Indicating gene hpbhlh48 of pitaya vig system and application

Abstract

This invention discloses an indicator gene for the dragon fruit VIGS system. HpbHLH48 This invention relates to the field of molecular biology. The TRV2-HpbHLH48 recombinant vector was constructed and applied to the VIGS experiment on dragon fruit. Results showed that after injection of the empty TRV1-TRV2 vector, the dragon fruit peel in the injection area only developed scabs and normally changed color to red; however, after injection of the TRV2-HpbHLH48 recombinant vector, the dragon fruit peel in the injection area remained green and did not change color. Simultaneously, the dragon fruit peel area injected with the TRV2-HpbHLH48 recombinant vector showed... HpbHLH48 The gene expression level was significantly lower than that of the empty TRV1-TRV2 vector. This indicates that... HpbHLH48 This invention can serve as an indicator gene for the VIGS system in dragon fruit. It provides a technological foundation for future functional verification of genes involved in dragon fruit development.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to an indicator gene for a dragon fruit VIGS system. HpbHLH48 and its applications. Background Technology

[0002] Virus-induced gene silencing (VIGS) is a method for studying plant gene function, offering advantages such as short cycle time, ease of operation, and low cost. However, the viral infection in VIGS is localized and time-sensitive. Therefore, it is essential to use an indicator gene to mark the silencing region and the timing of silencing. The phytoene desaturase gene is an example of this method. PDS ) is a commonly used indicator gene, a key gene in the carotenoid synthesis pathway, which protects chlorophyll from photobleaching. When PDS When genes are silenced, their mRNA levels decrease significantly, leading to the blockage of carotenoid synthesis pathways. This results in the whitening effect on the new leaves of infected plants, which can be observed directly with the naked eye. Therefore... PDS The gene was applied to the VIGS system in various plants, including cotton, rice, miscanthus, and loofah. However, as the dragon fruit develops, betalains gradually accumulate in the peel and pulp as the fruit enlarges, and the resulting reddish-purple color can mask the fruit's natural color. PDS The whitening phenomenon caused by silence makes PDS The gene cannot serve as an indicator gene for the VIGS system during the fruit development stage of dragon fruit. Therefore, it is necessary to develop a new indicator gene for the dragon fruit VIGS system. Summary of the Invention

[0003] To address the aforementioned shortcomings of existing technologies, the purpose of this invention is to provide an indicator gene for the dragon fruit VIGS system. HpbHLH48 And its application, to provide a new indicator gene for the dragon fruit VIGS system.

[0004] The technical solution of this invention to solve the above-mentioned technical problems is as follows: An indicator gene for the dragon fruit VIGS system is provided. HpbHLH48 Indicator genes HpbHLH48 The coding region nucleotide sequence is shown in SEQ ID NO.1.

[0005] This invention provides the above-mentioned indicator gene. HpbHLH48 Application in the preparation of TRV2-HpbHLH48 recombinant vector.

[0006] This invention provides a TRV2-HpbHLH48 recombinant vector, comprising a TRV2 vector and the aforementioned indicator gene.HpbHLH48 .

[0007] This invention provides a method for preparing the above-mentioned TRV2-HpbHLH48 recombinant vector, comprising the following steps:

[0008] (1) Amplification HpbHLH48 The 3' non-conserved fragment of the CDS gene: using HpbHLH48-F and HpbHLH48-R as primers, respectively, to... HpbHLH48 The coding region nucleotide sequence was used as a template for PCR amplification, and the PCR product was recovered and purified.

[0009] (2) Select BamH I and Sac Primers were designed with restriction enzyme sites, and PCR amplification was performed using the product obtained in step (1) as a template. The PCR product was recovered and purified to obtain a product containing... BamH I and Sac The target fragment at these two restriction enzyme sites;

[0010] (3) Adopt BamH I and Sac I digested the TRV2 vector with enzyme I, recovered the digestion product, and obtained the TRV2 digested fragment; then the TRV2 digested fragment was ligated with the target fragment obtained in step (2) and transformed into Escherichia coli to obtain the desired fragment.

[0011] Furthermore, in step (1) HpbHLH48 The nucleotide sequence of the non-conserved 3' end fragment of the gene CDS is shown in SEQ ID NO.2.

[0012] Furthermore, the nucleotide sequences of HpbHLH48-F and HpbHLH48-R in step (1) are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0013] Furthermore, the primers in step (2) are BamH IF and Sac IR, and their nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0014] Furthermore, the enzyme digestion system in step (3) is: 10 μL TRV2, 1 μL BamHI, 1 μL SacI, 1 μL 5×Kbuffer, and 7 μL double-distilled water; the ligation system is: 3 μL target fragment, 2 μL TRV2 double-digested fragment, and 5 μL 2×Seamlesscloning Master Mix.

[0015] This invention also provides an application of the above-mentioned TRV2-HpbHLH48 recombinant vector in dragon fruit VIGS injection. If the dragon fruit peel remains green after injection of the TRV2-HpbHLH48 recombinant vector, it indicates... HpbHLH48 The genes have been silenced.

[0016] The present invention has the following beneficial effects: The present invention discovers HpbHLH48 The gene is a gene related to betalain synthesis in dragon fruit, which can regulate the expression of the promoter of a key gene for betalain synthesis, thereby participating in betalain synthesis. Experiments in this invention show that after injecting the empty vector TRV1-TRV2 (TRV: Tobacco Rattle Virus) into the peel of dragon fruit, the injected area only showed scab formation and normal color change to red; however, after injecting the recombinant vector TRV2-HpbHLH48 (pTRV2-HpbHLH48), the dragon fruit peel in the injected area remained green and did not change color. This indicates that the gene regulating betalain synthesis... HpbHLH48 He has been silenced. HpbHLH48 The inability to express a gene prevents the synthesis of betaine in the dragon fruit peel, resulting in the peel's green color. Figure 3 It can be seen that the dragon fruit peel region injected with the TRV2-HpbHLH48 recombinant vector (pTRV2-HpbHLH48) HpbHLH48 The expression level of the indicator gene was significantly lower in the dragon fruit peel region injected with the empty TRV1-TRV2 vector (pTRV2), indicating that the indicator gene... HpbHLH48 They were effectively silenced. The above results indicate that... HpbHLH48 This gene can serve as an indicator gene for the VIGS system in dragon fruit. This invention also provides technical reserves for future functional verification of genes involved in dragon fruit development. Attached Figure Description

[0017] Figure 1 A schematic diagram of the construction of the TRV2-HpbHLH48 recombinant vector;

[0018] Figure 2 Indicator genes HpbHLH48 Silent phenotype diagram;

[0019] Figure 3 The injection area of ​​dragon fruit peel after injection of TRV2-HpbHLH48 recombinant vector. HpbHLH48 Gene expression levels. Detailed Implementation

[0020] The examples given below are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, conditions in the examples are performed under standard conditions or as recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0021] Example 1: Construction of TRV2-HpbHLH48 recombinant vector

[0022] (1) The HpbHLH48 gene was obtained from the dragon fruit RNA-seq database. Then, the CDS sequence (SEQ ID NO.1) of the HpbHLH48 gene was analyzed using the NCBI online website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi). The non-conserved 3' end sequence (SEQ ID NO.2) of the HpbHLH48 gene was selected for primer design. PCR amplification was performed using cDNA from the fruit of the "Zihonglong" dragon fruit as a template. The target fragment was recovered. The specific method is as follows: PCR amplification was performed using HpbHLH48-F and HpbHLH48-R primers, respectively, with cDNA from the fruit of the "Zihonglong" dragon fruit as a template (RNA extraction was performed according to the EZNA® Plant RNA Kit (Omega...). The PCR product was processed according to the instructions of the Bio-tek (USA) kit, and the first strand of cDNA was synthesized according to the reverse transcription kit (TaKaRa, Japan). The PCR product was subjected to agarose gel electrophoresis, and the HpbHLH48 DNA fragment was purified using the gel recovery kit (TaKaRa, Japan) according to the kit method. The concentration and purity were detected using a full-wavelength scanning microplate reader (MULTISKANA GO, THErmo) before ligation or storage at -20℃ for later use.

[0023] The PCR reaction conditions were: 98℃ for 5 min, 98℃ for 10 s, 60℃ for 10 s, 72℃ for 10 s, 72℃ for 5 min, and 35 cycles for steps 2-4.

[0024] The reaction system consisted of 10 μL: 1 μL cDNA template, 1 μL each of upstream and downstream primers (100 μM), 5 μL high-fidelity Premix (TaKaRa, Japan) and 2 μL double-distilled water;

[0025] The nucleotide sequences of HpbHLH48-F and HpbHLH48-R are shown below:

[0026] HpbHLH48-F: 5'-AGCTGCAGCTGAAAGCA-3' (SEQ ID NO.3);

[0027] HpbHLH48-R: 5'-TGGGAGGTATCGAGCAC-3' (SEQ ID NO. 4).

[0028] (2) Select BamH I and Sac I (TaKaRa, Japan) designed primers BamHI-F and SacI-R for restriction enzyme sites, and performed PCR amplification using the product obtained in step (1) as a template (reaction system and reaction procedure are the same as in step (1)), to obtain a product containing... BamH I and Sac The target fragment at these two restriction enzyme sites. Use BamH I and Sac The TRV2 vector was double-digested, and the TRV2 digested fragments were recovered by gel electrophoresis. The target fragment was then ligated with the TRV2 digested fragment and transformed into *E. coli* DH5α competent cells (Beijing TransGen Biotech Co., Ltd.). The cells were cultured overnight at 37°C. After positive clone identification, the cells were sent to Shanghai Biotech Co., Ltd. for sequencing. After successful sequencing, the plasmid was extracted to obtain the TRV2-HpbHLH48 recombinant vector. A schematic diagram of the vector construction is shown below. Figure 1 .

[0029] The nucleotide sequences of primers BamHI-F and SacI-R are shown below:

[0030] BamHI-F: 5'-AGAAGGCCTCCATGGGGATCCAGCTGCAGCTGAAAGCA-3' (SEQ ID NO.5, contains BamH I (restriction site);

[0031] SacI-R: 5'-GGCCTCGAGACGCGTGAGCTCTGGGAGGTATCGAGCAC-3' (SEQ ID NO. 6, containing Sac I (restriction site);

[0032] The double enzyme digestion system (20 μL) consists of: 10 μL TRV2 plasmid, 1 μL... BamH I, 1μL Sac I. 1 μL 5×K buffer, 7 μL double-distilled water; enzyme digestion conditions: 37℃, 4 h;

[0033] The ligation system (10 μL) consisted of: 3 μL target fragment, 2 μL TRV2 double digestion fragment, and 5 μL 2×Seamlesscloning Master Mix (Shanghai Sangon Biotech). The ligation conditions were: 50℃ for 30 min.

[0034] Example 2: Dragon fruit VIGS injection

[0035] (1) Transformation of Agrobacterium with vector plasmids: Take 5 μL of TRV1, TRV2 and TRV2-HpbHLH48 plasmids respectively and add 100 μL of GV3101 Agrobacterium competent cells. Place on ice for 30 min and then freeze in liquid nitrogen for 5 min. Then heat shock at 37℃ for 5 min and place on ice for 2 min. Finally, add 800 μL of LB liquid medium without antibiotics and shake in a shaker at 28℃ for 3 h. Then take 150 μL of bacterial solution and spread it evenly on LB solid medium (containing 20 mg / L Rif and 50 mg / L Kana). After culturing at 28℃ for 2 days, pick single colonies for PCR identification and then inject the bacteria into the peel of "purple dragon" dragon fruit during the color change period.

[0036] (2) Dragon fruit preparation: Dragon fruit is grown in Luodian County, Qiannan Buyi and Miao Autonomous Prefecture, Guizhou Province, China. It is used for Agrobacterium injection when the dragon fruit is in the color-changing period.

[0037] (3) Dragon fruit VIGS injection: Select successfully transformed single clones and culture them overnight in 50 mL LB liquid medium (containing 20 mg / L Lfif and 50 mg / L Kana). Collect the cells by centrifugation, resuspend the cells in resuspension solution (500 mM MES, 1 M MgCl2 and 100 mM As), wash 3 times, and then OD of the bacterial solution. 600 The value was adjusted to 1.0, and the bacterial solution was incubated in a 28℃ incubator for 3 hours. It was then injected into the peel of dragon fruit during the color-changing stage at volume ratios of TRV1:TRV2=1:1 and TRV1:TRV2-HpbHLH48=1:1, respectively, until the bacterial solution was observed to have penetrated the peel. Phenotypic changes and gene expression levels were observed one week after injection. The nucleotide sequences of the primers for quantitative PCR detection were as follows:

[0038] HpbHLH48-qF: 5'-TGTATAAGGGTCAAGGAAACAAG-3' (SEQ ID NO. 7);

[0039] HpbHLH48-qR: 5'-TCCACTGCCACATCGGGAAC-3' (SEQ ID NO. 8).

[0040] Depend on Figure 2It was found that after injecting the empty TRV1-TRV2 vector (pTRV2) into the dragon fruit peel, only scab formation occurred in the injected area; the dragon fruit peel did not exhibit other phenotypes and continued to change color normally to red. However, after injecting the TRV2-HpbHLH48 recombinant vector (pTRV2-HpbHLH48), the dragon fruit peel in the injected area remained green. This indicates that the betaine pigment synthesis regulating gene HpbHLH48 has been silenced. The inability to express the HpbHLH48 gene prevents the synthesis of betaine pigment in the dragon fruit peel, thus preventing color change and maintaining its green color. Figure 3 The results showed that the expression level of the HpbHLH48 gene in the peel region of dragon fruit injected with the TRV2-HpbHLH48 recombinant vector (pTRV2-HpbHLH48) was significantly lower than that in the peel region injected with the TRV1-TRV2 empty vector (pTRV2), indicating that the indicator gene HpbHLH48 was effectively silenced. These results suggest that HpbHLH48 can serve as an indicator gene for the dragon fruit VIGS system.

[0041] The coding nucleotide sequence of the indicator gene HpbHLH48 in this invention is shown below:

[0042] ATGGACCCATTTCAGGTTGATGAGTACATCTGCTGGAATGGACTTGGTGATTATTACACTTCCTTCATGGATTTTGATGCCTCTGATTTATGCTGGACCTCCCCCACCCCCAGGGCAAGTGGAACACCTGGTATGTCTCTGACAAGCAATGTTTTCACAGAAAAAGGGATGAAAAGAGGGAGGGAGCAGAAGAGGAGTCCTCAATCAGAGTCCAAGGCTTGTAGAGAGAAGCTGCGAAGAGAGAAGATGAATGATAAGTTCTCGGAGTTGTGCCTGTTTCTGCATCCTGAAAGACCTGCTAAAGCTGATAAATCTACCGTCCTTGGTGACGCGATTTGTGCCTTAAACAACTTGCAGTCTGAGCTTCAAGAGCTAAAAGAGAAGAAGAGGAAGCTTCAAGATGACATTCAAAATCTAAAATCAGAGAAGAATAAGCTGAAGGAAGAGAAGCTGCAGCTGAAAGCAAGAAAAGAAAACATGGAAGCAGGGTTTGTGCCGGTACAACCAGCAGTGTATAAGGGTCAAGGAAACAAGTTGATGGCTTTTTCAGGGTATGGAGGGTTCCCGATGTGGCAGTGGAGCTCACCTGCAGTGCTCGATACCTCCCAAGATCACGTCCTCAGGCCGCCTGTTGCCTGA (SEQ ID NO.1).

[0043] The non-conserved nucleotide sequence at the 3' end of the coding region of the indicator gene HpbHLH48 in the present invention is as follows:

[0044] AGCTGCAGCTGAAAGCAAGAAAAGAAAACATGGAAGCAGGGTTTGTGCCGGTACAACCAGCAGTGTATAAGGGTCAAGGAAACAAGTTGATGGCTTTTTCAGGGTATGGAGGGTTCCCGATGTGGCAGTGGAGCTCACCTGCAGTGCTCGATACCTCCCA (SEQ ID NO.2).

[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of HpbHLH48 as an indicator gene in dragon fruit VIGS injection, characterized by, The coding region nucleotide sequence of the indicator gene HpbHLH48 is shown in SEQ ID NO.

1.

2. The application of the TRV2-HpbHLH48 recombinant vector in the injection of VIGS in dragon fruit, characterized by: If the dragon fruit peel remains green after injection of the TRV2-HpbHLH48 recombinant vector, it indicates that the HpbHLH48 gene has been silenced. The preparation of the TRV2-HpbHLH48 recombinant vector includes the following steps: (1) Amplification of the 3' non-conserved fragment of the CDS of the HpbHLH48 gene: Using HpbHLH48-F and HpbHLH48-R as primers, PCR amplification was performed using the coding region nucleotide fragment of HpbHLH48 as a template. The PCR products were recovered and purified. The coding region nucleotide sequence of HpbHLH48 is shown in SEQ ID NO.1, and the nucleotide sequences of HpbHLH48-F and HpbHLH48-R are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. (2) Primers were designed using BamHI and SacI restriction enzyme sites. The nucleotide sequences of the primers are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. The product obtained in step (1) was used as a template for PCR amplification. The PCR product was recovered and purified to obtain the target fragment containing the two restriction enzyme sites of BamHI and SacI. (3) The TRV2 vector was digested with BamHI and SacI enzymes, the digestion products were recovered, and the TRV2 digested fragment was obtained. Then the TRV2 digested fragment was ligated with the target fragment obtained in step (2) and transformed into Escherichia coli to obtain the desired fragment.

3. The application according to claim 2, characterized in that, The nucleotide sequence of the 3' non-conserved fragment of HpbHLH48 described in step (1) is shown in SEQ ID NO.

2.

4. The application according to claim 2, characterized in that, The enzyme digestion system in step (3) is: 10 μL TRV2, 1 μL BamHI, 1 μL SacI, 1 μL 5×K buffer, and 7 μL double-distilled water; the ligation system is: 3 μL target fragment, 2 μL LTRV2 enzyme digestion fragment, and 5 μL 2×Seamless cloning Master Mix.

Images