Application of AhGA3ox1 gene in regulation and control of plant height and breeding

Abstract

The invention provides application of an AhGA3ox1 gene in regulation and control of plant height and breeding, and belongs to the technical field of bioengineering. The invention discloses a peanut AhGA3ox1 gene for coding gibberellin 3beta-dioxidase, the open reading frame nucleotide sequence of the gene is 1050bp, 349 amino acids are coded, and the expression in peanut needles and flowers is more and is obviously higher than that in other tissues. The AhGA3ox1 expression protein is positioned in cytoplasm and cell nucleus. A specific primer pair is designed aiming at a full-length open reading frame of the AhGA3ox1 gene, the specific primer pair is used for cloning the AhGA3ox1 gene to obtain a positive clone strain, the positive clone strain is converted into arabidopsis thaliana to obtain an AhGA3ox1 gene overexpression plant, and the plant height of the AhGA3ox1 gene overexpression plant is found to be obviously higher than that of a wild plant.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to the application of the AhGA3ox1 gene in regulating plant height and breeding. Background Art

[0002] Peanut is an important oil crop in China. Peanut belongs to the genus Arachis L. of the family Leguminosae in the order Rosales, also known as "groundnut". This genus contains a large number of diploid species (2n = 2x) and a small number of tetraploid species (2n = 4x). Cultivated peanut (Arachis hypogaea L.) is an allotetraploid, evolved from the natural doubling of hybrid chromosomes of diploid wild species, containing two sets of subgenomes, the A genome and the B genome. Among them, diploid wild species such as A. villosa, A. duranensis, A. ipaensis, and A. batizocoi are considered to be the possible original ancestors of cultivated peanut. Due to the large (2.8 GB) and complex genome of cultivated peanut, it is difficult to analyze the functions of many important genes in peanut.

[0003] Plant height is one of the important agronomic traits of higher crops. Peanut plant height not only has an important impact on yield formation, but also is significantly related to the efficiency of mechanical harvesting. Therefore, it is imperative to cultivate a high-yield peanut plant type suitable for mechanical harvesting. However, there are still few reports on the structure and function of the GA3ox gene in peanut, and its biological function in peanut is still unclear. Therefore, studying the genetic law of plant height development not only helps to understand the mechanism of yield formation, but also has important significance for using plant height genes to breed varieties with lodging resistance, high yield, and suitability for machine harvesting. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide the application of the AhGA3ox1 gene in regulating plant height and breeding. The present invention discloses a peanut AhGA3ox1 gene encoding gibberellin 3β-dioxygenase, designs a specific primer pair for the full-length open reading frame of the AhGA3ox1 gene, clones the AhGA3ox1 gene using the specific primer pair, transforms it into plants, obtains AhGA3ox1 gene overexpression plants, and finds that the plant height of AhGA3ox1 gene overexpression plants is significantly higher than that of wild-type plants.

[0005] To achieve the above invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides the application of the AhGA3ox1 gene in regulating plant height, and the nucleotide sequence of the AhGA3ox1 gene is as shown in SEQ ID NO.1.

[0007] Preferably, overexpressing the AhGA3ox1 gene in plants significantly increases plant height.

[0008] Preferably, the plant is peanut or Arabidopsis thaliana.

[0009] Preferably, the specific primer pair for amplifying the AhGA3ox1 gene includes a forward primer and a reverse primer;

[0010] The sequence of the forward primer is as shown in SEQ ID NO.3;

[0011] The sequence of the reverse primer is as shown in SEQ ID NO.4.

[0012] Preferably, the method for overexpressing the AhGA3ox1 gene in plants includes the following steps:

[0013] (1) After extracting the total RNA from the peanut tissue sample, reverse transcribe to obtain cDNA;

[0014] (2) Using the obtained cDNA as a template, perform PCR amplification with the specific primer pair of the AhGA3ox1 gene to obtain an amplification product;

[0015] (3) After ligating the amplification product with the expression vector, transform Agrobacterium, and screen to obtain positive strains;

[0016] (4) Transform the plant with the positive strain, and screen the positive plants, which are the plants overexpressing the AhGA3ox1 gene.

[0017] Preferably, the procedure for the PCR amplification is: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 60 s, for a total of 32 cycles; final extension at 68°C for 5 min, and store at 4°C.

[0018] Preferably, the PCR amplification system is calculated based on 50 μL and includes the following components: 2×PCR Buffer for KODFxH 2 O 25 μL, 2 mM dNTPs 10 μL, KOD-Plus-Neo 1 μL, cDNA template 1 μL, 10 pmol / μL forward primer 1 μL, 10 pmol / μL reverse primer 1 μL, ddH 2 O 11 μL.

[0019] The present invention also provides the application of the AhGA3ox1 gene in assisting plant breeding, and screening plants with overexpression of the AhGA3ox1 gene during the breeding process.

[0020] Compared with the prior art, the present invention has the following beneficial effects: The present invention discloses a peanut AhGA3ox1 gene encoding gibberellin 3β-dioxygenase. The nucleotide sequence of the open reading frame of this gene is 1050 bp, encoding 349 amino acids. Through the subcellular localization of the AhGA3ox1 gene, it is found that AhGA3ox1 is localized in the cytoplasm and nucleus. Through the analysis of the tissue expression level of the AhGA3ox1 gene, it is found that the part with the highest expression level of the AhGA3ox1 gene is the peg, followed by the flower. The present invention designs a specific primer pair for the full-length open reading frame of the AhGA3ox1 gene, uses this specific primer pair to clone the AhGA3ox1 gene, obtains a positive clone strain, transforms the positive clone strain into Arabidopsis thaliana, obtains an AhGA3ox1 gene overexpression plant, and finds that the plant height of the AhGA3ox1 gene overexpression plant is significantly higher than that of the wild-type plant. It shows that this gene positively regulates plant height, which provides a theoretical basis for the improvement of peanut variety plant height. Brief Description of the Drawings

[0021] Figure 1 is the relative expression level of the peanut AhGA3ox1 gene in various tissues and organs of peanut;

[0022] Figure 2 is the relative expression level of the peanut AhGA3ox1 gene at different development stages of the pod;

[0023] Figure 3 is the subcellular localization of the GA3ox1 protein;

[0024] Figure 4 is the comparison between the GA3ox1 transgenic plant and the control plant. Detailed Embodiment

[0025] The present invention provides the application of the AhGA3ox1 gene in regulating plant height. The nucleotide sequence of the AhGA3ox1 gene is as shown in SEQ ID NO.1, specifically as follows:

[0026]

[0027] In the present invention, the open reading frame of the AhGA3ox1 gene in plants is 1050 bp, encoding a total of 349 amino acids. The amino acid sequence of the GA3ox1 gene is as shown in SEQ ID NO.2, specifically as follows:

[0028] MATIESSGVETKTLPIQLPLDFSSIQSVPESHAWAESNEDKVENNGDGSIVLPIIDLNDPNAMEMIGYACENWGAFQLKNHGISKSVIEELEVETKRLFDLPKEQKLKALRSRDYPTGYGTFWITPFFQQRMWQEGFTIIGSAVQDAKKIWPNDYQPFCDAMKKFEDESRVLIEKLIHLSFKFLGISEEEEKNWVGPKNHAGAIQLNSYPICPKPENAMGIAPHTDTSIFTLLHQSQSSGLHIFKDGSGWFTVPLVPDTIIINTGDVLHMLSNARFKSALHKVSVNNVKHRYSMVYFYRPTMDQVVSPLVPNNNSDEEPRFRALTFKEYVGIKDKYLDKALSIVSVKED。

[0029] In the present invention, overexpression of the AhGA3ox1 gene results in a significant increase in plant height.

[0030] In the present invention, the plant is peanut or Arabidopsis thaliana.

[0031] In the present invention, the specific primer pair for amplifying the AhGA3ox1 gene includes a forward primer and a reverse primer;

[0032] The forward primer sequence is as shown in SEQ ID NO.3, specifically as follows:

[0033] 5’-CCAGTGAATTCGGATCCAAGCTTATGGCGACAATCGAGTCTTCT-3’;

[0034] The reverse primer sequence is as shown in SEQ ID NO.4, specifically as follows:

[0035] 5’-TGACCCTCGAGGAGCTCCTGCAGTTAATCTTCTTTGACGCTAAC AATTGACA-3’.

[0036] In the present invention, the method for overexpressing the AhGA3ox1 gene in plants includes the following steps:

[0037] (1) After extracting the total RNA from peanut tissue samples, cDNA was obtained by reverse transcription;

[0038] (2) Using the obtained cDNA as a template, PCR amplification was performed with specific primer pairs for the AhGA3ox1 gene to obtain amplification products;

[0039] (3) After ligating the amplification products with the expression vector, Agrobacterium was transformed, and positive strains were screened;

[0040] (4) Plants were transformed with the positive strains, and the positive plants screened were the plants overexpressing the AhGA3ox1 gene.

[0041] In the present invention, the peanut tissue sample is peanut leaves, and the total RNA extraction can be carried out using a conventional commercially available kit; the reverse transcription can be carried out using a conventional commercially available kit; the cDNA synthesis system is calculated as 20 μL and includes the following components: 10 μL of an aqueous solution containing 2 μg of total RNA, 2 μL of 10×RT Buffer, 0.8 μL of 25×dNTP Mix (100 mM), 2 μL of 10×RT Random Primers, MultiScribe TM Reverse Transcriptase 1 μL, 1 μL of 10 U / μL RNase Inhibitor, RNase Free H 2 O was supplemented to 20 μL. The reaction procedure was 25°C for 10 min; 37°C for 120 min; 85°C for 5 min, and stored at 4°C.

[0042] In the present invention, the PCR amplification procedure was pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 60 s, for a total of 32 cycles; final extension at 68°C for 5 min, and stored at 4°C. The PCR amplification system is calculated as 50 μL and includes the following components: 25 μL of 2×PCR Buffer for KOD FxH 2 O2, 10 μL of 2 mM dNTPs, 1 μL of KOD-Plus-Neo, 1 μL of cDNA template, 1 μL of 10 pmol / μL forward primer, 1 μL of 10 pmol / μL reverse primer, ddH 2 O 11 μL. The amplification products were used to recover the target fragments using the agarose gel DNA recovery kit (DP209-03) from Tiangen Biochemical Technology Co., Ltd.; the expression vector was 35S-AhGA3ox1-GFP; the Agrobacterium was EH105.

[0043] The present invention also provides the application of the AhGA3ox1 gene in assisting plant breeding, and plants with overexpression of the AhGA3ox1 gene are screened during the breeding process.

[0044] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0045] Example 1 In vitro cloning of the gibberellin 3β-dioxygenase GA3ox1 gene from peanut

[0046] 1. Extraction of total RNA from peanut leaves

[0047] For one-week-old seedlings of the large peanut variety "Yueyou 7", 0.1 g of leaves were taken and ground into powder in liquid nitrogen, and the total RNA of peanut was extracted with reference to the RNAprep Pure Plant Plus kit (Tiangen Biochemical Technology Co., Ltd.).

[0048] 2. Reverse transcription of total RNA from peanut leaves

[0049] After thawing each component on ice, 2 μg of total RNA was made up to 10 μL, and then the required reaction system was prepared as shown in Table 1. The reaction procedure of the mixed reaction solution on the PCR instrument is shown in Table 2.

[0050] Table 1 Reaction system

[0051] Component Volume (μL) 10×RT Buffer 2.0 25×dNTP Mix (100mM) 0.8 10×RT Random Primers 2.0 <![CDATA[MultiScribe TM Reverse Transcriptase]]> 1.0 RNase Inhibitor 1.0 <![CDATA[Nuclease-free H 2 O]]> 3.2 RNA 10 Total per reaction 20

[0052] Table 2 Reaction procedure

[0053]

[0054] After the reaction, it was cooled on ice and stored in a 4°C refrigerator.

[0055] 3. Cloning of the AhGA3ox1 gene

[0056] Specific primers for AhGA3ox1 were designed using Primer5 software,

[0057] GA3ox1-F1: 5’-CCAGTGAATTCGGATCCAAGCTTATGGCGACAATCGAGTCTTCT-3’ (SEQ ID NO.3),

[0058] GA3ox1-R1: 5’-TGACCCTCGAGGAGCTCCTGCAGTTAATCTTCTTTGACGCTAACAATTGACA-3’ (SEQ ID NO.4).

[0059] Using cDNA as a template, the AhGA3ox1 gene was amplified by PCR technology. The reaction system is shown in Table 3, and the reaction conditions are shown in Table 4.

[0060] Table 3 PCR reaction system

[0061]

[0062]

[0063] Table 4 PCR reaction conditions

[0064]

[0065] 4. Recovery of the PCR reaction product of in vitro amplification of AhGA3ox1

[0066] The 1050 bp electrophoresis fragment was cut off, and the target fragment was recovered using the Agarose Gel DNA Recovery Kit (DP209 - 03) from Tiangen Biochemical Technology Co., Ltd.; the operation was carried out according to the kit instructions.

[0067] 5. Recombinant plasmid transformation

[0068] The obtained product was ligated to the cloning vector pUC57, transformed into DH5α Escherichia coli competent cells, positive clones were screened, and sequence determination was carried out after PCR detection.

[0069] Example 2 Analysis of the tissue expression level of the AhGA3ox1 gene

[0070] For one - week - old seedlings of the peanut variety "Yueyou 7", 0.1 g of each tissue of leaves, roots, stems, flowers, and pegs was taken. And 10 d, 17 d, 24 d, 31 d, and 38 d after the peanut pegs entered the soil, pods of the same size were selected, the pod husks were quickly frozen in liquid nitrogen and ground into powder. Total RNA was extracted with reference to the RNAprep Pure PlantPlus kit (Tiangen), and a cDNA library was obtained by reverse transcription.

[0071] The primer sequences used for Real time PCR are as follows:

[0072] AhGA3ox1 - F1 RT: 5’ - GTAGTTTCTCCTTTGGTTCCGAAT - 3’ (SEQ ID NO.5),

[0073] AhGA3ox1 - R1 RT: 5’ - GGCTTTGTCAAGATACTTGTCCTT - 3’ (SEQ ID NO.6).

[0074] The reaction conditions for fluorescence quantitative Realtime PCR of AhGA3ox1 gene were as follows: Using the ABI StepOne Plus system, SYBR Premix ExTaq (TaKaRa) was used for PCR reaction. Taking the cDNA reverse transcribed from the total RNA of peanut roots, stems, leaves, flowers, and peg as the template to explore the expression of AhGA3ox1 gene in different tissues of peanut. The results were as Figure 1 shown. Taking the cDNA reverse transcribed from the total RNA of peanut pod hulls at 10d, 17d, 24d, 31d, and 38d after the peanut peg entered the soil as the template to explore the expression of AhGA3ox1 gene at different developmental stages of peanut pods. The results were as Figure 2 shown. The reaction method and conditions of the fluorescence quantitative system were referred to the SYBR Green kit (TaKaRa). 18S (18S-F: ATTCCTAGTAAGCGCGAGTCATCAG (SEQ ID NO.7), 18S-R: CAATGATCCTTCCGCAGGTTCAC (SEQ ID NO.8)) was used as the internal reference gene. Each sample was repeated 3 times. The experimental data was analyzed by the 2 -ΔΔct method, and the reaction was for 40 cycles. The Realtime PCR reaction system (25 μL) included 12.5 μL of SYBR preMix Ex Taq (2×) reaction solution, 0.5 μL of each forward and reverse primer (10 μM), 2 μL of peanut leaf cDNA template, and 9.5 μL of sterile water. The results showed that the part with the highest expression level of AhGA3ox1 gene in peanut was the peg, followed by the flower, and the expression levels in other tissues were significantly lower than that in the peg, and the expression level was the highest at 10d after the peg entered the soil.

[0075] Example 3 Subcellular localization analysis of the protein encoded by AhGA3ox1 gene

[0076] The full-length coding sequence of the AhGA3ox1 gene without the stop codon was cloned into the vector pNA580 (p35S-GFP). After the constructed plasmid was transformed into Escherichia coli DH5α, a large-scale plasmid DNA extraction kit (Omega) was used to ensure that the plasmid concentration was about 30 μg / μL. Sow several tobacco seeds and culture them under 12h light for 3 - 4 weeks for the experiment. The constructed vector plasmid was transformed into Agrobacterium tumefaciens (GV3101) by electrotransformation method and cultured at 30 °C for 2 days. Use an inoculation loop to scrape the Agrobacterium from the solid culture dish and transfer it to 1 mL of LB liquid medium with corresponding resistance (2 mL centrifuge tube). After blowing and mixing evenly, culture it on a shaker for 1 h; centrifuge at 5000 rpm / min for 5 min and remove the supernatant; use 10 mM MgCL 2Resuspend the cells with the suspension (containing 120 μMAS), adjust the OD600 to about 0.6, and let it stand at room temperature for 3 - 4 h; Select tobacco plants with good growth conditions, inject from the lower epidermis of tobacco leaves with a 1 mL syringe without a tip, and make marks; Cultivate the injected tobacco plants in low light for 2 days, then observations can be made; Take the tobacco leaves injected with the labeled Agrobacterium, make them into slides, observe under a laser confocal microscope, and take pictures. The results are as Figure 3 shown: Green fluorescence can be observed in both the cytoplasmic matrix and the nucleus for the empty vector without the target protein, and green fluorescence can also be observed in both the cytoplasm and the nucleus for the vector containing the target fragment, indicating that AhGA3ox1 is localized in the cytoplasm and the nucleus.

[0077] Example 4 Overexpression of the GA3ox1 gene promotes plant elongation growth

[0078] Construct a transgenic overexpression vector containing 35S - AhGA3ox1 - GFP, transform the vector into Agrobacterium strain EH105, and screen for positive strains through a medium containing kanamycin.

[0079] Transform Arabidopsis thaliana by the floral dip method: 1) Inoculate the activated Agrobacterium solution into an LB liquid medium containing 50 μg / mL kanamycin, place it on a shaker, shake overnight at 28 °C / 180 rpm until the OD reaches about 1.5; 2) Centrifuge at 5000 rpm for 10 min, collect the cells, and pour out the supernatant in the centrifuge tube; 3) Resuspend the cells with the pre - prepared buffer, use a spectrophotometer, with the buffer as a control, and adjust the bacterial solution to an OD of about 0.8; 4) For the previously cultivated Arabidopsis thaliana, pinch off the already blooming flowers and siliques, invert it into a container containing Agrobacterium, completely immerse it for about 1 min, place the infected Arabidopsis thaliana in the greenhouse for dark cultivation for 24 h, then take it out and place it in the greenhouse for normal cultivation; 5) PCR identification of transgenic Arabidopsis thaliana plants, extract the DNA of transgenic Arabidopsis thaliana. The identification of transgenic Arabidopsis thaliana plants is carried out using primers for the target gene AhGA3ox1 and primers for the hygromycin resistance screening marker; 6) Screening of transgenic Arabidopsis thaliana, according to the preliminary PCR identification, record the transgenic lines that can amplify the target band. When Arabidopsis thaliana grows for about 5 weeks, start harvesting seeds, and the obtained seeds are the T0 generation. Disinfect the harvested Arabidopsis thaliana seeds with 70% ethanol for 1 min, rinse them with a small amount of sterile water, then disinfect them with 70% ethanol for 1 min again, and then rinse them 5 times with sterile water. Place the seeds on sterile absorbent paper to dry, and spread them evenly on an MS solid medium containing 30 g / L hygromycin. Vernalize them in a 4 °C refrigerator for 48 h, and then place them in an incubator at 24 °C with a 16 h light / 8 h dark cycle to screen for positive plants. Harvest individual plants, and screen in the same way until a homozygous line is obtained.

[0080] The results are asFigure 4 As shown, the plant height and silique length of the Arabidopsis thaliana plants overexpressing the AhGA3ox1 gene are significantly greater than those of the wild-type plants; this indicates that AhGA3ox1 promotes the elongation growth of plants and fruits.

[0081] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. The application of AhGA3ox1 gene in regulating plant growth, characterized in that: The nucleotide sequence of the AhGA3ox1 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: Overexpression of the AhGA3ox1 gene in plants significantly increased plant height.

3. The use according to claim 2, characterized in that: The plant is peanut or Arabidopsis thaliana.

4. The use according to claim 1 or 2, characterized in that: A specific primer pair for amplifying the AhGA3ox1 gene, comprising a forward primer and a reverse primer; The forward primer sequence is shown in SEQ ID NO.3; The reverse primer sequence is shown in SEQ ID NO.

4.

5. The use according to claim 1, characterized in that: A method for overexpressing AhGA3ox1 gene in a plant comprises the following steps: (1) Extracting total RNA from peanut tissue samples and reversely transcribing to obtain cDNA; (2) Using the obtained cDNA as a template, performing PCR amplification with the specific primer pair described in claim 4 to obtain an amplified product; (3) After connecting the amplified product to the expression vector, transforming Agrobacterium, and screening to obtain positive strains; (4) Transforming plants with positive strains, and screening positive plants as plants that overexpress the AhGA3ox1 gene.

6. The use according to claim 5, characterized in that: The PCR amplification procedure was as follows: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 60 s, for a total of 32 cycles; final extension at 68°C for 5 min, and storage at 4°C.

7. The use according to claim 5, characterized in that: The PCR amplification system, in 50 μL, includes the following components: 2×PCR Buffer for KOD FxH2O 25 μL, 2 mM dNTPs 10 μL, KOD-Plus-Neo 1 μL, cDNA template 1 μL, 10 pmol / μL forward primer 1 μL, 10 pmol / μL reverse primer 1 μL, and ddH2O 11 μL.

8. The use of AhGA3ox1 gene in assisting plant breeding, characterized in that: During the breeding process, plants with overexpression of the AhGA3ox1 gene were screened.

Images