Single-drop liquid-solid friction nano-generator and method for detecting bacteria by single-drop liquid-solid friction nano-generator

Abstract

The invention relates to the technical field of microbiological detection, and discloses a single-drop liquid-solid friction nano-generator and a method for detecting bacteria thereof.The single-drop liquid-solid friction nano-generator comprises a first electrode, a dielectric layer and a second electrode, the dielectric layer is arranged between the first electrode and the second electrode, the first electrode comprises a sulfydryl-modified nucleic acid aptamer, gold nanoparticles and an electrode plate, and the electrode plate is arranged between the first electrode and the second electrode. The gold nanoparticles are arranged on the surface of the electrode plate, and the sulfydryl-modified nucleic acid aptamer is connected with the gold nanoparticles; the novel single-drop liquid-solid friction nano generator is constructed, complex operation is not needed when the single-drop liquid-solid friction nano generator is used as a sensor for detection, the obtained electric data can accurately reflect the change of the device, the change of the solubility of the bacterial liquid is reflected through the change of the electric data, and then the purpose of detecting the concentration of the bacterial liquid is achieved.

Description

[0001] This application claims the priority of a prior Chinese application with the application number: 202411950595.7 and the filing date of December 27, 2024. The specification, claims, abstract, and drawings of this application are hereby incorporated by reference in their entirety as part of this application. Technical Field

[0002] The present invention relates to the technical field of microbial detection, and particularly to a single-drop liquid-solid triboelectric nanogenerator and a method for detecting bacteria using the same. Background Art

[0003] A triboelectric nanogenerator (TENG) refers to an energy harvesting device based on the principles of contact electrification and electrostatic induction, which is used to convert mechanical energy into electrical energy. Subsequently, with further research, various types of TENGs have been discovered, including solid-solid TENG, liquid-solid TENG, liquid-liquid TENG, solid-gas TENG, and liquid-gas TENG. Among them, the single-droplet generator (SDEG) has received extensive attention because it can convert conventional interfacial effects into bulk effects and has a higher instantaneous power density than other solid-liquid TENGs. The principle is that a water droplet falling from a height first spreads onto a hydrophobic PTFE surface and then contracts until it completely separates. When the water droplet contacts the electrode on the PTFE surface, the potential difference between the electrode and the PTFE causes the positive and negative ions in the water to flow directionally, generating an electric current. Factors affecting the output performance of liquid-solid TENGs include friction materials, hydrophilicity / hydrophobicity, smoothness, chemical properties of the liquid, environmental temperature and humidity during operation, etc. Due to the advantages of simplicity, low cost, good stability, and high sensitivity of liquid-solid TENGs, they have become candidates for the development of sensors such as physical sensors, chemical sensors, and biomedical sensors. For example, liquid-solid TENGs can also be used in sweat sensors. Since the main components of sweat are water and NaCl, an increase in the NaCl concentration leads to a decrease in the sensor output, and this trend is used as a reference for detecting sweat concentration. By installing a tubular droplet counter on an intravenous infusion tube and integrating it with an intelligent intravenous infusion monitor, a real-time infusion monitoring system capable of monitoring a patient's infusion operation has been achieved.

[0004] Patent CN202111412341.6 discloses a sensing system and method for bacterial detection driven by a triboelectric nanogenerator. Its overall structure includes a triboelectric nanogenerator, a resistive biosensor, a variable resistor, and an LED lamp. The resistive biosensor is made of etched ITO conductive glass, and its surface needs to be successively modified with 3-aminopropyltriethoxysilane, glutaraldehyde, and a biorecognition material to specifically recognize and bind to target bacteria (concanavalin can specifically bind to lipopolysaccharide on the cell wall of sulfate-reducing bacteria, so concanavalin can recognize sulfate-reducing bacteria); the bacteria captured by the resistive biosensor adsorb carbon nanotubes. Since carbon nanotubes are conductive, the resistance of the resistive biosensor will decrease.

[0005] However, the above technology has the following disadvantages: 1. The device has too many components and low integration. An additional biosensor needs to be introduced, and its preparation process is complex. 2. Using concanavalin to bind bacteria, concanavalin will bind to any bacteria with lipopolysaccharide in the cell wall, which is not specific and it is difficult to achieve precise bacterial detection in a complex system. 3. Using the bacteria captured by the resistive biosensor to adsorb carbon nanotubes to control the change of resistance has high cost and poor stability. Summary of the Invention

[0006] To solve the above existing problems, the present invention discloses a single-drop liquid-solid triboelectric nanogenerator and its method for detecting bacteria, constructs a new type of single-drop liquid-solid triboelectric nanogenerator. When the single-drop liquid-solid triboelectric nanogenerator is used as a sensor for detection, it does not require complex operations, and the obtained electrical data can accurately reflect the change of the device. The change of the bacterial concentration is reflected by the change of the electrical data, so as to achieve the purpose of detecting the bacterial concentration.

[0007] On the one hand, the present invention provides a single-drop liquid-solid triboelectric nanogenerator, including a first electrode, a dielectric layer, and a second electrode. The dielectric layer is disposed between the first electrode and the second electrode. The first electrode includes a thiol-modified nucleic acid aptamer, gold nanoparticles, and an electrode sheet. The gold nanoparticles are disposed on the surface of the electrode sheet, and the thiol-modified nucleic acid aptamer is connected to the gold nanoparticles.

[0008] Further, the materials of the electrode sheet and the second electrode are selected from any one of metal materials, carbon materials, metal oxides, ceramic materials, composite materials, and organic materials.

[0009] The metal electrode materials include platinum, palladium, silver, copper, etc. The carbon materials include graphite, carbon nanotubes, diamond films, etc. The metal oxide materials include tin oxides, cobalt oxides, nickel oxides, etc. The ceramic materials include carbides (such as TiC, ZrC), borides (such as TiB2), and nitrides (such as TiN), etc. The composite materials are composed of two or more materials, such as metal oxide / carbon composite materials, metal / carbon composite materials, etc. The organic materials are based on organic polymers, such as polyaniline, polythiophene, etc. The electrode materials mainly affect the conductivity of the electrodes, and thus affect the detection performance of the single-drop liquid-solid triboelectric nanogenerator.

[0010] Preferably, the material of the electrode sheet is copper.

[0011] Furthermore, the dielectric layer is any one of plastic films, polyester films, and fluoroplastic films.

[0012] Preferably, the dielectric layer is an FEP film, and FEP is fluorinated ethylene propylene copolymer.

[0013] Furthermore, the thiol modification of the thiol-modified nucleic acid aptamer is at the 5'-end or 3'-end or intermediate nucleotides.

[0014] The way of connecting the nucleic acid aptamer with the gold nanoparticles is to modify a thiol group on the nucleic acid aptamer. Coordination can occur between the thiol group and the gold nanoparticles to generate an Au-S bond. Based on the above principle, it can be understood that the thiol groups modified at any position in the nucleic acid molecule can serve as ligands.

[0015] Preferably, the thiol modification of the thiol-modified nucleic acid aptamer is at the 5'-end.

[0016] In some ways, the nucleic acid aptamer has a nucleotide sequence as shown in Seq ID NO.1.

[0017] On the other hand, the present invention provides a single-drop liquid-solid triboelectric nanogenerator. The single-drop liquid-solid triboelectric nanogenerator includes a first electrode, a dielectric layer, and a second electrode. The dielectric layer is disposed between the first electrode and the second electrode. The first electrode includes a thiol-modified nucleic acid aptamer, gold nanoparticles, and an electrode sheet. The gold nanoparticles are disposed on the surface of the electrode sheet, and the thiol-modified nucleic acid aptamer is connected to the gold nanoparticles; the nucleic acid aptamer is further modified with an azide group.

[0018] The present invention unexpectedly discovers that for the further group modification of the nucleic acid aptamer, although most modifications have no obvious impact on its detection, and even have negative impacts, the modification of the azide group is beneficial to the improvement of linearity when it is used for detection. This is related to specific bacteria to be detected, nucleic acid aptamer sequences, etc., and has a significant effect on improving the linearity of the detection of Escherichia coli O157:H7 based on the nucleotide sequence shown in Seq ID NO.1. The reason may be that it amplifies and stabilizes the interfacial effect. It can be understood that based on the principle of the interfacial effect, the modification of the azide group at any position on the nucleic acid aptamer has a similar effect on improving linearity.

[0019] Preferably, the 5'-end of the nucleic acid aptamer is modified with a thiol group, the 3'-end of the nucleic acid aptamer is modified with an azide group, and the nucleic acid aptamer has the nucleotide sequence shown in Seq ID NO.1.

[0020] The nucleotide sequence shown in Seq ID NO.1 is a nucleic acid aptamer sequence that specifically binds to Escherichia coli O157:H7. Escherichia coli O157:H7 is one of the most dangerous foodborne pathogens because it can cause severe diseases such as inflammation, abdominal pain, diarrhea, hemolytic uremic syndrome, hemorrhagic colitis, and even death, especially in the young, the elderly, and the immunocompromised.

[0021] On the other hand, the present invention provides a method for detecting bacteria using a single-drop liquid-solid triboelectric nanogenerator. The single-drop liquid-solid triboelectric nanogenerator includes a first electrode, a dielectric layer, and a second electrode. The dielectric layer is disposed between the first electrode and the second electrode. The first electrode includes a thiol-modified nucleic acid aptamer, gold nanoparticles, and an electrode sheet. The gold nanoparticles are disposed on the surface of the electrode sheet, and the thiol-modified nucleic acid aptamer is connected to the gold nanoparticles. The nucleic acid aptamer is a nucleic acid that specifically binds to the bacteria. The method includes: dropping a solution containing the bacteria to be detected onto the surface of the first electrode, connecting the two ends of an electrometer to the first electrode and the second electrode respectively, and measuring the static voltage between the first electrode and the second electrode.

[0022] The present invention successfully detects bacteria using a single-drop liquid-solid triboelectric nanogenerator because a novel structure is constructed. The principle is described in combination with the structure as follows: When a solution containing the colony to be detected is dropped onto the surface of the first electrode, the bacterial solution diffuses on the surface of the first electrode. The nucleic acid aptamer conjugated with gold nanoparticles specifically binds to its corresponding bacteria to be detected, resulting in a decrease in the work function of the sensing surface of the first electrode, reducing the surface potential barrier, providing the key physical phenomenon responsible for the sensing performance, and the reduced work function can also achieve a higher output voltage. When the droplet is not in contact with the first electrode, the electrons of the corresponding material are located in the potential well. In this case, the surface barrier prevents the electrons from transferring to the adjacent medium. However, once a mechanical force is applied to make the materials contact, the electron clouds of various materials will strongly overlap, causing electrons to transfer from high energy states to low energy states. Since the binding of bacteria to the nucleotide aptamer modified with gold nanoparticles reduces the work function, the electron transfer from the bacterial solution to the conjugate of bacteria and the nucleotide aptamer modified with gold nanoparticles increases with the increase in the bacterial concentration. And there is a good linear relationship between the static voltage and the number of bacteria to be detected.

[0023] The detection of colonies in the present invention includes the following meanings: 1. Qualitatively detect whether the solution contains the bacteria to be detected, for example, detect whether a certain pathogenic bacterium exists in a biological sample; 2. Quantitatively detect the number of bacteria to be detected in the solution, for example, detect whether the number of a certain bacterium in sewage meets the discharge standard.

[0024] Preferably, the method further includes: setting the angle between the electrode sheet and the ground to 15 - 75°.

[0025] Conventional biosensors are often randomly placed for detection, while the present invention finds that tilting the electrode sheet of the present invention is beneficial to improving the sensitivity. This is because a certain tilting angle can improve the dispersion of the droplet on the surface of the electrode sheet. Through experiments, the preferred tilting angle is 15° - 75°, and more preferably 30° (the angle with the ground).

[0026] Preferably, the method further includes: placing the solution containing the bacteria to be detected 5 - 15 cm above the first electrode.

[0027] Similarly, the present invention finds that the height at which the droplet drops also has a certain influence on the sensitivity. The principle is also the dispersion of the droplet on the surface of the electrode sheet. Through experiments, the preferred height is 5 - 15 cm, and more preferably 10 cm, with higher stability and accuracy.

[0028] Preferably, the solution containing the bacteria to be detected contains Escherichia coli O157:H7, and the nucleic acid aptamer has the nucleotide sequence shown in Seq ID NO.1.

[0029] On the other hand, the present invention provides a preparation method of a single-drop liquid-solid triboelectric nanogenerator, including the steps: S1, prepare the first electrode, Perform thiol modification on the nucleic acid aptamer, grow gold nanoparticles on the electrode sheet, and connect the thiol-modified nucleic acid aptamer with the gold nanoparticles to obtain the first electrode; S2, sequentially assemble the first electrode, the dielectric layer and the second electrode; The materials of the electrode sheet and the second electrode are selected from any one of metal materials, carbon materials, metal oxides, ceramic materials, composite materials and organic materials; the dielectric layer is any one of plastic film, polyester film and fluoroplastic film.

[0030] Preferably, the step S1 includes: synthesizing the nucleic acid aptamer according to the nucleotide sequence shown in Seq ID NO.1, and modifying the thiol at the 5' end; respectively preparing solution A containing chloroauric acid and solution B containing trisodium citrate and tannic acid, heating solution A and B to 65°C, slowly adding solution A to solution B, stirring and heating to 95°C, cooling to room temperature, filtering the solution and storing it at 4°C to obtain the gold nanoparticle solution; the thiol-modified nucleic acid aptamer is mixed with freshly prepared TCEP and acetate buffer at room temperature and activated for 1 hour, and this solvent is added to the gold nanoparticle solution and incubated in a drawer at room temperature for at least 16 hours.

[0031] On the other hand, the present invention provides an application of a single-drop liquid-solid triboelectric nanogenerator, and the application of the single-drop liquid-solid triboelectric nanogenerator includes one or more of the following: detection of bacteria in sewage; detection of bacteria in biological samples; detection of bacteria in food; detection of bacteria in scientific research.

[0032] On the other hand, the present invention provides a use of a modified nucleic acid aptamer for preparing a single-drop liquid-solid triboelectric nanogenerator for detecting colonies. The modified nucleic acid aptamer includes thiol modification and azide group modification. The single-drop liquid-solid triboelectric nanogenerator includes a first electrode, a dielectric layer and a second electrode. The dielectric layer is disposed between the first electrode and the second electrode. The first electrode includes the nucleic acid aptamer, gold nanoparticles and an electrode sheet. The gold nanoparticles are disposed on the surface of the electrode sheet, and the nucleic acid aptamer is connected to the gold nanoparticles.

[0033] In summary, the present invention includes at least one of the following beneficial technical effects: 1. The present invention discloses a single-drop liquid-solid triboelectric nanogenerator and a method for detecting bacteria, constructs a novel single-drop liquid-solid triboelectric nanogenerator. When the single-drop liquid-solid triboelectric nanogenerator is used as a sensor for detection, it does not require complex operations, and the obtained electrical data can accurately reflect the changes of the device. The change of the bacterial concentration is reflected by the change of the electrical data, so as to achieve the purpose of detecting the bacterial concentration; 2. The single-drop liquid-solid triboelectric nanogenerator of the present invention uses aptamers, which have a high degree of specificity in binding to bacteria, thus specifically detecting the bacteria to be tested with high accuracy. At the same time, the appropriate aptamer can be flexibly selected according to the bacteria to be tested, and it has a wide range of application prospects. 3. The present invention finds that different electrode materials and dielectric layer materials will also have a certain impact on the detection. Through a large number of experiments, the materials with the best sensitivity and linearity are found. 4. The R & D team finds that the device of the present invention is different from some existing biosensors. Its detection sensitivity and accuracy are related to the tilt degree and liquid drop height of the device. Through experiments, the appropriate detection method is found. 5. The present invention unexpectedly finds that the modification of azide groups on aptamers can improve the detection linearity of the overall device, while the modification of other groups that may increase the connection between nucleic acid molecules has no effect or a negative effect. This is related to aptamers, bacteria to be tested, etc. Using this discovery, the detection linearity is improved and the detection accuracy is increased. Description of the Drawings

[0034] Figure 1 : Schematic structural diagram of the single-drop liquid-solid triboelectric nanogenerator; Figure 2 : Side view of the single-drop liquid-solid triboelectric nanogenerator; Figure 3 : Device diagram of the single-drop liquid-solid triboelectric nanogenerator for detecting bacterial solution; among them, from left to right in the figure are a computer, an electrometer, a single-drop liquid-solid triboelectric nanogenerator, and an injection pump. The data collected by the electrometer is sent to the computer for calculation and analysis. The two electrodes of the electrometer are respectively connected to the first electrode and the second electrode of the single-drop liquid-solid triboelectric nanogenerator. The injection pump contains the bacterial solution to be tested, and the liquid outlet is directly above the first electrode of the single-drop liquid-solid triboelectric nanogenerator; Figure 4 : 10 6 、10 5 、10 4 、10 3 、10 2 CFU / mL of Escherichia coli O157:H7 bacterial solution plate coating result diagram; Figure 5 : Result diagram of the single-drop liquid-solid triboelectric nanogenerator for detecting bacterial solution; Figure 6 : Standard curve of the single-drop liquid-solid triboelectric nanogenerator for detecting bacterial solution; Figure 7 : Result diagram of the single-drop liquid-solid triboelectric nanogenerator for detecting bacterial solution at different tilt angles; Figure 8:Results of detecting bacterial liquid with a single-drop liquid-solid triboelectric nanogenerator at different droplet dropping heights; Figure 9 :Results of detecting bacterial liquid with a single-drop liquid-solid triboelectric nanogenerator modified with an azide group at the 3'-end of the aptamer; Figure 10 :Standard curve of detecting bacterial liquid with a single-drop liquid-solid triboelectric nanogenerator modified with an azide group at the 3'-end of the aptamer; Figure 11 :Results of detecting bacterial liquid with a single-drop liquid-solid triboelectric nanogenerator modified with an amino group at the 3'-end of the aptamer; Figure 12 :Standard curve of detecting bacterial liquid with a single-drop liquid-solid triboelectric nanogenerator modified with an amino group at the 3'-end of the aptamer. Detailed implementation manners

[0035] The present invention will be further elaborated in detail below in conjunction with the accompanying drawings of the specification and specific embodiments. The embodiments are only used to explain the present invention and are not used to limit the scope of the present invention. The materials, reagents, etc. used in the following embodiments are commercially available reagents and materials unless otherwise specified. Example 1: Preparation of a single-drop liquid-solid triboelectric nanogenerator

[0036] The structural schematic diagram of the single-drop liquid-solid triboelectric nanogenerator is as shown in Figure 1 shown, and the side view is as shown in Figure 2 shown. The single-drop liquid-solid triboelectric nanogenerator is divided into 4 layers, namely a modified copper sheet, an FEP film, a copper sheet, and a PMMA substrate. The functions of the 4 layers are as follows: Modified copper sheet: Combine with Escherichia coli in the solution and collect charges Copper sheet: Collect charges FEP film: Used to generate electrostatic induction PMMA board: Used as a substrate for the support layer The preparation method is as follows: 1. Preparation of the modified copper sheet The growth of Au NPs is carried out on a high-purity copper sheet, and this growth is based on the spontaneous redox reaction between Au ions and Cu atoms. Before the redox reaction, the copper sheet is cleaned successively with acetone, isopropanol, and deionized water to remove surface impurities. The copper sheet is immersed in 1 mM HAuCl 4 for 30 minutes at 37 °C to enable the complete growth of Au NPs on the surface. After the redox reaction, the reacted copper sheet is rinsed 3 times with deionized water to remove by-products and loosely bound Au NPs. Finally, the Au NPs-coated copper sheet is dried and stored under vacuum conditions.

[0037] Prepare an aptamer for Escherichia coli O157:H7. The nucleotide sequence of the aptamer is shown in Seq ID NO.1. Entrust a gene synthesis company to synthesize the sequence of Seq ID NO.1 and modify the thiol group at the 5' end. After sequence identification and verification, the aptamer of Escherichia coli O157:H7 with a thiol group modified at the 5' end is obtained.

[0038] First, 3 μL of 1 mM 5'-thiol aptamer is mixed with 0.5 μL of freshly prepared 10 mmol of TCEP and 0.5 μL of 500 mmol of acetate buffer (pH 5.2) at room temperature and activated for 1 hour. Then, a copper sheet bound with Au NPs is added to the solution. The mixture is incubated in a drawer at room temperature for at least 16 hours. Next, to maximize the loading of the aptamer on the surface of the gold nanoparticles, 30 μL of 500 mmol of Tris acetate buffer (pH 8.2) and 300 μL of 1 mol of NaCl are added dropwise, and then stored in a drawer at room temperature for at least 24 hours.

[0039] 2. Preparation of other layers and overall assembly Use a laser cutter to cut PMMA sheets according to the required dimensions as the substrate; cut copper sheets and FEP films of the required dimensions; carefully paste the copper sheet on the PMMA substrate on the substrate, use conductive double-sided tape to paste the FEP film on the copper electrode, then paste the modified copper sheet on the FEP film, and finally wash the FEP film with ethanol to remove the residual adhesive. A single-drop liquid-solid triboelectric nanogenerator is obtained.

[0040] According to the above preparation process, the core structure of the single-drop liquid-solid triboelectric nanogenerator of the present invention lies in the modified copper sheet (the first electrode), the FEP film (the dielectric layer), and the copper sheet (the second electrode). The PMMA plate is used as the substrate of the support layer and can be replaced by any other support structure. Example 2: Detect the number of E. coli O157:H7 bacteria using a single-drop liquid-solid triboelectric nanogenerator

[0041] Use a Keithley 6514 electrometer, connect its two ports to the copper sheet and the modified copper sheet respectively to measure and read the static voltage between the copper sheet and the modified copper sheet. Stand the single-drop liquid-solid triboelectric nanogenerator (hereinafter referred to as the device) at an angle of 30° with the ground and support it stably. Fix a bracket and an injection pump above the device, and the outlet below the injection pump is aligned with the modified copper sheet. The specific device setup is as Figure 3 shown. The distance between the outlet below the injection pump and the vertical falling point of the liquid droplet on the modified copper sheet is 10 cm. Prepare an E. coli O157:H7 bacterial solution and dilute it to 10 6 、10 5 、 10 4, 10 3 , 10 2 CFU / mL, 10 6 , 10 5 , 10 4 , 10 3 , 10 2 The results of spreading the Escherichia coli O157:H7 bacterial solution with concentrations of 10 3 , 10 2 , 10 CFU / mL, 10 6 , 10 5 , 10 4 , 10 3 , 10 2 on the plate are shown respectively as Figure 4 shown.

[0042] Open the syringe pump to let the Escherichia coli O157:H7 bacterial solution drip naturally, record the readings of the Keithley 6514 electrometer. Repeat the dripping and reading 6 times each time, then clean with ethanol and dry with nitrogen, and then proceed with the next group. The results of the static voltage test are shown as Figure 5 shown. Draw the standard curve of the static voltage versus the bacterial solution concentration. The results are shown as Figure 6 shown. The standard curve equation is y = 1.03106x - 18.70308, R 2 = 0.9566. Repeat three times, and the results are all similar to the above results. Therefore, the linearity is good. If the bacterial solution to be tested is dripped onto the device in the same way, the voltage detected can be substituted into the standard curve to obtain the number of Escherichia coli O157:H7 in the bacterial solution. Example 3: Component screening test of single-drop liquid-solid triboelectric nanogenerator

[0043] In this example, different materials are used to construct the single-drop liquid-solid triboelectric nanogenerator to explore the influence of the material selection of different components on its performance of detecting colonies. It is constructed according to the following materials: Device 1, the electrode plates are all made of carbon nanotubes, that is, the copper plates in Example 1 are all changed to carbon nanotube plates, and the others are the same as in Example 1; Device 2, the dielectric layer is made of polyethylene terephthalate (PET), that is, the FEP film in Example 1 is changed to a PTFE film, and the others are the same as in Example 1; Detect according to the method of Example 2 and draw the standard curve. The R 2 of Device 1 is 0.92642, and the R 2 of Device 2 is 0.93115. The linearity is significantly worse than that of the single-drop liquid-solid triboelectric nanogenerator in Example 1.

[0044] The reason may be that the compatibility between carbon nanotubes and gold nanoparticles is poor. Further experiments show that the results of most other non-metal electrode materials are similar to those of carbon nanotubes, and the metal electrode materials are better. The best one is copper, and the reason may be that copper and gold belong to the same group of elements; the material of the dielectric layer also has a certain influence on the detection linearity. The reason may be that there are differences in the friction coefficient between different materials and the copper electrode. The best one is the FEP film. Example 4: Exploring the Influence of Different Drop Heights of Liquid Drops on the Electrical Signal Output

[0045] Prepare the device according to the method of Example 1, stipulate that the inclination angle of the device relative to the ground is 30°, prepare the Escherichia coli bacterial solution, dilute it to 10 5 (CFU / mL), and finally assemble the device, electrometer, and syringe pump to detect and collect the electrical signal data. Change the drop heights of the liquid drops to 5, 7.5, 10, 12.5, 15 (cm) respectively, and record the electrometer readings according to the method of Example 2. The results are as Figure 7 shown.

[0046] The results show that the optimal drop height of the liquid drop is 10 cm. At this time, the voltage reading is larger, and higher sensitivity can be achieved. In addition, compared with the drop height of 12.5 cm, the voltage values of repeated drops are more stable, and higher accuracy can be achieved.

[0047] From the perspective of principle analysis, the drop height of the liquid drop affects the contact mode between the bacterial solution and the modified copper sheet, especially affects the diffusion rate of the bacterial colonies, thereby affecting the voltage value. Example 5: Exploring the Influence of Different Drop Angles of Liquid Drops on the Electrical Signal Output

[0048] Prepare the device according to the method of Example 1, stipulate that the drop height of the liquid drop is 10 cm, prepare the Escherichia coli bacterial solution, dilute it to 10 5 (CFU / mL), and finally assemble the device, electrometer, and syringe pump to detect and collect the electrical signal data. Change the inclination angles of the device relative to the ground to 15°, 30°, 45°, 60°, 75° respectively, and record the electrometer readings according to the method of Example 2. The results are as Figure 8 shown.

[0049] The results show that the optimal inclination angle of the device is 30°. At this time, the voltage reading is larger, and higher sensitivity can be achieved.

[0050] From the perspective of principle analysis, the inclination angle of the device relative to the ground affects the contact mode between the bacterial solution and the modified copper sheet, especially affects the diffusion rate of the bacterial liquid drop, thereby affecting the voltage value. Example 6: Preparation of an Optimized Single-Drop Liquid-Solid Triboelectric Nanogenerator and Bacterial Detection

[0051] To further improve the detection performance of the single-drop liquid-solid triboelectric nanogenerator in Example 1, the present invention makes a series of adjustments to the modified copper sheet. First, it is clear that when no modification is carried out, only weak static voltage can be detected. Therefore, the optimization mainly focuses on the optimization of gold nanoparticles and aptamers.

[0052] For aptamers, the present invention unexpectedly discovers that modifying other groups on aptamers will have a certain impact on detection. The principle is mainly that after different groups bind to gold nanoparticles, the work function of the sensing surface of the first electrode will change differently, altering the surface potential barrier. And its specific impact is related to the aptamer, the type of bacteria specifically binding to the aptamer, the modification site, and the type of group. Therefore, a large number of experiments are conducted in this embodiment to test different modifications. Among them, two cases are relatively obvious, namely the modification of an azide group at the 3'-end and the modification of an amino group at the 3'-end. The modification of an azide group at the 3'-end and the modification of an amino group at the 3'-end are carried out according to the method of CN201910586273.1.

[0053] Detection is carried out in the manner of Example 2. The detection results of the modification of an azide group at the 3'-end are as Figure 9 shown. The standard curve is plotted as Figure 10 shown. The standard curve equation is y = 1.12841x - 18.93905, and R 2 = 0.97508. Repeated three times, the results are all similar to the above results. It can be seen that its linearity is significantly improved compared to Example 1.

[0054] Detection is carried out in the manner of Example 2. The detection results of the modification of an amino group at the 3'-end are as Figure 11 shown. The standard curve is plotted as Figure 12 shown. The standard curve equation is y = 0.89832x - 18.27885, and R 2 = 0.92352. Repeated three times, the results are all similar to the above results. It can be seen that its linearity shows a significant decline compared to Example 1.

[0055] For the modification of other groups, the present invention also conducts certain tests and does not find any obvious impact on linearity. In summary, the modification of an azide group at the 3'-end of the aptamer is beneficial to the improvement of detection linearity. It can be understood that based on the principle of the interface effect, the modification of an azide group at any position of the aptamer has a similar effect.

[0056] The above is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any equivalent modifications or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention. Sequence Listing

[0057] Seq ID NO.1 ATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT

Claims

1. A single droplet liquid-solid friction nanogenerator, characterized in that: The invention comprises a first electrode, a dielectric layer and a second electrode, wherein the dielectric layer is arranged between the first electrode and the second electrode, the first electrode comprises a thiol-modified nucleic acid aptamer, gold nanoparticles and an electrode sheet, the gold nanoparticles are arranged on the surface of the electrode sheet, and the thiol-modified nucleic acid aptamer is connected to the gold nanoparticles.

2. The single-droplet liquid-solid friction nanogenerator according to claim 1, characterized in that: The materials of the electrode sheet and the second electrode are selected from any one of metal materials, carbon materials, metal oxides, ceramic materials, composite materials and organic materials.

3. The single-drop liquid-solid friction nanogenerator according to claim 1, characterized in that: The dielectric layer is any one of a plastic film, a polyester film and a fluoroplastic film.

4. The single-drop liquid-solid friction nanogenerator according to claim 1, characterized in that: The thiol group of the thiol-modified nucleic acid aptamer is modified at the 5' end or the 3' end or the middle nucleotide.

5. A method for detecting bacteria using a single droplet liquid-solid friction nanogenerator, characterized in that: The single-drop liquid-solid friction nanogenerator comprises a first electrode, a dielectric layer and a second electrode, wherein the dielectric layer is disposed between the first electrode and the second electrode, the first electrode comprises a thiol-modified nucleic acid aptamer, gold nanoparticles and an electrode sheet, the gold nanoparticles are disposed on the surface of the electrode sheet, and the thiol-modified nucleic acid aptamer is connected to the gold nanoparticles; The nucleic acid aptamer is a nucleic acid that specifically binds to the bacteria; the method comprises: dropping a solution containing the bacteria to be tested onto the surface of a first electrode, connecting the first electrode to a second electrode at both ends of an electrometer, and measuring the static voltage between the first electrode and the second electrode.

6. The method for detecting bacteria using a single droplet liquid-solid friction nanogenerator as claimed in claim 5, characterized in that: The method further includes: setting the angle between the electrode sheet and the ground to 15°-75°.

7. The method for detecting bacteria using a single droplet liquid-solid friction nanogenerator as claimed in claim 5, characterized in that: The method further comprises: placing a solution containing the bacteria to be detected 5-15 cm above the first electrode.

8. The method for detecting bacteria using a single droplet liquid-solid friction nanogenerator as claimed in claim 5, characterized in that: The solution containing the bacteria to be tested contains Escherichia coli O157:H7, and the nucleic acid aptamer has a nucleotide sequence as shown in Seq ID NO.

1.

9. A method for preparing a single droplet liquid-solid friction nanogenerator, characterized in that: Includes steps: S1, preparing the first electrode, The aptamer is modified with thiol groups, gold nanoparticles are grown on the electrode sheet, and the aptamer modified with thiol groups is connected with the gold nanoparticles to obtain a first electrode; S2, assembling a first electrode, a dielectric layer, and a second electrode in sequence; The materials of the electrode sheet and the second electrode are selected from any one of metal materials, carbon materials, metal oxides, ceramic materials, composite materials and organic materials; the dielectric layer is any one of plastic film, polyester film and fluoroplastic film.

10. The method for preparing a single-drop liquid-solid friction nanogenerator according to claim 9, characterized in that: The step S1 comprises: synthesizing a nucleic acid aptamer according to the nucleotide sequence shown in Seq ID NO.1, and modifying the thiol group at the 5' end; respectively preparing a solution A containing chloroauric acid and a solution B containing trisodium citrate and tannic acid, heating the solutions A and B to 65° C., slowly adding the solution A to the solution B, stirring and heating to 95° C., cooling to room temperature, filtering the solution and storing it at 4° C. to obtain a gold nanoparticle solution; mixing the thiol-modified nucleic acid aptamer with freshly prepared TCEP and acetate buffer for activation at room temperature for 1 hour, adding the solvent to the gold nanoparticle solution, and incubating in a drawer at room temperature for at least 16 hours.

Images