nm; and (D) shows that the Zeta potential is -24.2 mV. Figure 6 Figure 6 Figure 6

[0042] Example 2: Control effect of dsFAR2@ZIF-8 nanocomposites on cassava mealybug

[0043] With water and ZIF-8 as controls, ZIF-8 and dsFAR2@ZIF-8 nanocomposites are dissolved in water to set 5 concentration gradients of 100 ng / mL, 200 ng / mL, 300 ng / mL, 500 ng / mL and 1000 ng / mL, and then female adult cassava mealybugs with consistent development duration and size collected from cassava variety SC205 plants in the field and reared on SC205 cassava plants in the indoor are inoculated on the upper leaves of the cassava variety SC205 plants transplanted for 30 days and sprayed with different concentrations of ZIF-8 and dsFAR2@ZIF-8 nanocomposites, respectively. The number of dead insects, the number of eggs laid per female, and the number of live insects are observed and counted at 1 d, 2 d, 4 d and 8 d after inoculation, and the total RNA of the cassava mealybugs is collected for qPCR determination and analysis of the expression amount of the wax synthesis key gene FAR2 of the cassava mealybugs. There are 6 leaves per inoculated plant, 30 insects per leaf, and 3 replicates for each concentration.

[0044] The PCR amplification electropherogram of the wax synthesis key gene FAR2 of the cassava mealybugs is as shown in Figure 1 ​​​The inhibition effect of aqueous solutions of dsFAR2@ZIF-8 nanocomposites with different concentrations on the expression of the wax synthesis key gene FAR2 of P. manihotus is shown in Figure 2 Figure 1 Figure 2 It can be seen that the aqueous solution of 500 ng / mL ZIF-8 has no effect on the expression of the wax synthesis key gene FAR2 of P. manihotus and has no lethal effect on P. manihotus; the aqueous solutions of 500 ng / mL and 1000 ng / mL dsFAR2@ZIF-8 nanocomposites have the best effect and can significantly inhibit the expression of the wax synthesis key gene FAR2 of P. manihotus.

[0045] The inhibition effect of aqueous solutions of dsFAR2@ZIF-8 nanocomposites with different concentrations on the fecundity of P. manihotus is shown in Figure 3 The lethal effect of aqueous solutions of dsFAR2@ZIF-8 nanocomposites with different concentrations on P. manihotus is shown in Figure 4 The field control effect of aqueous solutions of dsFAR2@ZIF-8 nanocomposites on P. manihotus is shown in Figure 5 Figure 3 Figure 4 Figure 5 It can be seen that spraying aqueous solutions of dsFAR2@ZIF-8 nanocomposites can significantly reduce the fecundity of P. manihotus and significantly increase the mortality rate of P. manihotus.

[0046] In summary, dsFAR2@ZIF-8 nanocomposites have good control effect on P. manihotus, which provides a direct scientific basis for the wide application of dsFAR2@ZIF-8 nanocomposites in the control of P. manihotus and provides a new target technology and new idea for innovative scale insect control methods. Therefore, it can be used for preparing P. manihotus control agents.

[0047] The technical solutions of the present application are not limited to the above specific embodiments, and any technical modification made according to the technical solutions of the present application falls within the protection scope of the present application.​​​​​

Claims

1. A method for preparing a dsFAR2@ZIF-8 nanocomposite, characterized in that, Comprising the following steps: S1. According to the gene sequence of cassava mealybug wax synthesis key gene FAR2, the dsFAR2 as described in SEQ ID NO. 2 is synthesized by using the designed primer for synthesizing dsRNA carrying T7 promoter; The primer comprises: dsFAR2-F: taatacgactcactatagggTGTTCGCCTTACCACTAT; vsFAR2-R: taatacgactcactatagggCGATCATAAATCCCACAG; S2. Dissolve 1 g of Zn(NO3)2·6H2O in 10 mL of deionized water, and after magnetic stirring and dissolution, obtain solution A; S3. Add 100 mg of dsFAR2 to the above solution A and stir uniformly to obtain solution B; S4. Dissolve 13.76 g of 2-methylimidazole in 90 mL of deionized water to obtain solution C; S5. Add solution C to the above solution B, and magnetically stir at room temperature for 30 minutes. Centrifuge to collect nanoparticles, and wash with deionized water for 3 times to obtain dsFAR2@ZIF-8 nanocomposite.

2. The method of claim 1, wherein the dsFAR2@ZIF-8 nanocomplex is prepared by the following steps: (a) mixing dsFAR2 and ZIF-8 in a solution; (b) removing the solution; and (c) drying the mixture. In the step S5, the centrifugal force for centrifuging to collect nanoparticles is 10000 g.

3. A dsFAR2@ZIF-8 nanocomposite prepared by the method of claim 1 or 2.

4. The dsFAR2@ZIF-8 nanocomposite of claim 3 for use in the prevention and control of cassava mealybug.

5. Use according to claim 4, characterized in that, The dsFAR2@ZIF-8 nanocomposite is dissolved in water to obtain a dsFAR2@ZIF-8 aqueous solution, and the dsFAR2@ZIF-8 aqueous solution is sprayed onto the upper leaves of cassava plants.

6. Use according to claim 5, characterized in that, The concentration of the dsFAR2@ZIF-8 aqueous solution is 500 ng / mL or 1000 ng / mL.

7. A pesticide for controlling cassava mealybugs, characterized in that, The dsFAR2@ZIF-8 aqueous solution consists of the dsFAR2@ZIF-8 nanocomposite of claim 3 with a concentration of 500 ng / mL or 1000 ng / mL.

Images