Application of nicotiana benthamiana nbgrp gene in improving expression level of plant virus-mediated foreign protein and transgenic plant cultivation method

By knocking out the NbGRP gene in Nicotiana benthamiana, the plant's antiviral defense was weakened, the viral vector's ability to infect was enhanced, the problem of unstable expression of exogenous proteins was solved, and efficient and stable production of target proteins was achieved.

CN120060357BActive Publication Date: 2025-10-10INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510194776.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-21
Publication Date
2025-10-10
Estimated Expiration
2045-02-21

AI Technical Summary

Technical Problem

The expression level of exogenous proteins in existing plant expression systems is unstable, the yield is low, the production cycle is long and the efficiency is low. The plant's antiviral defense mechanism affects the infection of viral vectors, resulting in insufficient production of target proteins.

Method used

By knocking out the NbGRP gene of Nicotiana benthamiana, a NbGRP gene knockout vector was constructed and introduced into the plant to weaken the antiviral defense response, enhance the infection ability of the viral vector, and promote the expression of the target protein.

Benefits of technology

It significantly improved the expression level of exogenous proteins mediated by plant viral vectors, promoted plant growth, reduced production costs, and provided new ideas for optimizing viral vector expression systems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060357B_ABST
    Figure CN120060357B_ABST
Patent Text Reader

Abstract

The application discloses application of a Nicotiana benthamiana NbGRP gene in improving expression level of virus-mediated exogenous protein of plants and a transgenic plant cultivation method, the plant virus is tobacco mosaic virus or potato virus X, and a transcript sequence of the NbGRP gene is shown as SEQ ID NO:1. The application introduces a gene knockout vector carrying a NbGRP gene target into the Nicotiana benthamiana by using an agrobacterium transformation method, and obtains the NbGRP gene edited Nicotiana benthamiana plant. The mutant plant can significantly promote plant growth, and significantly improve expression level of the tobacco mosaic virus or the potato virus X vector-mediated exogenous protein, thereby providing a new idea for efficient production of the exogenous protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to the application of Nicotiana benthamiana NbGRP gene in improving the expression level of plant virus-mediated exogenous proteins and a transgenic plant cultivation method. Background Art

[0002] Plants, as efficient bioreactors, have been widely used to produce both pharmaceutical and non-pharmaceutical target proteins. Compared to mammalian expression systems, plant expression systems offer significant advantages, including greater scalability, lower production costs, reduced risk of contamination with human pathogens, and the ability to achieve high-level protein expression in a shorter timeframe. Over the past three decades, plant expression systems have been used to produce a variety of recombinant proteins, such as vaccines, therapeutic antibodies, and bioactive proteins, demonstrating their enormous potential in the biopharmaceutical field.

[0003] Improving target protein yield is a key consideration for effective expression in plants. While overexpressing a target in transgenic plants is a key approach for large-scale production of vaccines or target molecules, obtaining transgenic plants takes a long time, and target protein or molecule yields can be affected by pathways such as RNA silencing. Consequently, existing technologies for producing exogenous proteins using plant expression systems still suffer from limitations such as unstable protein expression, low yields, long production cycles, and low efficiency. Plant viruses, as obligate intracellular parasites, have been successfully engineered into plant viral vectors, enabling efficient delivery of target genes into plant cells and promoting the rapid expression of vaccines, monoclonal antibodies, or other therapeutic proteins. However, to resist viral infection, plants have evolved diverse antiviral defense mechanisms, which can impact target protein yield. Therefore, identifying and knocking out plant antiviral factors would facilitate viral infection and thereby increase target protein yield. Summary of the Invention

[0004] The present invention aims to provide a method for cultivating transgenic plants using the NbGRP gene from Nicotiana benthamiana to enhance viral-mediated exogenous protein expression. This method utilizes the NbGRP gene to knock out transgenic plants. These transgenic plants not only facilitate viral infection but also promote plant growth, significantly increasing the yield of target proteins mediated by plant viral expression vectors. This provides new insights into optimizing plant viral expression systems.

[0005] To achieve the above purpose, the technical solutions adopted by the present invention are as follows:

[0006] Application of Nicotiana benthamiana NbGRP gene in improving the expression level of exogenous proteins mediated by plant viruses, wherein the plant virus is tobacco mosaic virus or potato virus X, and the transcript sequence of the NbGRP gene is shown in SEQ ID NO: 1.

[0007] The specific method involves constructing a NbGRP gene knockout vector for Nicotiana benthamiana and introducing the knockout vector into target plants to obtain N. benthamiana plants with NbGRP gene mutations. These mutant plants promote plant growth and significantly enhance infection by tobacco mosaic virus (TMV) and potato virus X (PVX). Transgenic plants with NbGRP mutations also exhibit increased expression of green fluorescent protein (GFP) mediated by TMV- and PVX-mediated vectors.

[0008] A method for cultivating NbGRP transgenic plants comprises constructing a Nicotiana benthamiana NbGRP gene knockout vector, introducing the gene knockout vector into a target plant, and obtaining Nicotiana benthamiana plants with NbGRP gene mutations.

[0009] Among them, a NbGRP gene knockout vector of Nicotiana benthamiana was constructed, that is, a gRNA targeting NbGRP was designed at the PAM site near the coding region of the NbGRP gene of Nicotiana benthamiana, and the pCambia1300-BKG-g1 vector was constructed. After the pretreated Nicotiana benthamiana leaves were cultured into callus tissue on a culture medium, the gene knockout vector was introduced into Nicotiana benthamiana using the Agrobacterium-mediated T-DNA insertion method to obtain Nicotiana benthamiana plants with NbGRP gene mutations. The obtained Nicotiana benthamiana plants with NbGRP gene mutations can promote plant growth and significantly enhance the expression level of GFP mediated by TMV and PVX.

[0010] The specific steps include:

[0011] (1) Designing a gRNA targeting NbGRP at the PAM site near the coding region of the NbGRP gene of Nicotiana benthamiana to obtain a gRNA sequence as shown in SEQ ID NO: 2; designing a complementary chain based on this sequence, synthesizing primers, and forming a complementary double strand after high-temperature annealing;

[0012] gRNA sequence: TGATTGCCCTCGGCACCCACCTCCG;

[0013] (2) Digest the BKG vector with restriction endonuclease Eco31I and recover the fragment by gel excision;

[0014] (3) Use T4 ligase to ligate the double-stranded gRNA to the BKG vector;

[0015] (4) The mixed product was added to 100 μL competent E. coli, heat-shocked and transformed, incubated at 37°C for 1 h, and then spread on the corresponding resistance culture medium and incubated at 37°C overnight;

[0016] (5) Using primers M13-F and NbGRP-BKG-R, positive single colonies were screened and the positive clone plasmids were sequenced to confirm the positive recombinant plasmids; the sequences of M13-F and NbGRP-BKG-R are shown in SEQ ID NO: 3 and SEQ ID NO: 6;

[0017] M13-F:GTAAAACGACGGCCAGT

[0018] NbGRP-BKG-R: AAACCGGAGGTGGGTGCCGAGGGCA

[0019] (6) Transform the recombinant plasmid into competent Agrobacterium, spread it onto the corresponding resistance culture medium, and culture it at 28°C;

[0020] (7) Infecting pre-cultured Nicotiana benthamiana explants, obtaining callus tissue through differentiation culture, and then obtaining T0 generation seedlings through rooting culture, which were transferred to soil for further culture;

[0021] (8) After the seedlings have grown stably, leaf samples are taken and DNA is extracted using the CTAB method; the extracted DNA is used as a template and PCR amplification is performed using primers M13-F and gRNA-R to confirm that the exogenous CRISPR-Cas9 sequence has been transferred into the plant; the gRNA-R sequence is shown in SEQ ID NO: 4;

[0022] gRNA-R sequence:TTGATATTTTTGGAGTAGACAAGTGTGTCG

[0023] (9) DNA was extracted from the positive transgenic plants and amplified using primers NbGRP-BKG-F and NbGRP-BKG-R. The target gene was detected by sequencing to determine whether it was edited. The edited lines were kept as seeds, T1 generation seeds were screened on the corresponding resistance culture medium, and the positive seedlings were used for the experiment; wherein the sequences of NbGRP-BKG-F and NbGRP-BKG-R are shown in SEQ ID NO:5-6.

[0024] (10) Viral expression vectors carrying GFP, such as TMV-GFP and PVX-GFP, were inoculated into NbGRP-mutated transgenic plants by Agrobacterium infiltration. The fluorescence intensity of GFP was observed by ultraviolet light, and RNA and total protein were extracted from the systemic leaves of the inoculated plants. The accumulation of viral RNA and GFP protein was analyzed by western blot.

[0025] Compared with the prior art, the outstanding effects of the present invention are:

[0026] (1) The present invention knocks out the antiviral factor NbGRP of Nicotiana benthamiana, thereby weakening the plant's antiviral defense response, significantly enhancing the infection of TMV and PVX, and thereby increasing the expression level of exogenous proteins mediated by plant virus vectors, such as GFP.

[0027] (2) Unlike prior art methods that knock out antiviral factors like RDR6, which result in abnormal plant development, knocking out the NbGRP gene in the present invention resulted in no obvious developmental defects and, instead, promoted plant growth. This characteristic allows the mutant plants to increase both protein production and biomass, further reducing production costs.

[0028] (3) The present invention is not only applicable to tobacco mosaic virus (TMV) and potato virus X (PVX), but is also expected to be extended to other plant virus vector systems, providing a universal platform for the production of vaccine antigens, therapeutic antibodies, and biologically active proteins.

[0029] The application of the Nicotiana benthamiana NbGRP gene in improving the expression level of plant virus-mediated exogenous proteins and the transgenic plant cultivation method of the present invention are further described below in conjunction with the accompanying drawings and specific examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the construction of the NbGRP gene knockout vector and the growth phenotype of transgenic plants: (A) Schematic diagram of the construction of the NbGRP gene knockout vector; (B) Gene editing site of NbGRP; (C) Phenotypic comparison between the NbGRP knockout mutant and the wild-type plant.

[0031] Figure 2 Figure 3. Effects of NbGRP knockout in N. benthamiana on TMV- and PVX-mediated GFP expression. (A) Wild-type and NbGRP knockout N. benthamiana plants were inoculated with TMV-GFP and PVX-GFP, and virus accumulation was observed in systemic leaves under UV light on day 7. (B) Western blot analysis of viral protein accumulation. WT represents the wild-type N. benthamiana control, and Ponceau S represents the loading level analysis. DETAILED DESCRIPTION

[0032] A method for cultivating NbGRP transgenic plants that enhances the expression of exogenous proteins mediated by plant viral vectors involves introducing a gene knockout vector carrying the NbGRP gene target site into the target plant via Agrobacterium transformation to obtain NbGRP gene-edited Nicotiana benthamiana plants. The transcript sequence of the NbGRP gene is shown in SEQ ID NO: 1.

[0033] The specific steps include:

[0034] (1) Designing a gRNA targeting NbGRP at the PAM site near the coding region of the NbGRP gene of Nicotiana benthamiana to obtain a gRNA sequence as shown in SEQ ID NO: 2; designing a complementary strand based on this sequence and synthesizing a primer;

[0035] gRNA sequence: TGATTGCCCTCGGCACCCACCTCCG

[0036] (2) Anneal the primers using BioTec Annealing Buffer for DNA Oligos (D0251) to obtain double-stranded DNA. The specific steps are as follows:

[0037] ① Prepare NbGRP-BKG-F / R powder in ddH2O to 50 μM;

[0038] ② Prepare the reaction system in the PCR tube:

[0039] <![CDATA[ddH2O]]> 4 μL Annealing Buffer for DNAOligo 2μL Oligo A 2μL Oligo B 2μL Overall system 10 μL

[0040] ③React using a PCR instrument: 95°C for 2 minutes; decrease by 0.1°C every 8 seconds until it reaches 25°C; store temporarily at 4°C for 5 minutes;

[0041] (3) The BKG vector was digested with restriction endonuclease Eco31I, ligated with the annealed product using T4 ligase, and transformed into DH5α Escherichia coli. After heat shock transformation and incubation at 37°C for 1 hour, the bacterial solution was plated on a kanamycin-selected culture plate and incubated at 37°C overnight. Positive single colonies were screened using primers M13-F (shown in SEQ ID NO: 3) and NbGRP-BKG-R (shown in SEQ ID NO: 6). The positive clone plasmid was confirmed by sequencing to obtain a positive recombinant plasmid.

[0042] M13-F:GTAAAACGACGGCCAGT

[0043] NbGRP-BKG-R: AAACCGGAGGTGGGTGCCGAGGGCA

[0044] The schematic diagram of the construction of NbGRP gene knockout vector (pCambia1300-BKG-g1 vector) is shown in Figure 1 As shown in A;

[0045] (4) Add the recombinant plasmid to 100 μL of Agrobacterium competent medium, electroporate and transform, then spread on the corresponding resistance medium and culture at 28°C;

[0046] (5) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus tissue through differentiation culture, and then obtain T0 generation seedlings through rooting culture, which are then transferred to soil for further cultivation;

[0047] (6) After the seedlings grow stably, leaf samples are taken, and DNA is extracted using the CTAB method; the extracted DNA is used as a template, and PCR amplification is performed using primers M13-F and gRNA-R (as shown in SEQ ID NOs: 3-4) to determine whether the exogenous CRISPR-Cas9 sequence is introduced into the plant;

[0048] M13-F: GTAAAACGACGGCCAGT

[0049] gRNA-R: TTGATATTTTTGGAGTAGACAAGTGTGTCG

[0050] (7) DNA is extracted from the positive transgenic plants, amplification is performed using primers NbGRP-BKG-F and NbGRP-BKG-R (as shown in SEQ ID NOs: 5-6), and sequence determination is performed to confirm whether the target gene is edited; the edited strains are kept, and T1 generation seeds are screened on the corresponding resistance medium, and the positive seedlings are used for experiments.

[0051] NbGRP-BKG-F: TGATTGCCCTCGGCACCCACCTCCG

[0052] NbGRP-BKG-R: AAACCGGAGGTGGGTGCCGAGGGCA

[0053] (8) In the obtained positive editing materials, NbGRP-edited N. benthamiana materials are screened. As shown in Figure 1 B, a 7-base deletion mutation occurs in the target sequence, and is named: Nbgrp-3.

[0054] (9) The transgenic strains are screened, the effect of NbGRP knockout on the growth of N. benthamiana is observed, and it is indicated that the mutation of NbGRP promotes the growth of N. benthamiana Figure 1 C).

[0055] Tobacco mosaic virus (TMV-GFP) with GFP fluorescence and infectious clone of potato virus X (PVX-GFP) are inoculated into wild-type N. benthamiana and NbGRP gene knockout N. benthamiana, and on the 7th day after inoculation, the green fluorescence of the leaves is observed using a handheld ultraviolet lamp observation system, as shown in Figure 2 A, 2C; the same disease sites of different plants are sampled, and western blot detection is performed, and the results are shown in Figure 2 B, 2D, and the accumulation amount of GFP protein in the NbGRP gene knockout strain is significantly higher than that in the wild-type plant.

[0056] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.

Claims

1. Knockout of Nicotiana benthamiana NbGRP The application of a gene in improving the expression level of a plant virus-mediated foreign protein is characterized by: The plant virus is tobacco mosaic virus or potato virus X, NbGRP The transcript sequence of the gene is shown in SEQ ID NO: 1; NbGRP The gene knockout vector is introduced into the target plant to obtain NbGRP Genetically mutated Nicotiana benthamiana plants can promote plant growth and significantly enhance the infection of tobacco mosaic virus and potato virus X, and increase the expression level of exogenous proteins mediated by viral vectors.

Citation Information

Patent Citations

  • Application of nicotiana benthamiana NbTSG101 gene in regulation and control of plant virus resistance and transgenic plant cultivation method

    CN115976040A