Ganoderma lucidum transcription factor and application and method thereof in regulating and controlling transcriptional activity of ganoderic acid synthetic gene SQS

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a ganoderma lucidum transcription factor, and application and a method thereof in regulating and controlling the transcriptional activity of a ganoderic acid synthetic gene SQS. The invention provides a ganoderma lucidum transcription factor C2H2-4 with a nucleotide sequence as shown in SED ID NO.1, and yeast one-hybrid and bimolecular luciferase experiments prove that the transcription factor C2H2-4 can be combined with a ganoderma lucidum SQS gene promoter and positively regulate and control the expression of the SQS gene, so that the regulation and control of the ganoderic acid content are realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a Ganoderma lucidum transcription factor and its application and method in regulating the transcriptional activity of the ganoderic acid synthesis gene SQS. Background Art

[0002] Ganoderma lucidum is a traditional large fungus in China that can be used as both medicine and food, with effects such as replenishing qi and calming the mind, relieving cough and asthma. Ganoderma lucidum produces bioactive secondary metabolites such as polysaccharides and ganoderic acids at different growth stages. Research shows that ganoderic acids play important roles in tumor treatment, antioxidant, inhibiting cholesterol synthesis, inhibiting angiotensin-converting enzyme activity, inhibiting histamine release, anti-HIV, etc. However, currently, the main way to obtain ganoderic acids is to extract them from Ganoderma lucidum fruiting bodies and spores, and the content of ganoderic acids in Ganoderma lucidum is relatively low.

[0003] The research by Yuan Kai et al. (in 2021) "Research Progress on the Biosynthesis and Metabolic Regulation of Ganoderic Acids" expounded that the synthesis pathway of ganoderic acids mainly includes the mevalonate pathway (MVA) and the pyruvate / glyceraldehyde phosphate pathway. In the MVA pathway, there are two important branches in the synthesis of ganoderic acids. One branch is from farnesyl pyrophosphate to geranyl geranyl pyrophosphate, and the other branch is from farnesyl pyrophosphate to lanosterol. The key genes cloned and reported in these two branches are FPS, MVD, AACT, LS, HMGR, HMGS, IDI, SQS, and OSC genes. These genes directly regulate the synthesis of ganoderic acids and are the keys to the synthesis and accumulation of ganoderic acids. Among them, squalene synthase (SQS) is the first key enzyme that catalyzes the conversion of the MVA pathway to triterpenoid biosynthesis and is also a key enzyme involved in the synthesis and metabolism of ganoderic acids. The prior art CN119061026A discloses a Ganoderma lucidum transcription factor C2H2-3 and its method and application for synthesizing ganoderic acids. The Ganoderma lucidum transcription factor C2H2-3 can regulate the key enzyme involved in the synthesis and metabolism of ganoderic acids by binding to the promoter of the Ganoderma lucidum SQS gene and positively regulating the expression of the SQS gene, thereby realizing the regulation of the content of ganoderic acids in Ganoderma lucidum.

[0004] Therefore, exploring new Ganoderma lucidum transcription factors is of great significance for analyzing the biosynthesis pathway of ganoderic acids and its regulatory mechanism, and also provides new ideas for cultivating Ganoderma lucidum varieties with high yields of ganoderic acids. Summary of the Invention

[0005] Based on the above background, this patent discloses a new Ganoderma lucidum transcription factor C2H2-4, and through studying the interaction mechanism between the Ganoderma lucidum SQS gene and the transcription factor C2H2-4, provides a certain basis for the regulatory mechanism of ganoderic acids.

[0006] To achieve the above-mentioned invention objectives, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides a Ganoderma lucidum transcription factor gene, which is the Ganoderma lucidum transcription factor C2H2-4 gene, and the nucleotide sequence of the Ganoderma lucidum transcription factor C2H2-4 gene is as shown in SED ID NO.1.

[0008] SED ID NO.1:

[0009]

[0010] The amino acid sequence encoded by the C2H2-4 gene is shown in SED ID NO.2.

[0011] SED ID NO.2:

[0012] MSNFSDSTALVGSTGVQGLFSLVEAASISRPMAATRESSVDSGFAPGSFKGAGSLGINGNSVGSSSKVHTAMKHRRLSSTGQARRRLSDAREATSRPSPVMLQSAAAALSSLATLSLSGSPPQGVPQTGTSFASASGQLASPPTSRMLKLEAKDDDIVLDDAPVAAPVKTEINGAGISVTKTGKKRGTIFKCESCSKVYRHPSCLIKHRWEHSPHWREASKFLLSKHQQVQLLEAAAILSHLAPSASGGTSLPEDRSLWPSFLSGGLLPPPDQANMIHDTKYSSKARASSVSTSLDQSITYPTSSSVPAPSLLSVRSSSSSGIGSGSGTATSTGRSPSAGPRMHDYAIPSSGGGLTHVRPGVVGVSTNGQSPQHPQSAHAHLEAHALPGASSPHTYPPSGHRSAPVPVPAAARDAYREPRNGDTGAYSFVSGASISDAWSSPVSVGFAQSSFRSSMESPSASASFSASYSQPASAPGVGRSFSDSAGGWSLPRSSLCEGSRSPSGSVEMDGREEFVDVDGASGSEDGDGAIAGRFGFTSRRWNGPAKIEEEEWDGMEMEMEM.

[0013] In a second aspect, the present invention provides an expression vector, which comprises the aforementioned Ganoderma transcription factor C2H2-4 gene.

[0014] Specifically, the expression vector is a plant expression vector or a fungal expression vector.

[0015] Preferably, the expression vector is pGADT7-AD or pGreen II 62-SK.

[0016] In some embodiments, when the expression vector is pGADT7-AD, the recombinant vector is pGADT7-C2H2-4, and the amplification primer sequences of C2H2-4 are shown in SED ID NO.3 and SED ID NO.4, and the insertion sites on the vector are EcoRI and BamHI.

[0017] SED ID NO.3: GCCATGGAGGCCATGAGCGACGTTTCGGAC;

[0018] SED ID NO.4: CAGCTCGAGCTCGTCACATTTCCATCTCCATCTC.

[0019] In some embodiments, when the expression vector is pGreen II 62-SK, the recombinant vector is pGreen II62-SK-C2H2-4, and the amplification primer sequences of C2H2-4 are as shown in SED ID NO.5 and SED ID NO.6, and the insertion sites on the vector are HindIII and XmaI.

[0020] SED ID NO.5: CGCTCTAGAACTAGTGGATCCATGAGCGACGTTTCGGA;

[0021] SED ID NO.6: TTCAGCGTACCGAATTGGTACCTCACATTTCCATCTCCAT CTC.

[0022] In a third aspect, the present invention provides a genetically engineered cell expressing the aforementioned Ganoderma lucidum transcription factor gene or comprising the aforementioned expression vector.

[0023] The source of the aforementioned genetically engineered cell can be any source. Preferably, the aforementioned genetically engineered cell can be a yeast cell, an Escherichia coli cell, a cell derived from Ganoderma lucidum, etc.

[0024] In a fourth aspect, the present invention provides the application of the aforementioned Ganoderma lucidum transcription factor gene, the aforementioned expression vector, or the genetically engineered cell comprising the aforementioned expression vector in regulating the synthesis of ganoderic acid.

[0025] Specifically, the aforementioned application is achieved by regulating the enzyme for the synthesis of ganoderic acid with the Ganoderma lucidum transcription factor C2H2-4.

[0026] More specifically, the enzyme is squalene synthase, and the gene encoding this enzyme is SQS.

[0027] Preferably, the Ganoderma lucidum transcription factor C2H2-4 binds to the SOS promoter sequence to promote the expression of SOS and regulate the synthesis of ganoderic acid.

[0028] In a fifth aspect, the present invention provides a method for biosynthesis of ganoderic acid, comprising: expressing the aforementioned Ganoderma lucidum transcription factor C2H2-4 gene to further regulate the enzyme for the synthesis of ganoderic acid.

[0029] Preferably, the method for biosynthesis of ganoderic acid includes:

[0030] (1) Construct the expression vector of Ganoderma lucidum transcription factor C2H2-4;

[0031] (2) Transfer the expression vector of Ganoderma lucidum transcription factor C2H2-4 into cells;

[0032] (3) Carry out conditional culture on the cells;

[0033] (4) Purify the product.

[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0035] The Ganoderma lucidum transcription factor C2H2-4 binds to the promoter of the SQS gene and positively regulates the expression of SQS; the transcription factor C2H2-4 can regulate the key enzyme genes involved in the synthesis and metabolism of ganoderic acid, thereby realizing the regulation of the content of ganoderic acid in Ganoderma lucidum. Brief Description of the Drawings

[0036] Figure 1 It is the tissue-specific expression heat map of the C2H2-4 gene;

[0037] Figure 2 It is the recombinant vector map of pGADT7-C2H2-4;

[0038] Figure 3 It is the recombinant vector map of pGreenII-62SK-C2H2-4;

[0039] Figure 4 It is the result of the yeast one-hybrid experiment of C2H2-4 and SQS;

[0040] Figure 5 In it, A is the result of the dual-luciferase reporter experiment, and B is the result of fluorescence imaging. In the figure, "***" indicates that the p value is less than 0.001, and the result is extremely significant statistically. Detailed Embodiments

[0041] The following combines specific embodiments to further elaborate on the present invention. The following embodiments are not used to limit the present invention, but only to illustrate the present invention. The experimental methods used in the following embodiments, unless otherwise specified, and the experimental methods without specific conditions specified in the embodiments usually follow conventional conditions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels.

[0042] The information of some products selected in the embodiments is as follows in the table:

[0043] Table 1 Reagent Sources

[0044] Experimental reagents Source Catalog number pAbAi vector Shanghai Zeye Biotechnology Co., Ltd. ZY8159 pGADT7-AD Shanghai Zeye Biotechnology Co., Ltd. ZY6124 Yeast competent cell Y1H Shanghai Jingkang Bioengineering Co., Ltd. JK-G8044 pGreenII-62SK Shanghai Zeye Biotechnology Co., Ltd. ZY8123 pGreenII-0800 Shanghai Zeye Biotechnology Co., Ltd. ZY612 GV3101-pSoup-P19 competent Shanghai Weidi Biotechnology Co., Ltd. AC1003M Glo lysis buffer Beijing Zhaosheng Laibo Trading Co., Ltd. 0000566337

[0045] Example 1: Screening of Transcription Factor C2H2-4

[0046] In the early stage of the experiment, based on the Ganoderma lucidum genome and transcriptome data of different tissue parts of Ganoderma lucidum, differential genes catalyzing the synthesis of ganoderic acid were initially screened through the analysis of differentially expressed genes. Combining with the biosynthetic pathway of ganoderic acid, the key gene C2H2-4 catalyzing the formation of ganoderic acid from lanosterol was further screened. The expression heat map of C2H2-4 is as shown in Figure 1 Figure [Figure number not provided in the original]. The C2H2-4 gene was most highly expressed in the mycelium, suggesting that the C2H2-4 gene is involved in the process of mycelium developing into fruiting bodies and finally forming Ganoderma lucidum.

[0047] Example 2: Yeast One-Hybrid Verification of the Interaction between C2H2-4 and SQS

[0048] (1) Using the cDNA of Ganoderma lucidum variety Xianzhi No. 2 as a template, the full-length coding region of the C2H2-4 gene (the CDS sequence of C2H2-4 is shown in SEQ ID NO.1) was cloned. The cloning primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively; the cloned fragment was ligated to the pGADT7-AD vector (insertion sites EcoRI and BamHI) to obtain the recombinant vector pGADT7-C2H2-4. The map of the recombinant vector is as shown in Figure 2 Figure [Figure number not provided in the original].

[0049] SED ID NO.3: GCCATGGAGGCCATGAGCGACGTTTCGGAC;

[0050] SED ID NO.4: CAGCTCGAGCTCGTCACATTTCCATCTCCATCTC.

[0051] (2) Using the gDNA of Ganoderma lucidum variety Xianzhi No. 2 as a template, the promoter region of 2000 bp before the start codon ATG of the SQS gene was cloned (the nucleotide sequence is shown in SEQ ID NO.7). The cloning primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.9 respectively; the cloned fragment was ligated to the pAbAi vector (insertion sites HindIII and XmaI) to obtain the recombinant vector pAbAi-SQS.

[0052] SEQ ID NO.7:

[0053]

[0054] SEQ ID NO.8: TAGGGTCTGCTCGATTTTCG;

[0055] SEQ ID NO.9: TATGACGAAAGAGTTGGTAG.

[0056] (3) Set up a control group (pGADT7-AD empty vector + pAbAi-SQS recombinant vector) and an experimental group (pGADT7-C2H2-4 recombinant vector + pAbAi-SQS recombinant vector), transfer them into yeast competent cells Y1H, spread them on SD-ura / leu defective medium, and culture them at a constant temperature of 30 °C for 3 - 4 d.

[0057] (4) Pick more than 10 positive clone bacteria, culture them in SD-ura / leu liquid medium on a shaker at 30 °C until OD 600 > 1.5, centrifuge at 1000 rpm for 2 min, discard the supernatant, and resuspend it with sterile water to OD 600 ≈ 0.2. Spot it at the original dilution, 1 / 10, 1 / 100, and 1 / 1000 on SD-ura / leu solid medium containing the cyclic lipopeptide antibiotic AbA, and culture it at a constant temperature of 30 °C for 2 - 3 d.

[0058] The results are as Figure 4 shown. On the SD- / -ura / -leu defective medium, by adding 100 ng / mL of AbA to inhibit the self-activation of the promoter, it was found that the growth ability of the co-transformation combination of C2H2-4 and SQS was significantly better than that of the control, indicating that C2H2-4 can directly bind to the SQS promoter.

[0059] Example 3 Verification of the activation effect of C2H2-4 protein on SQS by dual luciferase

[0060] (1) The CDS fragment of C2H2-4 was amplified and ligated to the pGreenII-62SK vector (insertion sites HindIII and XmaI). The amplification primer sequences are as shown in SEQ ID NO.5 and SEQ ID NO.6, and the recombinant vector map is as Figure 3 shown; the SQS promoter fragment was amplified and ligated to the pGreenII-0800 vector (insertion sites HindIII and XmaI). The amplification primer sequences are as shown in SEQ IDNO.10 and SEQ ID NO.11. Then they were respectively transformed into Agrobacterium tumefaciens competent GV3101-pSoup-P19, and the bacterial solutions with correct sequencing after shaking were stored at -80 °C. SED ID NO.5: CGCTCTAGAACTAGTGGATCCATGAGCGACGTTTCGGA;

[0061] SED ID NO.6: TTCAGCGTACCGAATTGGTACCTCACATTTCCATCTCCATCTC。

[0062] SED ID NO.10: CGATAAGCTTTAGGGTCTGCTCG;

[0063] SED ID NO.11: TCCCCCGGGTATGACG。

[0064] (2) Streak and activate the pGreenII-62SK-C2H2-4 bacterial solution and the pGreenII-0800-SQS bacterial solution on a kanamycin-resistant medium with rifampicin. Pick a single colony and culture it in a small shaker and then in a large shaker overnight until OD 600 > 2.0, and collect the bacterial cell precipitate at room temperature at 5000 rpm for 10 min.

[0065] (3) Resuspend the two bacterial cell precipitates in step (2) with 1× MMA solution and mix the two bacterial solutions until OD 600 = 0.5, and place it in the dark at room temperature for 3 h, then inject Nicotiana benthamiana (healthy Nicotiana benthamiana at 4 - 5 weeks is placed in the dark 24 h in advance). After injection, place it in the dark for 1 - 2 d, then under a light cycle of 14 / 10 h for 3 - 4 d, and select an injection area of 0.5 cm 2 and grind it with 500 μL of Glo lysis buffer.

[0066] (4) After sufficient lysis, centrifuge at 12000 rpm at 4 °C for 3 min, take 50 μL of the supernatant + 50 μL of the luciferase reaction substrate and react at room temperature for 10 min, measure the luciferase fluorescence A with a microplate reader, then add another 50 μL of the termination solution and react for 10 min and then measure its Renilla fluorescence B, and calculate the ratio of A / B.

[0067] The results of the dual-luciferase reporter assay are as Figure 5 shown, and it can be seen that C2H2-4 can promote the expression of SQS.

[0068] Combined with the existing literature "Cloning and Induced Expression of the Key Enzyme GaSQS Gene for Triterpenoid Synthesis in Ganoderma lucidum", it is recorded that overexpression of the SQS gene can increase LS expression and promote the production of lanosterol, thereby promoting the biosynthesis of ganoderic acid precursors. The present invention discloses that C2H2-4 can bind to the SQS promoter to promote its expression. This reveals that the gene expression of the Ganoderma lucidum transcription factor C2H2-4 regulates the enzyme SQS for ganoderic acid synthesis, and thus synthesizes ganoderic acid.

[0069] The above specific embodiments do not constitute a limitation to the protection scope of the present invention. Those skilled in the art should understand that various modifications, combinations, sub-combinations and substitutions can be made according to design requirements and other factors. Any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A Ganoderma lucidum transcription factor gene, characterized in that: It is the Ganoderma lucidum transcription factor C2H2-4 gene, and the nucleotide sequence of the Ganoderma lucidum transcription factor C2H2-4 gene is shown in SED ID NO.

1.

2. An expression vector, characterized in that: The expression vector comprises the Ganoderma lucidum transcription factor C2H2-4 gene according to claim 1.

3. The expression vector according to claim 2, characterized in that The expression vector is a plant expression vector or a fungal expression vector.

4. The expression vector according to claim 3, characterized in that The expression vector is pGADT7-AD or pGreenII 62-SK.

5. A genetically engineered cell expressing the Ganoderma lucidum transcription factor gene of claim 1 or comprising the expression vector of any one of claims 2 to 4.

6. Use of the Ganoderma transcription factor gene according to claim 1, the expression vector according to any one of claims 2 to 4, or the genetically engineered cell according to claim 5 in regulating the synthesis of ganoderic acid.

7. The use according to claim 6, characterized in that: The application is achieved by regulating the enzyme for synthesizing ganoderic acid through the ganoderma transcription factor C2H2-4.

8. The use according to claim 7, characterized in that: The enzyme is squalene synthase.

9. The use according to claim 8, characterized in that: The Ganoderma lucidum transcription factor C2H2-4 binds to the SOS promoter sequence and promotes SOS expression.

10. A method for biosynthesis of ganoderic acid, characterized in that: include: The ganoderma transcription factor C2H2-4 gene of claim 1 is used to express and then regulate the enzyme for ganoderic acid synthesis.

Images