A detection method for genotyping of glyphosate-resistant goosegrass

Abstract

The present invention relates to the field of molecular biology detection technology, and particularly to a detection method for genotyping of glyphosate-resistant goosegrass. The present invention designs a pair of primer sets for three mutation sites, namely Pro-106-Leu, Pro-106-Ser, and Thr-102-Ile. Based on the loop-mediated isothermal amplification technology of the pair of primer sets, two detection modes are established by combining a fluorescence monitoring and a colorimetric dye closed-tube interpretation dual system. The synergistic use of the two can improve the detection accuracy (>95%), and the independent use can meet the requirements of various scenarios. The present invention realizes for the first time the genotyping detection of glyphosate-resistant weed targets by LAMP technology, combines the high sensitivity of laboratory detection with the portability of field application, and has a low detection cost, and is suitable for resistance evolution monitoring and precise herbicide control.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and particularly relates to a method for detecting the genotyping of glyphosate-resistant goosegrass. Background Art

[0002] As the world's most widely used broad-spectrum herbicide, the long-term single use of glyphosate has led to the accelerated evolution of resistant weeds. Glyphosate exerts its herbicidal effect by inhibiting the EPSPS gene of plants and interfering with the synthesis of aromatic amino acids. With the acceleration of the agricultural modernization process, the planting area of glyphosate-resistant genetically modified crops (such as soybeans and corn) has been expanding year by year, and the frequency and amount of glyphosate use will inevitably increase significantly. Therefore, it is of great significance to establish a rapid detection technology for weed resistance, monitor the occurrence of glyphosate-resistant weeds in transgenic crop fields in different regions, and timely block the spread of glyphosate-resistant weeds to transgenic crop fields.

[0003] However, the current resistance detection technology faces double challenges: one is the limitation of laboratory technology: traditional sequencing and fluorescence quantitative PCR rely on precise instruments and professional personnel, and it is difficult to meet the needs of rapid field screening; the other is the blank of field monitoring: the lack of detection technology adapted to the field environment makes it impossible to timely master the weed resistance situation in each region, resulting in a lag in the early warning of the spread of resistant populations.

[0004] For the detection methods for resistance caused by mutations in weed target sites, there are mainly traditional Sanger sequencing, fluorescence quantitative PCR, CAPS (Cleaved Amplified Polymorphic Sequences) / dCAPS (Derived Cleaved Amplified Polymorphic Sequences), and loop-mediated isothermal amplification (LAMP) methods, etc. However, the above methods all have some technical defects.

[0005] The traditional Sanger detection method mainly involves extracting the DNA of resistant weeds, designing PCR primers according to the conserved sequence of the known resistance gene, adding each reaction component to the PCR tube, performing reactions and agarose gel electrophoresis detection on a PCR instrument, etc. Finally, the PCR product is subjected to Sanger sequencing, and whether there are mutations is analyzed according to the sequencing results; fluorescence quantitative PCR is to add a fluorescently labeled probe or dye to conventional PCR, monitor the fluorescence signal intensity in real time, and quantitatively detect gene mutations in combination with a standard curve. These two detection methods not only have a long detection cycle, high cost, require expensive instruments to purchase, and need professional experimental personnel to operate and analyze, but also have poor field applicability and are not suitable for large-scale screening.

[0006] The CAPS / dCAPS detection method. The former utilizes the restriction enzyme cleavage sites formed by the original single nucleotide polymorphisms (SNPs) in the genome, while the latter constructs recognition sites by introducing mismatched bases at the 3` end of the primer, enabling the PCR products to be recognized and cleaved by specific restriction endonucleases. The PCR products of different genotypes will produce products of different lengths after enzymatic digestion, and the gene mutations are judged by separation through agarose gel electrophoresis. Compared with the previous two methods, this method can not only detect the presence of mutations but also perform rapid gene typing, yet it still faces the defects of the above-mentioned traditional detection techniques.

[0007] At present, although the conventional single-target LAMP technology avoids the above-mentioned defects, it can only qualitatively judge the presence or absence of resistance genes and cannot perform resistance gene typing. Summary of the Invention

[0008] To solve the above technical problems, the present invention designs a set of LAMP primers for the specific sequences of two genotypes of goosegrass (resistant and sensitive) at three different mutation sites (Pro-106-Leu, Pro-106-Ser, Thr-102-Ile) of the goosegrass EPSPS gene. The LAMP technology is used to rapidly detect goosegrass with unknown resistance and sensitivity, distinguish the presence of resistance mutations, and further distinguish the types of resistance mutations (homozygous mutation, heterozygous mutation). Based on this, the following technical solutions are proposed.

[0009] First of all, the present invention provides a set of primers, including: a specific primer set for the resistance gene and a specific primer set for the sensitive gene; the specific primer set for the resistance gene includes the Pro-106-Leu resistance primer set, the Pro-106-Ser resistance primer set, and the Thr-102-Ile resistance primer set; the specific primer set for the sensitive gene includes the Pro-106-Leu sensitive primer set, the Pro-106-Ser sensitive primer set, and the Thr-102-Ile sensitive primer set;

[0010] The Pro-106-Leu resistance primer set includes:

[0011] F3: CTGAAAACCCTCGGACTCTC

[0012] B3: CCAACTCACGTTGCATTTCC

[0013] FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC

[0014] BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCGCTA;

[0015] The Pro-106-Ser resistance primer set includes:

[0016] F3: CTGAAAACCCTCGGACTCTC

[0017] B3: CCAACTCACGTTGCATTTCC

[0018] FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC

[0019] BIP:AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCATAGA;

[0020] The Thr-102-Ile resistance primer set includes:

[0021] F3:AGCTGCCAAAAGAGCAGTAG

[0022] B3:CGGGCATATTCTGAGGATGG

[0023] FIP:ATGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC

[0024] BIP:TTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC;

[0025] The Pro-106-Leu sensitive primer set includes:

[0026] F3:CTGAAAACCCTCGGACTCTC

[0027] B3: CCAACTCACGTTGCATTTCC

[0028] FIP:TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC

[0029] BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCCTTG;

[0030] The Pro-106-Ser sensitive primer set includes:

[0031] F3:CTGAAAACCCTCGGACTCTC

[0032] B3:CCAACTCACGTTGCATTTCC

[0033] FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC

[0034] BIP: AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCAGCGG;

[0035] The Thr-102-Ile sensitive primer set includes:

[0036] F3: AGCTGCCAAAAGAGCAGTAG

[0037] B3: CGGGCATATTCTGAGGATGG

[0038] FIP: GTGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC

[0039] BIP: CTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC.

[0040] The design method of the above primer set is as follows: Use PrimerExplorer V5 to design primers for the gene sequence of goosegrass with three-site mutations on the target gene as the resistance gene-specific primer set, and then design primers for the goosegrass gene sequence without mutations at the three sites as the sensitive gene-specific primer set.

[0041] Next, the designed primer sets were introduced with mismatches to improve the reaction specificity. It includes mutant gene-specific LAMP primer sets, where double mismatched bases were introduced at the 3rd - 4th positions at the 3' end of the FIP primer in the Pro-106-Leu primer set; double mismatched bases were introduced at the 3rd - 4th positions at the 3' end of the FIP primer in the Pro-106-Ser primer set; a mismatched base was introduced at the 3rd position at the 5' end of the FIP primer in the Thr-102-Ile primer set, and a mismatched base was introduced at the 3rd position at the 5' end of the BIP primer in the Thr-102-Ile primer set. It also includes wild-type gene-specific LAMP primer sets, where double mismatched bases were introduced at the 3rd - 4th positions at the 3' end of the FIP primer in the Pro-106-Leu primer set; double mismatched bases were introduced at the 3rd - 4th positions at the 3' end of the FIP primer in the Pro-106-Ser primer set; a mismatched base was introduced at the 3rd position at the 5' end of the FIP primer in the Thr-102-Ile primer set, and a mismatched base was introduced at the 3rd position at the 5' end of the BIP primer in the Thr-102-Ile primer set. The positions of these mismatched bases were selected through multiple experiments for screening and verification. In the initial experiments, we tried to introduce mismatched bases at other positions, but the introduction at these positions did not achieve ideal specificity, and even non-specific amplification or low amplification efficiency occurred. Therefore, finally, we selected the current mismatched positions to ensure higher amplification specificity and reliability.

[0042] Furthermore, the present invention provides a reagent or kit containing the above-mentioned primer sets.

[0043] In some embodiments, the reagent or kit is a LAMP reagent or kit.

[0044] In some embodiments, the reagent or kit includes a fluorescence-resistant detection system and a fluorescence-sensitive detection system;

[0045] The fluorescence-resistant detection system includes: Bst 3.0 polymerase, TS LAMP Green, LAMP ReactionMIXⅠ, RNase-free Water, and the resistant gene-specific primer set;

[0046] The fluorescence-sensitive detection system includes: Bst 3.0 polymerase, TS LAMP Green, LAMP ReactionMIXⅠ, RNase-free Water, and the sensitive gene-specific primer set.

[0047] In some embodiments, the reagent or kit includes a colorimetric-resistant detection system and a colorimetric-sensitive detection system;

[0048] The color development resistance detection system includes: Bst 2.0 polymerase, N-Red Stain, pH Sensitive LAMP Reaction Mix, RNase-free Water, and the resistance gene specific primer set;

[0049] The color development sensitivity detection system includes: Bst 2.0 polymerase, N-Red Stain, pH Sensitive LAMP Reaction Mix, RNase-free Water, and the sensitive gene specific primer set.

[0050] In some embodiments, the reagent or kit further includes a positive control, a heterozygous control, and a negative control; the positive control includes Pro-106-Leu homozygous resistant DNA, Pro-106-Ser homozygous resistant DNA, and Thr-102-Ile homozygous resistant DNA; the heterozygous control includes Pro-106-Leu mutant / wild-type mixed DNA, Pro-106-Ser homozygous resistant DNA, and Thr-102-Ile homozygous resistant DNA; the negative control includes wild-type sensitive DNA.

[0051] Furthermore, the present invention provides the application of the primer set or the reagent or kit in the genotyping of glyphosate-resistant goosegrass genes.

[0052] Furthermore, the present invention provides a fluorescence detection method for genotyping glyphosate-resistant goosegrass genes, including: adding the DNA sample of the to-be-detected goosegrass into the fluorescence resistance detection system and the fluorescence sensitivity detection system in the reagent or kit respectively, then performing PCR amplification, and judging the genotyping result according to the Ct value and the ΔCt value; the conditions of the PCR amplification include: amplifying at 65 °C for 45 min and terminating the reaction at 80 °C (preferably collecting fluorescence signals at an interval of 1 min).

[0053] In some embodiments, when the resistance Ct value < 30 and the ΔCt value ≥ 10, it is determined as homozygous mutation; when the resistance Ct value < 30, the sensitivity Ct value < 30, and -5 < ΔCt value < 5, it is determined as heterozygous mutation; when the sensitivity Ct value < 30 and the ΔCt value ≥ 10, it is determined as no mutation.

[0054] In the present invention, the ΔCt value = Ct sensitivity - Ct resistance.

[0055] Meanwhile, the present invention provides a colorimetric detection method for glyphosate-resistant goosegrass genotyping, comprising: adding a DNA sample of the to-be-detected goosegrass into the colorimetric resistance detection system and the colorimetric sensitivity detection system in the reagent or kit respectively, and then (preferably in a water bath) amplifying at 65 °C for 45 min and terminating the reaction at 80 °C, and judging the genotyping result according to the color change.

[0056] In some embodiments, it is determined as a homozygous mutation when the resistance detection system is yellow and the sensitivity detection system is red; it is determined as a heterozygous mutation when both the resistance detection system and the sensitivity detection system are yellow; it is determined as not mutated when the resistance detection system is red and the sensitivity detection system is yellow; it is determined as no template when both the resistance detection system and the sensitivity detection system are red.

[0057] In the specific implementation process, the fluorescence detection method and the colorimetric detection method can either be used synergistically to improve the overall accuracy, or be used separately according to different experimental purposes in different scenarios (laboratory or field).

[0058] In the specific implementation process, the fluorescence detection method and the colorimetric detection method can be used for dual-mode collaborative detection. The colorimetric detection method is used as a preliminary screening to filter out most sensitive samples, and then the fluorescence detection method is further used to concentrate on detecting suspected resistant samples. The two complement each other and cover different scenarios, thereby improving the efficiency and accuracy of the overall detection (when the results of the two methods conflict, the fluorescence detection method shall prevail).

[0059] In the specific implementation process, the DNA sample can be obtained by using a DNA extraction kit method or a crude extraction method.

[0060] The present invention realizes LAMP genotyping for the first time, breaks through the limitation that the traditional LAMP technology can only perform qualitative detection, and realizes genotyping through double primer cross-validation; for the first time, a method of mutual verification of dual-mode detection is established to improve the accuracy of rapid detection. The sensitivity of the LAMP detection method of the present invention is 1000 times higher than that of the conventional PCR detection. Moreover, the LAMP detection method of the present invention is simple and rapid to operate and can be completed within 1 hour. In addition, the primer set of the present invention is designed with 4 specific primers for 6 different regions in the gene sequences of resistant and sensitive goosegrass. If any region in the 6 regions does not match the primer, nucleic acid amplification cannot be carried out. Therefore, the detection method of the present invention has high specificity.

[0061] The present invention has achieved significant advantages in the genotyping detection of herbicide-resistant weeds through double primer set design, dual-mode collaborative verification and anti-pollution control technology, and is of great significance for early warning of the spread of resistant weeds and reducing crop losses.

[0062] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0063] The primer set designed using the present invention can rapidly detect goosegrass that is sensitive to unknown resistance, distinguish whether there are resistance mutations, and further distinguish the types of resistance mutations (homozygous mutations, heterozygous mutations), thereby understanding the occurrence of herbicide resistance of such weeds in the region, providing data support for the planting zoning of glyphosate-resistant crops, avoiding the horizontal spread of resistance genes, and at the same time guiding the rotational use of herbicides by accurately identifying homozygous and heterozygous resistant populations and reducing the dosage of glyphosate. Description of the Drawings

[0064] Figure 1 It is the amplification curve of the sensitive primer set for the P106S mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0065] Figure 2 It is the amplification curve of the resistance primer set for the P106S mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0066] Figure 3 It is the amplification curve of the resistance primer set for the P106L mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0067] Figure 4 It is the amplification curve of the sensitive primer set for the P106L mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0068] Figure 5 It is the amplification curve of the resistance primer set for the T102I mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0069] Figure 6 It is the amplification curve of the sensitive primer set for the T102I mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0070] Figure 7 It is the screening result of the colorimetric detection method. Among them, PL represents homozygous mutation of Pro→Leu at position 106 of the goosegrass EPSPS gene, PLWT represents heterozygous mutation of Pro→Leu; PS represents homozygous mutation of Pro→Ser at position 106 of the goosegrass EPSPS gene, PSWT represents heterozygous mutation of Pro→Ser; IS represents homozygous mutation of Thr→Ile at position 102 of the goosegrass EPSPS gene, ISWT represents heterozygous mutation of Thr→Ile; WT represents no mutation; CK represents no-template control (water).

[0071] Figure 8These are the sensitivity test results of the LAMP reaction, where CK is the template-free control (water).

[0072] Figure 9 These are the sensitivity test results of the PCR reaction.

[0073] Figure 10 These are the test results of the fluorescence detection method for the non-mutated sample.

[0074] Figure 11 These are the test results of the fluorescence detection method for the heterozygous sample.

[0075] Figure 12 These are the test results of the fluorescence detection method for the homozygous mutant sample.

[0076] Figure 13 These are the test results of the fluorescence detection method for the test sample (part).

[0077] Figure 14 This is the statistical analysis map of the CT values of the test sample.

[0078] Figure 15 These are the test results of the colorimetric detection method.

[0079] Figure 16 These are the test results of the colorimetric detection method for the test sample (part). Detailed implementation manners

[0080] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below. Obviously, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art without making creative efforts based on the embodiments in the present invention belong to the scope of protection of the present invention. In the embodiments provided in this specification, those without specific technical or conditions are carried out according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments without indicating the manufacturer can be obtained as conventional products through regular channels. All primer sequences in the present invention are in the 5'-3' direction.

[0081] Example 1 Design and screening of specific primers for three target sites of glyphosate-resistant goosegrass EPSPS

[0082] Download the gene sequence of the Euphorbia cerevisiae EPSPS from NCBI. Use SnapGene software to locate the target sites at Pro106 and Thr102, selecting sequences approximately 400 bp before and after the target sites. Use Primer Explorer V5 (https: / / primerexplorer.jp / e / ) to design LAMP primers online. Select primers that adhere to the following LAMP primer principles:

[0083] (1) Tm value: For base sequences with normal GC content or GC content enrichment (above 60%), select primers F1C / B1C with a Tm of 64-66°C, primers F2 / B2 with a Tm of 64-66°C, and primers F3 / B3 with a Tm of 64-66°C. For base sequences with AT content enrichment (GC content below 45%), select primers F1C / B1C with a Tm of 59-61°C, primers F2 / B2 with a Tm of 54-56°C, and primers F3 / B3 with a Tm of 54-56°C. (2) Free energy: Select primers F1C / B1C with a 5' end free energy and primers F2 / B2 / F3 / B3 with a 3' end free energy less than or equal to -4 kcal / mol. (3) Primer design: For base sequences with normal or GC-rich GC content, the GC content of primers should be between 50-60%. For base sequences with AT content, the GC content of primers should be between 40-50%. When designing primers, it is important to prevent the formation of secondary structures, especially for internal primers, and to avoid 3' end sequence complementarity. All primers within the selection criteria are pending for subsequent screening.

[0084] The fluorescence detection reaction system is 25 μL and includes: 1 μL of 50 ng / μL DNA Template, 2 μL of 10 U / μL Bst 3.0 polymerase, 6.25 μL of 4×LAMP Reaction MIXⅠ, 0.45 μL of TS LAMP Green (20×), 4 μL each of 10 μM FIP / BIP, 1 μL each of 10 μM F3 / B3, and RNase-free water to 25 μL.

[0085] The reaction system for the colorimetric detection method is 25 μL and includes: 1 μL DNA Template, 1 μL 30 U / μL Bst 2.0 polymerase, 10 μL 2.5× pH Sensitive LAMP Reaction Mix, 1.5 μL 2.5 mM N-Red Stain, 4 μL each of 10 μM FIP / BIP, 1 μL each of 10 μM F3 / B3, and RNase-free water to 25 μL.

[0086] The DNA of the goosegrass samples was extracted using the TianGen High-efficiency Plant Genomic DNA Extraction Kit (Catalog No.: DP350).

[0087] For the target sites to be detected, the resistant and sensitive primers for these sites were selected. The DNA of known homozygous mutants, heterozygous mutants, and non-mutant samples was respectively added to the reaction systems of the resistant primers and sensitive primers, and the reaction was carried out on a fluorescence quantitative PCR instrument (ABI7500 instrument). The reaction program was as follows: amplification at 65°C for 1 min, 45 cycles, and fluorescence signals (FAM) were collected every minute at 65°C, and the reaction was terminated by incubation at 80°C for 2 min. The screening criteria were as follows: in the resistant primer system, homozygous mutants and heterozygous mutant samples were amplified, non-mutant samples were not amplified or amplified after at least 10 cycles of lag, while in the sensitive primer system, non-mutant and heterozygous mutant samples were amplified, homozygous mutants were not amplified or amplified after at least 10 cycles of lag. Thus, the preliminary screening was completed.

[0088] The primer sets screened above were further screened by the principle of dye color development; for the target sites to be detected, the resistant and sensitive primers for these sites were selected. The known homozygous mutants, heterozygous mutants, non-mutant samples, and no-template control were respectively added to the reaction systems of the resistant primers and sensitive primers, and the reaction was carried out in a metal water bath. The reaction program was as follows: amplification at 65°C for 45 min, and the reaction was terminated by incubation at 80°C for 5 min, and the color change in the tube was observed. The screening criteria were as follows: in the resistant primer system, homozygous mutants and heterozygous mutant samples changed from red to yellow, non-mutant and no-template control did not change color, while in the sensitive primer system, non-mutant and heterozygous mutants changed from red to yellow, homozygous mutants and no-template control did not change color. Thus, the primer screening was completed.

[0089] After screening a large number of primer combinations and conducting experimental verification, the following primer sets were finally obtained, which could meet the requirements of both fluorescence detection methods and color development detection methods.

[0090] The primer sets include: a resistant gene-specific primer set and a sensitive gene-specific primer set; the resistant gene-specific primer set includes the Pro-106-Leu resistant primer set, the Pro-106-Ser resistant primer set, and the Thr-102-Ile resistant primer set; the sensitive gene-specific primer set includes the Pro-106-Leu sensitive primer set, the Pro-106-Ser sensitive primer set, and the Thr-102-Ile sensitive primer set;

[0091] The Pro-106-Leu resistant primer set includes:

[0092] F3: CTGAAAACCCTCGGACTCTC (SEQ ID No.1)

[0093] B3: CCAACTCACGTTGCATTTCC (SEQ ID No.2)

[0094] FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC

[0095] (SEQ ID No.3)

[0096] BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCGCTA (SEQ ID No.4)

[0097] The Pro-106-Ser resistance primer set includes:

[0098] F3: CTGAAAACCCTCGGACTCTC (SEQ ID No.1)

[0099] B3: CCAACTCACGTTGCATTTCC (SEQ ID No.2)

[0100] FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC (SEQ ID No.3)

[0101] BIP:AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCATAGA (SEQ ID No.5)

[0102] The Thr-102-Ile resistance primer set includes:

[0103] F3:AGCTGCCAAAAGAGCAGTAG (SEQ ID No.6)

[0104] B3:CGGGCATATTCTGAGGATGG (SEQ ID No.7)

[0105] FIP:ATGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC (SEQ ID No.8)

[0106] BIP:TTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC (SEQ ID No.9)

[0107] The Pro-106-Leu sensitive primer set includes:

[0108] F3: CTGAAAACCCTCGGACTCTC (SEQ ID No.1)

[0109] B3: CCAACTCACGTTGCATTTCC (SEQ ID No.2)

[0110] FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC (SEQ ID No.3)

[0111] BIP: AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCCTTG (SEQ ID No.10)

[0112] The Pro-106-Ser sensitive primer set includes:

[0113] F3: CTGAAAACCCTCGGACTCTC (SEQ ID No.1)

[0114] B3: CCAACTCACGTTGCATTTCC (SEQ ID No.2)

[0115] FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC (SEQ ID No.3)

[0116] BIP: AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCAGCGG (SEQ ID No.11)

[0117] The Thr-102-Ile sensitive primer set includes:

[0118] F3: AGCTGCCAAAAGAGCAGTAG (SEQ ID No.6)

[0119] B3: CGGGCATATTCTGAGGATGG (SEQ ID No.7)

[0120] FIP: GTGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC (SEQ ID No.12)

[0121] BIP: CTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC (SEQ ID No.13).

[0122] The amplification curve of the sensitive primer set for the P106S mutation site is as followsFigure 1 As shown, the amplification curve of the resistance primer set for the P106S mutation site is as Figure 2 shown, and the amplification curve of the resistance primer set for the P106L mutation site is as Figure 3 shown, and the amplification curve of the sensitive primer set for the P106L mutation site is as Figure 4 shown, and the amplification curve of the resistance primer set for the T102I mutation site is as Figure 5 shown, and the amplification curve of the sensitive primer set for the T102I mutation site is as Figure 6 shown.

[0123] The screening results of the colorimetric detection method are as Figure 7 shown.

[0124] Example 2 Comparison of the Sensitivity between LAMP Reaction and Conventional PCR Reaction

[0125] The DNA concentration was serially diluted by a 10-fold dilution method to 50, 5, 5×10 -1 , 5×10 -2 , 5×10 -3 , 5×10 -4 , 5×10 -5 , 5×10 -6 ng / µL, a total of 8 concentration gradients.

[0126] The LAMP reaction system was the same as in Example 1; the PCR system was: 12.5 µL 2×Taq Plantinum PCR Mix, 1 µL Primer F (10 µM), 1 µL Primer R (10 µM), 9.5 µL ddH2O, 1 µL DNA.

[0127] Primer F: GCCTTCTCCTTTTCGTTTC (SEQ ID No.14)

[0128] Primer R: GGTAGCCCTCCGATTCC (SEQ ID No.15)

[0129] The same DNA above was subjected to LAMP and PCR respectively, and the sensitivities of the two methods were compared. The LAMP program was 65°C for 45 min, 80°C for 5 min, and after the reaction, 1% agarose gel electrophoresis was performed; the PCR program was 94°C for 4 min, 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, and the above three steps were cycled 32 times, and then 72°C for 5 min. After the reaction, 1% agarose gel electrophoresis was also performed.

[0130] Detection results: The display results of the LAMP reaction ( Figure 8)The observable color changes from red to yellow, or characteristic ladder bands of LAMP appear in the agarose gel, and the detection sensitivity can reach 5×10 -4 ng. The display result of the PCR reaction ( Figure 9 )A single band can be observed at the corresponding position of the agarose gel, and the detection sensitivity can reach 5×10 -1 ng.

[0131] Example 3 Verification of Two LAMP Genotyping Methods

[0132] A total of 150 goosegrass samples with unknown resistance and sensitivity were prepared. DNA was extracted from the above samples, followed by genotype verification through cloning and sequencing, and then accuracy verification experiments of fluorescence detection method and colorimetric detection method were carried out.

[0133] (1)Fluorescence detection method

[0134] The DNA of each of the above-extracted samples was added separately to a double system containing the corresponding mutant resistance primer set and sensitive primer set (as a group). Each reaction system was placed on a qPCR instrument for reaction. The reaction program was: 65°C for 1 min, 45 cycles, fluorescence signals (FAM channel) were collected every minute at 65°C, and the reaction was terminated at 80°C for 2 min. Subsequently, the amplification curve was observed to interpret the results. Result determination: When the resistance Ct value < 30 and the ΔCt value ≥ 10, it was determined as homozygous mutation; when the resistance Ct value < 30, the sensitive Ct value < 30, and -5 < ΔCt value < 5, it was determined as heterozygous mutation; when the sensitive Ct value < 30 and the ΔCt value ≥ 10, it was determined as no mutation; ΔCt value = Ct sensitive - Ct resistance, and the Ct value without amplification was regarded as infinite.

[0135] The detection results of the fluorescence detection method for samples without mutation are as Figure 10 shown, the detection results of the fluorescence detection method for heterozygous samples are as Figure 11 shown, the detection results of the fluorescence detection method for homozygous mutant samples are as Figure 12 shown, the detection results of the fluorescence detection method for the samples to be tested (partially) are as Figure 13 shown, and the spectrum obtained by data analysis of the CT values of the sample detection results is as Figure 14 shown. It can be seen from the figure that there are significant differences among the detection results (where there is no CT value without amplification, and the default cycle number is 50 for convenient data analysis). The overall accuracy of the fluorescence detection method is 91.33%.

[0136] (2)Colorimetric detection method

[0137] Add each of the extracted sample DNAs above to a reaction system containing the corresponding mutant-resistant primer set (sensitive primer set can also be selected), and place each reaction system in a water bath for reaction. The reaction program is as follows: 65°C for 45 minutes, and terminate the reaction at 80°C for 5 minutes. Observe the color change in the tube. Samples with the color in the tube changing from red to yellow are determined to be homozygous mutant samples or heterozygous mutant samples, and samples without color change are non-mutant samples.

[0138] Then, react the sample DNA with the color change above again using the sensitive primer set and observe the results. If the color in the tube changes from red to yellow again, it is determined to be a heterozygous mutant sample; if there is no color change, it is a homozygous mutant sample; and the template-free sample will always have no color change, proving that the system is not contaminated.

[0139] The test results of the colorimetric detection method are as Figure 15 shown. The test results of the colorimetric detection method for some of the test samples are as Figure 16 shown. The overall accuracy rate of the colorimetric detection method is 86.6%.

[0140] (3)Dual-mode collaborative detection

[0141] The colorimetric detection method can quickly eliminate sensitive samples, and only send suspected resistant samples to the laboratory for qPCR verification, reducing the amount of qPCR detection and concentrating resources to verify key samples. The fluorescence detection method is used to centrally detect the colorimetric positive samples, and accurate typing is carried out through the ΔCt algorithm to avoid waste of laboratory resources. The dual-mode collaborative detection improves the overall accuracy rate from 91.33% of qPCR single detection to 98.5% of collaborative detection at the system level.

[0142] Example 4 Laboratory-field joint monitoring

[0143] 1. Investigate and find areas where suspected glyphosate-resistant goosegrass breaks out.

[0144] 2. Rapid screening by the colorimetric detection method in the field (100 samples can be detected in 1 hour using the DNA crude extraction method), and preliminarily determine the weed resistance situation in this area.

[0145] 3. Use the fluorescence detection method to verify the positive samples (with mutations) in the laboratory by qPCR, and delimit the resistance levels (low / medium / high-risk areas) according to the Ct value and ΔCt value.

[0146] 4. Develop a differential weeding plan (rotate glyphosate / glufosinate or switch to other pesticides with different action mechanisms for prevention and control).

[0147] The above method is applicable to high-precision screening of weed resistance in a region, providing data support for the planting zoning of glyphosate-resistant crops. If only a general understanding of the weed resistance situation in the region is needed, only the colorimetric detection method in the field can be used for rapid detection and screening.

[0148] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than limiting them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Primer set, characterized in that, Comprising: A specific primer set for resistant genes and a specific primer set for sensitive genes; The specific primer set for resistant genes includes a Pro-106-Leu resistant primer set, a Pro-106-Ser resistant primer set, and a Thr-102-Ile resistant primer set; the specific primer set for sensitive genes includes a Pro-106-Leu sensitive primer set, a Pro-106-Ser sensitive primer set, and a Thr-102-Ile sensitive primer set; The Pro-106-Leu resistant primer set includes: F3: CTGAAAACCCTCGGACTCTC B3: CCAACTCACGTTGCATTTCC FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCGCTA; The Pro-106-Ser resistant primer set includes: F3: CTGAAAACCCTCGGACTCTC B3: CCAACTCACGTTGCATTTCC FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCATAGA; The Thr-102-Ile resistant primer set includes: F3:AGCTGCCAAAAGAGCAGTAG B3:CGGGCATATTCTGAGGATGG FIP:ATGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC BIP:TTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC; The Pro-106-Leu sensitive primer set includes: F3:CTGAAAACCCTCGGACTCTC B3: CCAACTCACGTTGCATTTCC FIP:TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCCTTG; The Pro-106-Ser sensitive primer set includes: F3:CTGAAAACCCTCGGACTCTC B3:CCAACTCACGTTGCATTTCC FIP:TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCAGCGG; The Thr-102-Ile sensitive primer set includes: F3: AGCTGCCAAAAGAGCAGTAG B3: CGGGCATATTCTGAGGATGG FIP: GTGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC BIP: CTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC。 2. A reagent or kit containing the primer set recited in claim 1.

3. The reagent or kit according to claim 2, wherein The reagent or kit is a LAMP reagent or kit.

4. The reagent or kit according to claim 3, wherein The reagent or kit includes a fluorescence-resistant detection system and a fluorescence-sensitive detection system; The fluorescence-resistant detection system includes: Bst 3.0 polymerase, TS LAMP Green, LAMP Reaction MIXⅠ, RNase-free Water, and the resistance gene-specific primer set; The fluorescence-sensitive detection system includes: Bst 3.0 polymerase, TS LAMP Green, LAMP Reaction MIXⅠ, RNase-free Water, and the sensitive gene-specific primer set.

5. The reagent or kit according to claim 3, characterized in that, The reagent or kit includes a colorimetric-resistant detection system and a colorimetric-sensitive detection system; The colorimetric-resistant detection system includes: Bst 2.0 polymerase, N-Red Stain, pH Sensitive LAMPReaction Mix, RNase-free Water, and the resistance gene-specific primer set; The colorimetric-sensitive detection system includes: Bst 2.0 polymerase, N-Red Stain, pH Sensitive LAMPReaction Mix, RNase-free Water, and the sensitive gene-specific primer set.

6. Use of the primer set recited in claim 1 or the reagent or kit recited in any one of claims 2 to 5 in the genotyping of glyphosate-resistant goosegrass genes.

7. A fluorescence detection method for the genotyping of glyphosate-resistant goosegrass, characterized in that, It includes: Respectively add the DNA sample of the to-be-detected goosegrass into the fluorescence-resistant detection system and the fluorescence-sensitive detection system in the reagent or kit recited in claim 4, then perform PCR amplification, and judge the genotyping result according to the Ct value and the ΔCt value; The conditions for the PCR amplification include: amplify at 65 °C for 45 min and terminate the reaction at 80 °C.

8. A colorimetric detection method for genotyping of glyphosate-resistant goosegrass, characterized in that, It includes: Respectively add the DNA sample of the to-be-detected goosegrass into the colorimetric-resistant detection system and the colorimetric-sensitive detection system in the reagent or kit recited in claim 5, then amplify at 65 °C for 45 min and terminate the reaction at 80 °C, and judge the genotyping result according to the color change.

9. The fluorescence detection method according to claim 7, wherein When the resistance Ct value < 30 and the ΔCt value ≥ 10, it is determined as a homozygous mutation; when the resistance Ct value < 30, the sensitive Ct value < 30, and -5 < ΔCt value < 5, it is determined as a heterozygous mutation; when the sensitive Ct value < 30 and the ΔCt value ≥ 10, it is determined as no mutation.

10. The colorimetric detection method according to claim 8, wherein The resistant detection system is yellow and the sensitive detection system is red, which is determined as a homozygous mutation; both the resistant detection system and the sensitive detection system are yellow, which is determined as a heterozygous mutation; the resistant detection system is red and the sensitive detection system is yellow, which is determined as non-mutated; both the resistant detection system and the sensitive detection system are red, which is determined as no template.

Images