Recombinant microorganism capable of producing 1, 6-hexanediol through fermentation as well as construction method and application of recombinant microorganism

Abstract

The invention relates to the technical field of genetic engineering and biological fermentation, and particularly discloses a recombinant microorganism capable of producing 1, 6-hexanediol through fermentation as well as a construction method and application of the recombinant microorganism. Compared with an original strain, the recombinant microorganism disclosed by the invention expresses adipic acid transporters DcaK and DcaP, acyl CoA transferases DcaI and DcaJ, an aldehyde dehydrogenase variant bldL273T, a carboxylic acid reductase CAR variant and a CAR activating enzyme sfp; the amino acid sequence of the carboxylic acid reductase CAR variant is as shown in SEQ ID NO. 6. The invention provides a new method for efficiently converting adipic acid into 1, 6-hexanediol through fermentation by using recombinant microorganisms, the method has the advantages of low production cost and capability of being directly operated under normal temperature and pressure conditions, and a new method is provided for green biosynthesis of 1, 6-hexanediol.

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and biological fermentation. Specifically, it relates to a recombinant microorganism capable of fermentatively producing 1,6 - hexanediol, and a construction method and application thereof. Background Art

[0002] 1,6 - Hexanediol is an important compound, widely used in multiple industrial fields such as polyurethanes, polyesters, coatings, adhesives, and cosmetics, and can significantly improve the toughness, durability, adhesion, and anti - aging properties of materials. At the same time, it also serves as a key chemical group in the synthesis of pharmaceuticals and fine chemicals. Traditionally, 1,6 - hexanediol is mainly produced through petrochemical routes, for example, using adipic acid esters as raw materials and preparing it through hydrogenation or high - temperature catalytic reactions. However, this process highly depends on non - renewable resources, has high energy consumption, and requires harsh conditions during the reaction process, imposing a certain burden on the environment. In contrast, the biological production of 1,6 - hexanediol uses renewable resources (such as sugars or biomass) as raw materials and utilizes microorganisms or enzymes to catalyze the production process, having the significant advantages of being green, mild conditions, and potential economic viability. However, due to the lack of natural biosynthetic pathways, the current biological production of 1,6 - hexanediol still faces many challenges and is difficult to achieve efficient biological conversion. Summary of the Invention

[0003] One of the objectives of the present invention is to provide a new recombinant microorganism for efficiently producing 1,6 - hexanediol.

[0004] The present invention provides a recombinant microorganism, which, compared with the starting strain, expresses adipic acid transporters DcaK and DcaP, acyl - CoA transferases DcaI and DcaJ, aldehyde dehydrogenase variant bld L273T , carboxylic acid reductase CAR variant, and CAR - activating enzyme sfp; the amino acid sequence of the carboxylic acid reductase CAR variant is as shown in SEQ ID NO.22.

[0005] 1,6 - Hexanediol is an important C6 platform chemical with wide industrial application value. However, there is no organism in nature that can directly synthesize 1,6 - hexanediol. The present invention constructs a new artificial biosynthetic pathway for synthesizing 1,6 - hexanediol from adipic acid and screens out the key enzymes capable of efficiently catalyzing this pathway. By recombining this artificial synthetic pathway in microorganisms, a recombinant strain capable of efficiently utilizing adipic acid to produce 1,6 - hexanediol has been successfully developed, demonstrating its great potential and application prospects in industrial production.

[0006] Specifically, the new pathway for synthesizing 1,6 - hexanediol from adipic acid proposed by the present invention utilizes an acyl - CoA - dependent pathway to effectively produce adipic acid semialdehyde, which is then converted into hexanediol. The schematic diagram of the metabolic process is asFigure 1 As shown, adipic acid is converted into adipyl-CoA under the action of adipic acid transporters DcaK, DcaP and acyl-CoA transferases DcaI, DcaJ, and then is converted into adipic acid semialdehyde through aldehyde dehydrogenase variant bld L273T and then is converted into 6-hydroxyhexanoic acid through the endogenous alcohol dehydrogenase of Escherichia coli. 6-Hydroxyhexanoic acid is converted into 6-hydroxyhexanal through carboxylic acid reductase CAR variant, and then is converted into 1,6-hexanediol through the endogenous alcohol dehydrogenase of Escherichia coli.

[0007] In the recombinant microorganism of the present invention, the NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and the NCBI accession number of DcaP is WP_004926597.1; the NCBI accession number of the acyl-CoA transferase DcaI is WP_004926591.1, and the NCBI accession number of DcaJ is WP_004926593.1; the amino acid sequence of the aldehyde dehydrogenase variant bld L273T is shown in SEQ ID NO.23; the NCBI accession number of the CAR activating enzyme sfp is WP_003234549.1.

[0008] In the recombinant microorganism of the present invention, the coding nucleic acid sequences of the adipic acid transporters DcaK and DcaP are shown in SEQ ID NO.1-2 respectively; the coding nucleic acid sequences of the acyl-CoA transferases DcaI and DcaJ are shown in SEQ ID NO.3-4 respectively; the coding nucleic acid sequence of the aldehyde dehydrogenase variant bld L273T is shown in SEQ ID NO.5; the coding nucleic acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.6; the coding nucleic acid sequence of the CAR activating enzyme sfp is shown in SEQ IDNO.7.

[0009] In the recombinant microorganism of the present invention, the starting strain is Escherichia coli.

[0010] The present invention also provides the application of the above-mentioned recombinant microorganism in the fermentation production of 1,6-hexanediol, in the microbial genetic breeding for the production of 1,6-hexanediol, and in improving the yield of biochemically synthesized 1,6-hexanediol.

[0011] The present invention also provides a method for fermenting and producing 1,6-hexanediol, which includes the step of culturing the above-mentioned recombinant microorganism.

[0012] As a specific embodiment, when the present invention ferments and produces 1,6-hexanediol, the above-mentioned recombinant microorganism is first inoculated into a fermentation medium (the carbon source is glucose) for culture, IPTG is added for induction when the cell OD reaches 0.6, and then fermentation is continued to achieve the production of 1,6-hexanediol.

[0013] The present invention also provides a method for constructing a recombinant microorganism for producing 1,6 - hexanediol, which includes the steps of making a starting strain express adipic acid transporters DcaK and DcaP, acyl - CoA transferases DcaI and DcaJ, aldehyde dehydrogenase variant bld L273T , carboxylic acid reductase CAR variant, and CAR - activating enzyme sfp; the amino acid sequence of the carboxylic acid reductase CAR variant is as shown in SEQ ID NO.22.

[0014] In the method of the present invention, the NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and that of DcaP is WP_004926597.1; the NCBI accession number of the acyl - CoA transferase DcaI is WP_004926591.1, and that of DcaJ is WP_004926593.1; the amino acid sequence of the aldehyde dehydrogenase variant bld L273T is as shown in SEQ ID NO.23; the NCBI accession number of the CAR - activating enzyme sfp is WP_003234549.1; the starting strain is Escherichia coli.

[0015] The beneficial effects of the present invention are at least as follows: The present invention provides a recombinant microorganism that can efficiently convert adipic acid into 1,6 - hexanediol, and further provides a new method for synthesizing 1,6 - hexanediol. Compared with traditional chemical processes, this method uses adipic acid as a raw material, avoids high - temperature and high - pressure conditions, is simple to operate, green and environmentally friendly, and produces no harmful by - products. The production process is safe, efficient, has significant economic benefits and potential for industrial application, and is particularly suitable for fields such as polymer materials and fine chemicals. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is a schematic diagram of the metabolic process of the recombinant microorganism of the present invention for fermenting adipic acid to produce 1,6 - hexanediol. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0017] The preferred embodiments of the present invention will be described in detail below in conjunction with the examples. It should be understood that the following examples are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0018] The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources or prepared according to conventional methods in the art unless otherwise specified.

[0019] Example 1 Construction of the adipic acid to 6-hydroxyhexanoic acid synthesis module An optimized gene nucleic acid sequence was artificially designed based on the amino acid sequence of adipic acid transporter DcaK from Acinetobacter baylyi (NCBI accession number ENV54224.1) (the gene sequence is shown in SEQ ID NO.1). Using this gene fragment as a template, primers DcaK-F (TTTAACTTTAATAAGGAGATATACCATGCATATCCTTTCGGAAGATATTGATATGACG, SEQ ID NO.8) and DcaK-R (GAATCAATTTCTTCATGTATATCTCCTTCTTTTAGTCAGCCTTCTGGGGGTTATACA, SEQ ID NO.9) were used for PCR to obtain a DcaK fragment of approximately 1.3 kb, which was then purified by PCR.

[0020] An optimized gene nucleic acid sequence was artificially designed based on the amino acid sequence of adipic acid transporter DcaP from Acinetobacter baylyi (WP_004926597.1) (the gene sequence is shown in SEQ ID NO.2). Using this gene fragment as a template, primers DcaP-F (GCTGACTAAAAGAAGGAGATATACATGAAGAAATTGATTCTGGCGGTTGC, SEQID NO.10) and DcaP-R (CCGAGCTCGAATTTTAGAACTTGTACATTGAAACAAAGTTGATTCTCGAG, SEQ IDNO.11) were used for PCR to obtain a DcaP fragment of approximately 1.3 kb, which was then purified by PCR.

[0021] An optimized gene nucleic acid sequence was artificially designed based on the amino acid sequence of acyl-CoA transferase DcaI from Acinetobacter baylyi (NCBI accession number WP_004926591.1) (the gene sequence is shown in SEQ ID NO.3). Using this gene fragment as a template, primers DcaI-F (TAAGTATAAGAAGGAGATATACATATGATCAACAAAATTATTAATGACATCGAACCTATACTTAAATCG, SEQ ID NO.12) and DcaI-R (ATTGTCATGTATATCTCCTTCTTTTACTTAATATCCCCTAATCTTACCACGTGTTGA, SEQ ID NO.13) were used for PCR to obtain a DcaI fragment of approximately 0.7 kb, which was then purified by PCR.

[0022] An optimized gene nucleic acid sequence was artificially designed based on the amino acid sequence of acyl-CoA transferase DcaJ from Acinetobacter baylyi (NCBI accession number WP_004926593.1) (the gene sequence is shown as SEQ ID NO.4). Using this gene fragment as a template, PCR was performed with primers DcaJ-F (TAGGGGATATTAAGTAAAAGAAGGAGATATACATGACAATTCAAAAGCGGTCAAGAGAG, SEQ ID NO.14) and DcaJ-R (GCCGATATCCAATTTTAGCGAAGTTGAATAAGGGATGAATATGTGC, SEQ ID NO.15) to obtain a DcaJ fragment of approximately 0.7 kb, which was then purified by PCR.

[0023] Using the Gibson Assembly kit (NEB), the purified DcaK fragment, DcaP fragment, DcaI fragment, and DcaJ fragment were ligated into pRSFDuet-1 in one step (the DcaK and DcaP fragments were linked with RBS (AAGAAGGAGATATAC) after the first T7 promoter, while the DcaI and DcaJ fragments were linked with RBS (AAGAAGGAGATATAC) after the second T7 promoter). The resulting recombinant plasmid was named pRSF-DcaKPIJ.

[0024] Based on the amino acid sequence of aldehyde dehydrogenase variant bld from Clostridium saccharoperbutylacetonicum L273T (SEQ ID NO.23), an optimized gene nucleic acid sequence was artificially designed (the gene sequence is shown as SEQ ID NO.5). Using this gene fragment as a template, PCR was performed with primers bld-F (GTTTAACTTTAATAAGGAGATATACCATGATCAAGGACACCCTGGTTTCG, SEQ ID NO.16) and bld-R (GTGATGATGGTGATGGCTGCTTTAACCGGCTAACACGCAGC, SEQ ID NO.17) to obtain a bld fragment of approximately 1.4 kb, which was then purified by PCR.

[0025] Using the Gibson Assembly kit (NEB), the above-purified bld L273T fragment was ligated into pCDFDuet-1 in one step. The resulting recombinant plasmid was named pCDF-bld.

[0026] The pRSF-DcaKPIJ and pCDF-bld were introduced into Escherichia coli step by step by electroporation, and the recombinant strain was screened on an LB plate containing 100 mg / L spectinomycin and 50 mg / L kanamycin, named E.c / pRSF-DcaKPIJ / pCDF-bld. At the same time, the empty plasmids pRSFDuet-1 and pCDFDuet-1 were also introduced into Escherichia coli to obtain the control strain E.c / pRSF / pCDF.

[0027] The E.c / pRSF-DcaKPIJ / pCDF-bld and the control strain E.c / pRSF / pCDF were inoculated into the fermentation medium for cultivation. The fermentation temperature was 30 °C and the rotation speed was 250 rpm. When the OD of the bacteria reached 0.6, 0.5 mM IPTG was added for induction, and fermentation continued for 48 h.

[0028] The fermentation medium formula (g / L) was as follows: glucose 10, ammonium dihydrogen phosphate ((NH 4 ) 2 HPO 4 ) 4, potassium dihydrogen phosphate (KH 2 PO 4 ) 6.7, magnesium sulfate heptahydrate (MgSO 4 ·7H 2 O) 0.8, yeast extract 2.5, citric acid 0.8, and 5 mL of trace metal solution. The composition of the trace metal solution included (g / L): ferrous sulfate heptahydrate (FeSO 4 ·7H 2 O) 10, calcium chloride dihydrate (CaCl 2 ·2H 2 O) 2, zinc sulfate heptahydrate (ZnSO 4 ·7H 2 O) 2.2, manganese sulfate tetrahydrate (MnSO 4 ·4H 2 O) 0.5, copper sulfate pentahydrate (CuSO 4 ·5H 2 O) 1, ammonium molybdate tetrahydrate ((NH 4 ) 6 Mo 7 O 24 ·4H 2 O) 0.1, and borax (Na 2 B 4 O 7 ·10H 2 O) 0.02, adipic acid 3.

[0029] After 48 hours of fermentation, the products of the strain were detected by high performance liquid chromatography (HPLC). Strain E.c / pRSF-DcaKPIJ / pCDF-bld could produce 0.35 g / L of 6-hydroxyhexanoic acid, while the control strain did not produce 6-hydroxyhexanoic acid. This indicated that the introduced artificial pathway could successfully achieve the conversion of glucose to 6-hydroxyhexanoic acid.

[0030] Example 2 Construction of the adipic acid to 1,6-hexanediol synthesis module An optimized gene nucleic acid sequence was artificially designed according to the amino acid sequence (SEQ ID NO.22) of the carboxylic acid reductase CAR variant of Mycobacteroides abscessus (the gene sequence is shown in SEQ ID NO.6). Using this gene fragment as a template, primers CAR-F (TTTGTTTAACTTTAAGAAGGAGATATACCATGACGGAAACTATTTCCACAGCTG, SEQ ID NO.18) and CAR-R (TTTGTTTAACTTTAAGAAGGAGATATACCATGACGGAAACTATTTCCACAGCTG, SEQ ID NO.19) were used for PCR to obtain a CAR fragment of approximately 3.6 kb and perform PCR purification.

[0031] The activating enzyme gene sfp of the carboxylic acid reductase was artificially synthesized (the NCBI accession number of the amino acid sequence is WP_003234549.1, and the gene sequence is shown in SEQ ID NO.7). Using this gene fragment as a template, primers sfp-F (TTTGTTTAACTTTAAGAAGGAGATATACCATGACGGAAACTATTTCCACAGCTG, SEQ ID NO.20) and sfp-R (CTTAAGCATTATGCGGCCGCTCAAAGTAACTCCTCGTAGGAGACCATC, SEQ ID NO.21) were used for PCR to obtain an sfp fragment of approximately 0.7 kb and perform PCR purification.

[0032] Using the Gibson Assembly kit (NEB), the above purified CAR fragment and sfp fragment were ligated into pETDuet-1 in one step (the CAR and sfp fragments were ligated after the first T7 promoter with RBS (AAGAAGGAGATATAC)), and the obtained recombinant plasmid was named pET-CAR-sfp.

[0033] The pET-CAR-sfp was transformed into E.c / pRSF-DcaKPIJ / pCDF-bld by electroporation, and the recombinant strain was screened on an LB plate containing 100 mg / L ampicillin, 100 mg / L spectinomycin and 50 mg / L kanamycin, and named E.c / pET-CAR-sfp / pRSF-DcaKPIJ / pCDF-bld. At the same time, the empty plasmid pETFDuet-1 was also transformed into E.c / pRSF / pCDF to obtain the control strain E.c / pET / pRSF / pCDF.

[0034] The E.c / pET-CAR-sfp / pRSF-DcaKPIJ / pCDF-bld and the control strain E.c / pET / pRSF / pCDF were inoculated into the fermentation medium for cultivation. The fermentation temperature was 30 °C and the rotation speed was 250 rpm. When the OD of the bacteria reached 0.6, 0.5 mM IPTG was added for induction, and fermentation continued for 48 h.

[0035] The fermentation medium formula was (g / L): glucose 10, ammonium dihydrogen phosphate ((NH 4 ) 2 HPO 4 ) 4, potassium dihydrogen phosphate (KH 2 PO 4 ) 6.7, magnesium sulfate heptahydrate (MgSO 4 ·7H 2 O) 0.8, yeast extract 2.5, citric acid 0.8, and 5 mL of trace metal solution. The composition of the trace metal solution included (g / L): ferrous sulfate heptahydrate (FeSO 4 ·7H 2 O) 10, calcium chloride dihydrate (CaCl 2 ·2H 2 O) 2, zinc sulfate heptahydrate (ZnSO 4 ·7H 2 O) 2.2, manganese sulfate tetrahydrate (MnSO 4 ·4H 2 O) 0.5, copper sulfate pentahydrate (CuSO 4 ·5H 2 O) 1, ammonium molybdate tetrahydrate ((NH 4 ) 6 Mo 7 O 24 ·4H 2 O) 0.1 and borax (Na 2 B 4 O 7 ·10H 2 O) 0.02, adipic acid 3.

[0036] After 48 hours of fermentation, the products of the strain were detected by high performance liquid chromatography (HPLC). The recombinant strain produced 0.39 g / L of 1,6 - hexanediol. The control strain did not accumulate hexanediol. It can be seen that the direct fermentation process developed by the present invention can produce hexanediol simply and efficiently, and has important industrial application prospects.

[0037] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

Claims

1. A recombinant microorganism, characterized in that Compared with the starting strain, the recombinant microorganism expresses adipic acid transporters DcaK and DcaP, acyl CoA transferases DcaI and DcaJ, and aldehyde dehydrogenase variant bld L273T , carboxylic acid reductase CAR variant and CAR activating enzyme sfp; the amino acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.

22.

2. The recombinant microorganism according to claim 1, characterized in that The NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and the NCBI accession number of DcaP is WP_004926597.1; the NCBI accession number of the acyl CoA transferase DcaI is WP_004926591.1, and the NCBI accession number of DcaJ is WP_004926593.1; the aldehyde dehydrogenase variant bld L273T The amino acid sequence is shown in SEQ ID NO.23; the NCBI accession number of the CAR activating enzyme sfp is WP_003234549.

1.

3. The recombinant microorganism according to claim 1 or 2, characterized in that The encoding nucleic acid sequences of the adipic acid transporters DcaK and DcaP are shown in SEQ ID NOs. 1-2, respectively; the encoding nucleic acid sequences of the acyl CoA transferases DcaI and DcaJ are shown in SEQ ID NOs. 3-4, respectively; the aldehyde dehydrogenase variant bld L273T The encoding nucleic acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.5; the encoding nucleic acid sequence of the CAR activating enzyme sfp is shown in SEQ ID NO.

7.

4. The recombinant microorganism according to any one of claims 1 to 3, characterized in that The starting strain is Escherichia coli.

5. Use of the recombinant microorganism according to any one of claims 1 to 4 in the fermentation production of 1,6-hexanediol.

6. Use of the recombinant microorganism according to any one of claims 1 to 4 in the genetic breeding of microorganisms for producing 1,6-hexanediol.

7. Use of the recombinant microorganism according to any one of claims 1 to 4 in increasing the yield of 1,6-hexanediol synthesized by biological method.

8. A method for producing 1,6-hexanediol by fermentation, characterized in that: The method comprises the step of culturing the recombinant microorganism according to any one of claims 1 to 4.

9. A method for constructing a recombinant microorganism for producing 1,6-hexanediol, characterized in that: The invention comprises making the starting strain express adipic acid transporter DcaK and DcaP, acyl CoA transferase DcaI and DcaJ, aldehyde dehydrogenase variant bld L273T , carboxylic acid reductase CAR variant and CAR activating enzyme sfp; the amino acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.

22.

10. The method according to claim 9, characterized in that The NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and the NCBI accession number of DcaP is WP_004926597.1; the NCBI accession number of the acyl CoA transferase DcaI is WP_004926591.1, and the NCBI accession number of DcaJ is WP_004926593.1; the aldehyde dehydrogenase variant bld L273T The amino acid sequence is shown in SEQ ID NO.23; the NCBI accession number of the CAR activating enzyme sfp is WP_003234549.1; and the starting strain is Escherichia coli.

Images