Gene related to high temperature tolerance of brassica rapa and application thereof
By identifying and overexpressing the BrNAC043 gene, and using quantitative real-time PCR and genetic engineering techniques, the problem of long breeding cycles for heat-resistant, non-heading Chinese cabbage varieties was solved. This enabled rapid identification and breeding of heat-resistant varieties, improved the heat resistance of non-heading Chinese cabbage, and significantly increased the plant's growth and survival rate under high-temperature conditions.
Patent Information
- Application Number
- CN202510284617.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2045-03-11
AI Technical Summary
Existing technologies for cultivating heat-resistant, non-heading Chinese cabbage have long cycles and slow results, making it difficult to effectively improve its heat resistance.
By identifying and overexpressing the BrNAC043 gene, its expression level was determined using quantitative real-time PCR. A vector was constructed using genetic engineering techniques and transformed into plants to improve the heat resistance of non-heading Chinese cabbage.
The method enables rapid identification and breeding of heat-resistant, non-heading Chinese cabbage varieties. Varieties with high BrNAC043 gene expression levels exhibit stronger heat resistance, significantly improving plant growth and survival rates under high-temperature conditions.
Smart Images

Figure CN120060278B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic breeding, and particularly relates to a gene related to high-temperature resistance of Brassica chinensis and application thereof. BACKGROUND
[0002] Brassica chinensis, also known as small rape, is an important vegetable crop widely cultivated in southern China, belonging to Brassica of Cruciferae, and plays an important role in the year-round supply of vegetables.
[0003] High temperature is the most common stress factor in vegetable production. Since Brassica chinensis prefers cool and cold climate and is not resistant to high temperature, the high-temperature stress in summer and autumn easily restricts the growth of Brassica chinensis in the field environment and affects the supply of Brassica chinensis in summer and autumn.
[0004] In the prior art, the methods for breeding high-temperature-resistant Brassica chinensis are mainly traditional planting and screening, which have the defects of long cycle and slow effect.
[0005] Therefore, from the genetic level, studying the high-temperature resistance mechanism of Brassica chinensis is an important means for breeding high-temperature-resistant Brassica chinensis. SUMMARY
[0006] (I) Technical problems solved
[0007] In view of the deficiencies in the prior art, the present application provides a gene related to high-temperature resistance of Brassica chinensis and application thereof to solve the technical problems of long cycle in breeding Brassica chinensis varieties with high-temperature resistance in the prior art.
[0008] (II) Technical solutions
[0009] To achieve the above object, the present application is implemented by the following technical solutions:
[0010] In a first aspect of the present application, a gene related to high-temperature resistance of Brassica chinensis is provided, which is named as BrNAC043 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1, and the amino acid sequence of which is shown in SEQ ID NO. 2.
[0011] In a second aspect of the present application, the application of the above-mentioned BrNAC043 gene in breeding high-temperature-resistant Brassica chinensis is also involved, which includes overexpression of the BrNAC043 gene to improve the high-temperature resistance of Brassica chinensis.
[0012] In a third aspect of the present application, the application of the above-mentioned BrNAC043 gene in identifying high-temperature resistance of Brassica chinensis is also involved, which is to judge the advantages and disadvantages of high-temperature resistance of various Brassica chinensis varieties according to the expression level of the BrNAC043 gene.
[0013] Further, the high-temperature tolerance of the Brassica rapa variety with high BrNAC043 gene expression is better than that of the Brassica rapa variety with low BrNAC043 gene expression.
[0014] The fourth aspect of the present application also relates to the vector of the above BrNAC043 gene, which is obtained by cutting the fragment shown in SEQ ID NO. 1 into the vector pCAMBIA1305.
[0015] The fifth aspect of the present application also relates to the obtaining method of the above BrNAC043 gene, which comprises amplifying the cDNA template of the Brassica rapa by using the primer pair composed of F1 and R1 to obtain the BrNAC043 gene; wherein the nucleotide sequence of F1 is shown in SEQ ID NO. 3, and the nucleotide sequence of R1 is shown in SEQ ID NO. 4.
[0016] The sixth aspect of the present application also relates to a method for identifying the high-temperature tolerance of the Brassica rapa, which comprises:
[0017] The BrNAC043 gene expression of the same position of each Brassica rapa plant obtained under the same culture condition is determined by using the fluorescent quantitative PCR method, and the high-temperature tolerance of each Brassica rapa variety is judged according to the BrNAC043 gene expression.
[0018] Further, the high-temperature tolerance of the Brassica rapa variety with high BrNAC043 gene expression is better than that of the Brassica rapa variety with low BrNAC043 gene expression.
[0019] Further, the primer pair used in the fluorescent quantitative PCR method is composed of F3 and R3; wherein the nucleotide sequence of F3 is shown in SEQ ID NO. 8, and the nucleotide sequence of R3 is shown in SEQ ID NO. 9.
[0020] (III) Beneficial effects
[0021] The present application provides a gene related to the high-temperature tolerance of the Brassica rapa and the application thereof, which has the following beneficial effects compared with the prior art:
[0022] The application discloses a nucleotide sequence of a BrNAC043 gene in non-heading Chinese cabbage. The high-temperature resistance of various non-heading Chinese cabbage varieties can be judged according to the expression amount of the BrNAC043 gene, wherein the non-heading Chinese cabbage variety with a high BrNAC043 gene expression amount is superior to the non-heading Chinese cabbage variety with a low BrNAC043 gene expression amount in high-temperature resistance, and the gene and the method are helpful to the genetic breeding of non-heading Chinese cabbage. BRIEF DESCRIPTION OF DRAWINGS
[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.
[0024] Figure 1 A comparison chart of the expression amount of the BrNAC043 gene in different non-heading Chinese cabbage materials at normal temperature;
[0025] Figure 2 A comparison chart of the expression amount of the BrNAC043 gene in different non-heading Chinese cabbage materials at high temperature;
[0026] Figure 3 A comparison chart of the expression amount of the BrNAC043 gene in wild type and overexpression strains;
[0027] Figure 4 A comparison chart of the phenotype of wild type and overexpression BrNAC043 gene strains at normal temperature and high temperature;
[0028] Figure 5 A non-heading Chinese cabbage BrNAC043 gene PCR amplification gel chart;
[0029] Figure 6 A non-heading Chinese cabbage BrNAC043 gene bacterial liquid PCR identification gel chart. DETAILED DESCRIPTION
[0030] In order to make the purpose, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions of the embodiments of the present application are described clearly and completely. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.
[0031] Embodiment 1
[0032] The following operations are performed on the non-heading Chinese cabbage germplasm of the variety QS054.
[0033] The acquisition of the Brassica rapa L. BrNAC043 gene includes the following steps:
[0034] Step 1. Extraction of total RNA of Brassica rapa L. genome and synthesis of cDNA: The total RNA of Brassica rapa L. genome was extracted according to the instruction of Takara RNA extraction kit. After the obtained RNA was quantified, cDNA was synthesized by adding sample according to the system in Table 1. The synthesis was carried out according to the instruction of Takara reverse transcription.
[0035] Table 1
[0036] Reagent Volume (μL) 5x gDNA Eraser Buffer 2 gDNA Eraser 1 Total RNA 1 μg RNase Free ddH2O Up to 10 μl PrimeScript RT Enzyme Mix I 1 RT Primer Mix 1 5x PrimeScript Buffer 2 4 RNase Free ddH2O 4 Total 20
[0037] Step 2. Acquisition and recovery and purification of Brassica rapa L. BrNAC043 gene
[0038] Step 2.1, the cDNA template obtained in step 1 was subjected to PCR amplification using the upstream primer F1 (nucleotide sequence as shown in SEQ ID NO. 3) and the downstream primer R1 (nucleotide sequence as shown in SEQ ID NO. 4) to obtain the BrNAC043 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1, and the amino acid sequence of which is shown in SEQ ID NO. 2, and the amplification system is shown in Table 2; wherein the PCR amplification running program is as follows: 95℃ for 3 min, 95℃ for 15 s, 58.5℃ for 15 s, 72℃ for 40 s, return to the second step, repeat 34 cycles (i.e. (95℃ for 15 s, 58.5℃ for 15 s, 72℃ for 40 s) for 34 cycles), 72℃ for 10 min, 8℃ for 10 min.
[0039] Table 2
[0040] Reagent Volume (μL) 2x Phanta Max Master Mix 12.5 cDNA 1 F-Primer 1 R-Primer 1 RNase Free ddH2O 9.5 Total 25
[0041] Step 2.2, the 5' end of the upstream primer F1 was added with endonuclease BamH I and a protection base (obtaining the upstream primer F2, the nucleotide sequence of which is shown in SEQ ID NO. 5), and the 5' end of the downstream primer R1 was added with endonuclease Hind III and a protection base (obtaining the downstream primer R2, the nucleotide sequence of which is shown in SEQ ID NO. 6);
[0042] Step 2.3, 1 ul of the PCR amplification product obtained in step 1 was taken as the cDNA template, and the upstream primer F2 and the downstream primer R2 obtained in step 2.2 were used for PCR amplification. The obtained product was detected by 1% agarose electrophoresis, and the electrophoresis result is shown in Figure 5The DNA fragment of expected size was cut from the agarose gel, and the target DNA fragment was recovered according to the TIANgel Purification Kit instructions to obtain the gel recovery product. The primers above were synthesized by a general biological company; the amplification system of this step is shown in Table 2, and the PCR amplification running program is as follows: 95°C for 3 min, 95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s, return to the second step, repeat 34 cycles (i.e. (95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s) for 34 cycles), 72°C for 10 min, and 8°C for 10 min.
[0043] Step 3. Cloning vector construction and transformation of E. coli
[0044] Step 3.1, the vector pCAMBIA1305 was double-digested with endonuclease BamH I and endonuclease Hind III according to the system shown in Table 3 to obtain a linearized vector;
[0045] Table 3
[0046] Reagent Volume (μL) 10x Quick Buffer 5 BamH I 1 Hind III 1 1305 plasmid 7.5 RNase Free ddH2O 10.5 Total 25
[0047] Step 3.2, the gel recovery product obtained in step 2 and the linearized vector obtained in step 3.1 were recombined at a volume ratio of 1:2 (the operation steps refer to the Vazyme ClonExpress II One Step Cloning Kit instructions), and a connection product was obtained.
[0048] Step 3.3, 5 μL of the connection product obtained in step 3.2 was added to 50 μL of thawed E. coli DH5α competent cells, which were placed on ice for 30 min, then heat shocked at 42°C for 45 s, quickly placed on ice for 3 min, and then 600 ul of LB liquid medium (the LB liquid medium was prepared at a ratio of 1 g of tryptone, 0.5 g of yeast extract, 1 g of NaCl, and 100 ml of distilled water in 100 ml of LB) was added, and then cultured in a shaking incubator at 37°C and 220 rpm for 1 h. After centrifugation at 5000 rpm for 3 min, most of the supernatant was discarded, and the remaining 70 μL was gently blown with a pipette and evenly coated on an LB plate containing 100 mg·L -1 kan (the LB solid medium was prepared at a ratio of 1 g of tryptone, 0.5 g of yeast extract, 1 g of NaCl, 1.5 g of agar, and 100 ml of distilled water in 100 ml of LB), and after waiting for air drying, it was placed in a 37°C incubator for overnight culture. The next day, 8 single colonies were picked into 1.5 mL EP tubes, 600 μL of liquid LB containing Kan resistance was added, and the culture was incubated in a shaking incubator at 37°C and 220 rpm for 6 h to obtain the target bacterial solution.
[0049] Step 4. Sequencing and bioinformatics analysis
[0050] The target bacteria solution obtained in step 3 was subjected to bacteria solution PCR identification, and the BrNAC043 gene was amplified using the upstream primer F2 and the downstream primer 1305R (the nucleotide sequence of the downstream primer 1305R is shown in SEQ ID NO. 7) according to the system in Table 4, and the amplification program was as follows: 95°C for 3 min, 95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s, return to the second step, repeat 34 cycles (i.e. (95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s) three steps repeated 34 times), 72°C for 10 min, 8°C for 10 min.
[0051] After agarose gel electrophoresis, imaging was performed as follows Figure 6 The bacteria solution with correct band size (the target band was near 1000 bp) was subjected to sequencing.
[0052] The sequencing result was correct, and 500 μL of the target bacteria solution obtained in step 3 was uniformly mixed with 500 μL of 50% glycerol and stored in a -80°C refrigerator.
[0053] Table 4
[0054] Reagent Volume (μL) 2x Rapid Taq Master Mix 5 Bacterial solution 1 F-Primer 0.2 R-Primer 0.2 RNase Free ddH2O 3.6 Total 10
[0055] Example 2
[0056] Functional verification of the BrNAC043 gene
[0057] 1. Analysis of the expression pattern of the Brassica rapa L. BrNAC043 gene under normal temperature and high temperature stress conditions
[0058] In this experiment, 25 different Brassica rapa varieties (specifically, QS023, QS026, QS027, QS028, QS029, QS032, QS033, QS035, QS037, QS038, QS042, QS045, QS046, QS048, QS050, QS051, QS053, QS054, QS055, QS089, QS093, QS094, QS096, QS097, QS098) were selected and planted at the same time. After the seeds germinated, they were placed in an artificial climate chamber for uniform cultivation. The artificial climate chamber cultivation conditions were as follows: the temperature was set to 20 / 15°C (day / night), the time was set to 16 / 8h (day / night), the daytime light intensity was set to 300 μmol·m -2 s -1 , and the night light intensity was set to 0 μmol·m -2 s -1 , and the humidity was constant at 70%.
[0059] When the non-heading Chinese cabbage grows to 5-6 true leaves, 24 seedlings with uniform size and growth vigor are selected for each variety, of which 12 are subjected to high temperature stress treatment and 12 are subjected to normal temperature control treatment, and the treatment time is 1 day.
[0060] wherein:
[0061] The high temperature group is set to have the following conditions in the artificial climate chamber: temperature of 42℃ / 37℃ (day / night), time of 16 / 8h (day / night), light intensity of 300 μmol·m -2 s -1 during the day and 0 μmol·m -2 s -1 during the night, and constant humidity of 70%;
[0062] The normal temperature control group is set to have the following conditions in the artificial climate chamber: temperature of 20 / 15℃ (day / night), time of 16 / 8h (day / night), light intensity of 300 μmol·m -2 s -1 during the day and 0 μmol·m -2 s -1 during the night, and constant humidity of 70%.
[0063] After the seedlings are treated for 1 day under the corresponding conditions, 0.1g of each is sampled and placed in a 1.5mL EP tube, and then quickly frozen and stored in liquid nitrogen for subsequent experiments; wherein the sampling position is the third leaf counted from the inside to the outside.
[0064] The 1.5mL EP tube containing the sample is placed on a grinder and ground for 60s to form a powder, and then the RNA and cDNA of the sample are obtained according to the method shown in Example 1, and then the BrNAC043 gene expression amount is determined, and the determination of the BrNAC043 gene expression amount is specifically as follows:
[0065] According to the nucleotide sequence of the BrNAC043 gene shown in SEQ ID NO. 1, a fluorescent primer pair for detecting the expression of the BrNAC043 gene is designed by using Oligo 7.0 software (wherein the nucleotide sequence of the upstream primer F3 is shown in SEQ ID NO. 8, the nucleotide sequence of the downstream primer R3 is shown in SEQ ID NO. 9, and the primer is synthesized by a general biological company), the EP tube is placed on ice and the sample is added according to Table 5, and the cDNA is amplified by referring to YEASEN SYBR Green Master Mix reagent instruction for real-time quantitative PCR operation, gene expression was detected in CFX 96 PCR instrument (with reference to Brassica rapa Actin, nucleotide sequence as SEQ ID NO. 12); wherein, the BrNAC043 gene expression of each sample was biologically repeated three times, and the primer pair for amplifying the housekeeping gene Actin was upstream primer Actin-F (SEQ ID NO. 10): AGGCTACACGTTCGGACAAG, downstream primer Actin-R (SEQ ID NO. 11): TGGGGCACTAAACACAGTCA.
[0066] Table 5
[0067] Reagent Volume (μL) qPCR SYBR Green Master Mix 10 cDNA 1 F-Primer 1 R-Primer 1 RNase Free ddH2O 7 Total 20
[0068] The test results are shown in Figure 1 and Figure 2 The expression amount of BrNAC043 gene under normal temperature (the condition shown in the normal temperature control group) and high temperature (the condition shown in the high temperature group) has significant difference in different Brassica rapa materials.
[0069] 2. Determination of high temperature resistance related indexes of Brassica rapa under normal temperature and high temperature stress conditions
[0070] The high temperature resistance related indexes of 25 Brassica rapa samples in the normal temperature control group and 25 Brassica rapa samples in the high temperature group were determined, including the determination of semi-lethal temperature, heat damage index, relative water content, malondialdehyde content, Fv / Fm and Fv / Fo.
[0071] (1) Determination of semi-lethal temperature
[0072] The semi-lethal temperature of Brassica rapa was determined by measuring the electrolyte permeability of leaves under different treatment temperatures using the conductivity method, and the Logistic regression equation was used for fitting. Eight leaves (0.1 g each) were taken from each group of Brassica rapa, and the eight leaves were placed in eight 10 ml double distilled water and subjected to 30 min water bath. The water bath temperatures of the eight double distilled water were room temperature 25℃ (CK), 30℃, 35℃, 40℃, 45℃, 50℃, 55℃ and 60℃, respectively. Then the current electrolyte permeability K1 of each leaf was measured by conductivity meter. Then the eight double distilled water were placed in 100℃ water for 15 min, and after cooling to room temperature, the current electrolyte permeability K2 of each leaf was measured again. The treatment temperature and the electrolyte permeability of the leaves were fitted by the Logistic equation, and the temperature at the inflection point of the fitted equation curve was the semi-lethal temperature of high temperature.
[0073] (2) Determination of heat damage index
[0074] According to the heat damage symptom grading standard, the leaf damage of each group of plants was counted and the heat damage index of the group was calculated.
[0075] The heat damage symptom grading standard is as follows:
[0076] 0 level - no heat damage symptoms, normal plant growth;
[0077] 1 level - the number of damaged leaves < 1 / 3 of the total number of leaves;
[0078] 3 level - 1 / 3 of the total number of leaves ≤ the number of damaged leaves < 1 / 2 of the total number of leaves;
[0079] 5 level - 1 / 2 of the total number of leaves ≤ the number of damaged leaves < 2 / 3 of the total number of leaves;
[0080] 7 level - the number of damaged leaves ≥ 2 / 3 of the total number of leaves, but not dead;
[0081] 9 level - the plant loses economic value or dies.
[0082] Heat damage index = [∑(X × Xi) / (A × N)] × 100%
[0083] X represents the heat damage level, Xi represents the number of plants at X heat damage level, A represents the highest level, and N represents the total number of plants surveyed.
[0084] (3) Measurement of relative water content
[0085] The relative water content of leaves was measured by weighing method. Fresh plant leaves at the same position (sample position: the third leaf counted from the inside to the outside) in each group were collected, wiped clean and weighed, then soaked in deionized water for 24 h to fully saturate, and then the surface water was absorbed with absorbent paper, and the saturated fresh weight was measured. Then it was placed in a 105℃ oven for 30 min, then placed in an 80℃ oven for 48 h until the weight was constant, and the dry weight was weighed, with 3 replicates per group. The calculation formula is as follows:
[0086] Leaf relative water content (%) = (fresh weight - dry weight) / (saturated fresh weight - dry weight) × 100%
[0087] (4) Measurement of MDA (malondialdehyde) content
[0088] MDA content was determined by thiobarbituric acid (TBA) method. 0.1 g of leaf of Brassica rapa L. was accurately weighed and put into a mortar, 1.5 mL of 10% TCA (trichloroacetic acid) was added to grind into homogenate, and then the homogenate was centrifuged at 6000 r / min for 10 min. In a test tube, 1 mL of supernatant was added, 2 mL of TBA was added, mixed uniformly, and heated in 100 ℃ boiling water for 30 min. The absorbance value was determined at wavelength of 600 nm, 532 nm and 450 nm by 1 cm cuvette, and each group was repeated 3 times. The calculation formula of MDA content was:
[0089] MDA (mmol·g -1 FW) = [6.452 × (D532-D600) - 0.559 × D450] × Vt / (Vs × W)
[0090] In the formula, Vt is the total volume of the extract (mL), Vt is 3 mL (1 mL of supernatant + 2 mL of TBA) in this embodiment; Vs is the volume of the extract used (mL), Vs is 1 mL in this embodiment; W is the sample mass (g), and D532, D600 and D450 are the absorbance values of the sample at wavelengths of 532 nm, 600 nm and 450 nm, respectively.
[0091] (5) Determination of chlorophyll fluorescence parameters
[0092] The chlorophyll fluorescence-related parameters were determined by a plant efficiency analyzer (Pocket PEA, Hansatech, UK). Before measurement, the test leaves were clamped with a matching dark adaptation clamp, the leaves were selected from the same node of different plants (the third leaf from the inside to the outside was selected as the sampling position), avoiding the main leaf veins, the leaves were clamped and the measurement window was closed, each group was repeated three times, and dark treatment was performed for 20 min. After dark treatment, the plant efficiency analyzer was used for determination and analysis. The instrument can complete the determination of more than 50 chlorophyll fluorescence parameters including Fo, Fm, Fv, Tm and PIABS, and continuously records 100,000 fluorescence trace measurement values per second. The OJIP fluorescence induction kinetic curve of chlorophyll is completely determined within 1 s. The measured results are shown in Table 6 (25 parts of Brassica rapa L. high temperature resistance index):
[0093] Table 6
[0094]
[0095]
[0096] The heat injury index, MDA content, leaf relative water content, Fv / Fm and Fv / Fo of Brassica rapa L. after high temperature treatment were analyzed by using fuzzy membership function, which was used for comprehensive evaluation of the strength of high temperature resistance of Brassica rapa L. The membership function formula is as follows:
[0097] The index is positively correlated with heat resistance, using the formula M = (Mi-Mmin) / (Mmax-Mmin);
[0098] The index is negatively correlated with heat resistance, using the formula M = 1-(Mi-Mmin) / (Mmax-Mmin);
[0099] In the formula, Mi represents the index measured value, Mmin represents the minimum value in the index measured value, and Mmax represents the maximum value in the index measured value.
[0100] The membership function value of each index is calculated respectively, and the materials are ranked according to the average membership function value, and the higher the average membership function value, the stronger the heat resistance of the material, as shown in Table 7 (evaluation of heat resistance of 25 materials of Brassica campestris L. ssp. chinensis Makino):
[0101] Table 7
[0102]
[0103]
[0104] From the data in Table 7 and Figure 1 , 2 It can be seen that under normal temperature and high temperature conditions, the high and low of the average membership function value is basically the same as the expression trend of BrNAC043 gene in each Brassica campestris L. ssp. chinensis Makino material; among them, the higher the expression of BrNAC043 gene, the higher the corresponding membership function value, and the stronger the heat resistance of the corresponding variety of Brassica campestris L. ssp. chinensis Makino, which shows that plants with high expression of BrNAC043 gene can better cope with the damage caused by high temperature stress.
[0105] Example 3
[0106] The correct sequencing of the above-mentioned connecting product obtained in Example 1 was transformed into Agrobacterium GV3101 (purchased from Shanghai Weidi Biotechnology Co., Ltd.), and the specific operation was as follows: 100 μl of GV3101 Agrobacterium competent cells was added with 1 μg of recombinant vector plasmid DNA (the connecting product obtained in Example 1), and the bottom of the tube was beaten with hands to mix evenly, and then it was sequentially placed on ice for 5 min, liquid nitrogen for 5 min, 37°C water bath for 5 min, and ice bath for 5 min. 700 μl of LB liquid medium without antibiotics was added, and it was cultured at 28°C for 2 h with shaking; it was centrifuged at 6000 rpm for 1 min to collect the bacteria, and about 70 μl of supernatant was retained, and the bacterial body was resuspended by gently blowing, and then it was evenly coated on the LB solid culture medium containing Kan and Rif, and then it was placed in a 28°C incubator for 2 days, and the required bacterial liquid was obtained, and several positive clones were picked up in 700 μl of liquid LB containing Kan and Rif antibiotics, and after being cultured at 28°C for 2 days, the bacterial liquid PCR verification result was used (the PCR program was the same as that in Example 1).
[0107] 1 mL of the required bacterial liquid obtained above was added into 100 mL of LB liquid medium, 100 μL of Kan (kanamycin) and 200 μL of Rif (rifampicin) were added, and then it was placed in a 28°C, 220 rpm shaking incubator for 12 h, and then the OD value of the bacterial liquid was measured, when the OD value reached 0.8-1.0, it was centrifuged at 6000 rpm for 5 min, the precipitated bacterial body was discarded, and an appropriate amount of buffer (the buffer was prepared from 5% sucrose and 50 μL of Silwet-77) was added to the precipitated bacterial body, and then the bacterial body was resuspended by blowing with a pipette, and then the resuspended bacterial liquid was stored in the dark for 4 hours, and then it was poured into a glass culture dish, and then the Arabidopsis inflorescences were immersed in the culture dish, and then they were gently shaken for 1 min, and then the plants were stored in the dark for 24 h after the transformation was completed, and then they were placed in a natural growth room for normal culture, and then the transformation was repeated once a week.
[0108] The seeds of the T0 generation after the Arabidopsis infection were harvested, the T0 generation seeds were sterilized with 75% alcohol for 30 s, and then they were washed with 3% NaClO3 for 6 min, and then they were evenly spread on 1 / 2MS medium containing 30 mg / L hygromycin, and then they were cultured at 22°C under light for 7 to 10 days, and then the T1 generation positive plants were obtained by screening.
[0109] The T1 generation positive seedlings were transplanted into nutrient soil, and then they were covered with plastic wrap for 2 to 3 days, and then the plastic wrap was removed, and then they were normally grown. The leaves of the screened T1 generation positive plants were used to extract DNA, and then the PCR method was used to identify that they contained the BrNAC043 gene, and finally it was confirmed that the gene had been transferred into the T1 generation positive plants. After the screening of each generation (the screening methods of T2 and T3 generation plants were the same as those of T1 generation), three T3 generation transgenic lines (OE#2, OE#7 and OE#8) with relatively high relative expression of BrNAC043 gene were finally obtained.
[0110] Figure 3 Real-time quantitative PCR results showed that the relative expression levels of the BrNAC043 gene in OE#2, OE#7, and OE#8 were all higher than those in the wild type (WT). These results indicate that the genetic transformation of transgenic Arabidopsis thaliana was successful, and the three transgenic lines obtained can be used for subsequent experiments.
[0111] Wild-type WT Arabidopsis thaliana and T3 generation seeds (OE#2, OE#7, and OE#8) were simultaneously spotted on 1 / 2 MS medium. After 7 to 10 days, the seedlings were transplanted into potting soil and covered with plastic wrap for 2 to 3 days before being removed. When the Arabidopsis reached 6 weeks of age, they were subjected to 3 days of high-temperature stress treatment. The artificial climate chamber conditions for the high-temperature group were set as follows: temperature 42℃ / 37℃ (day / night), duration 16 / 8h (day / night), and daytime light intensity 300 μmol·m⁻¹. -2 s -1 The light intensity at night is 0 μmol·m -2 s -1 The humidity was kept constant at 70%; the artificial climate chamber conditions for the normal temperature control group were set as follows: temperature 20 / 15℃ (day / night), time 16 / 8h (day / night), and daytime light intensity 300 μmol·m⁻². -2 s -1 The light intensity at night is 0 μmol·m -2 s -1 The humidity is kept constant at 70%.
[0112] After high-temperature treatment of wild-type and transgenic plants, such as Figure 4 As shown, the wild-type lines exhibited obvious leaf curling and wilting, while the transgenic lines showed no obvious or only slight dehydration. Subsequently, both wild-type and transgenic lines were rehydrated for 3 days. The survival rate of the transgenic lines was significantly higher than that of the wild-type lines, indicating that the BrNAC043 gene is positively correlated with the heat tolerance of non-heading Chinese cabbage.
[0113] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.
[0114] The above examples are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that the technical solutions recorded in the foregoing examples can be modified, or some technical features can be replaced by equivalent features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Claims
1. The application of BrNAC043 gene in breeding of high temperature tolerant non-heading Chinese cabbage, characterized in that, The nucleotide sequence of the BrNAC043 gene is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2, and the application comprises overexpressing the BrNAC043 gene to improve the high-temperature tolerance of Brassica chinensis.
2. The use of the BrNAC043 gene in identifying high temperature tolerance in Brassica campestris L. var. pekinensis according to claim 1, characterized in that, The application comprises judging the high-temperature tolerance of each Brassica chinensis variety according to the expression level of the BrNAC043 gene, and the high-temperature tolerance of the Brassica chinensis variety with a high expression level of the BrNAC043 gene is better than that of the Brassica chinensis variety with a low expression level of the BrNAC043 gene.
3. A method for identifying high temperature tolerance of Brassica campestris L. ssp. pekinensis using the BrNAC043 gene of claim 1, characterized in that, It comprises: The expression level of the BrNAC043 gene in each Brassica chinensis plant obtained under the same culture condition is determined by the fluorescent quantitative PCR method, and the high-temperature tolerance of each Brassica chinensis variety is judged according to the expression level of the BrNAC043 gene, and the high-temperature tolerance of the Brassica chinensis variety with a high expression level of the BrNAC043 gene is better than that of the Brassica chinensis variety with a low expression level of the BrNAC043 gene.
4. The method of claim 3, wherein, The primer pair used in the fluorescent quantitative PCR method comprises F3 and R3; the nucleotide sequence of F3 is shown as SEQ ID NO. 8, and the nucleotide sequence of R3 is shown as SEQ ID NO. 9.