Rhodopseudomonas palustris engineering bacteria with high astaxanthin yield as well as construction method and application of rhodopseudomonas palustris engineering bacteria

Abstract

The invention discloses a rhodopseudomonas palustris engineering bacterium for high yield of astaxanthin as well as a construction method and application of the rhodopseudomonas palustris engineering bacterium. According to the invention, Rhodopseudomonas palustris is subjected to adaptive evolution by using NaHCO3 as a unique carbon source, and crtC in a Rhodopseudomonas palustris genome is knocked out through homologous recombination on the basis, so that an engineering strain crtC is obtained. On the basis of the engineering strain, cytochrome P450 reductase crtR, lycopene beta-cyclase crtYB and astaxanthin synthetase crtS are over-expressed through plasmids, the rhodopseudomonas palustris engineering strain for high yield of astaxanthin is obtained, and the yield of astaxanthin produced by the rhodopseudomonas palustris engineering strain can reach 53.4 mg / g DCW. The Rhodopseudomonas palustris engineering bacterium constructed by the invention has a remarkable effect of improving the yield of astaxanthin, and has a very good application prospect.

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biology and genetic engineering, and particularly relates to an engineered strain of Rhodopseudomonas palustris with high astaxanthin production, a construction method thereof, and an application thereof. Background Art

[0002] Astaxanthin is a xanthophyll carotenoid. Free astaxanthin is a dark red-brown powder crystal with a high melting point, low polarity, extremely difficult to dissolve in water, and easily soluble in fats and most organic solvents. The structure of astaxanthin is formed by the continuous formation of eight isoprene molecules and contains 13 conjugated double bonds. Due to the strong free radical scavenging ability, anti-cancer, anti-aging, and antioxidant effects of astaxanthin, it is widely used in the fields of medicine and health care, food preservation, and cosmetics. As an important natural antioxidant, it has important biological properties in many fields of life science.

[0003] Rhodopseudomonas palustris is a typical purple non-sulfur bacterium (PNSB), belonging to the phylum Proteobacteria, family Rhodospirillaceae, genus Rhodopseudomonas. It is widely distributed in anaerobic environments with sufficient light such as swamps, soils, lakes, and the sea. Because Rhodopseudomonas palustris is rich in various nutrients and can be used as a feed additive; it can also increase the dissolved oxygen content in water, stabilize the pH, and purify water quality; and degrade waste in animals, plants, and industries. At present, the research focus is mainly on its applications in the fields of wastewater treatment and aquaculture. However, Rhodopseudomonas palustris has great potential in the field of synthesizing terpene compounds: 1) Rhodopseudomonas palustris has multiple metabolic modes: photoautotrophy, photoheterotrophy, chemoautotrophy, and chemoheterotrophy, and can use solar energy and carbon dioxide in the atmosphere for growth to produce the required products to provide the energy it needs; 2) Through the whole-genome sequencing results of Rhodopseudomonas palustris, the MEP pathway genes for synthesizing terpene compound precursors and the genes for downstream synthesis of carotenoids were found, which are suitable for the research of synthesizing terpene compounds; 3) The fermentation process and fermentation conditions of Rhodopseudomonas palustris have been studied for many years, and its cell structure is simple and relatively easy to extract. Therefore, it is potential to use Rhodopseudomonas palustris as a host to produce synthetic terpene compounds. Summary of the Invention

[0004] The object of the present invention is to provide an engineered strain of Rhodopseudomonas palustris with high astaxanthin production, and its construction method and application. On the basis of the evolved strain of Rhodopseudomonas palustris, the engineered strain ΔcrtC is obtained in the present invention. On the basis of this engineered strain, the present invention overexpresses cytochrome P450 reductase crtR, lycopene β-cyclase crtYB and astaxanthin synthase crtS through a plasmid, and finally obtains an engineered strain of Rhodopseudomonas palustris with high astaxanthin production, RPLA3.

[0005] To achieve the above object of the invention, the present invention is implemented by the following technical solutions:

[0006] The present invention provides a construction method of an engineered strain of Rhodopseudomonas palustris with high astaxanthin production, which specifically includes the following steps:

[0007] (1) Using NaHCO 3 as the sole carbon source to adaptively evolve Rhodopseudomonas palustris to obtain an evolved strain;

[0008] (2) Amplify the upstream and downstream homologous arms of the crtC gene fragment, connect the upstream and downstream homologous arms, and perform enzyme digestion, ligation, and transformation of the obtained product and the suicide plasmid pJQ200SK into competent cells respectively to obtain the recombinant plasmid pJQ200SK-ΔcrtC;

[0009] (3) Transform the positive recombinant plasmid pJQ200SK-ΔcrtC into the LMJ01 strain, and after resistance screening and sequencing verification, obtain the engineered strain ΔcrtC;

[0010] (4) Amplify the crtR, crtYB, and crtS genes related to astaxanthin synthesis respectively;

[0011] (5) Perform seamless ligation of the amplification product and the plasmid pBBRMCS-5, and transform it into competent cells to obtain the recombinant plasmid pBBR-crtR-crtYB-crtS;

[0012] (6) Transform the recombinant plasmid pBBR-crtR-crtYB-crtS into the engineered strain ΔcrtC, and after resistance screening and sequencing verification, obtain the engineered strain of Rhodopseudomonas palustris with high astaxanthin production.

[0013] Further, the crtR gene is first codon-optimized, and the optimized nucleotide sequence is as shown in SEQ ID NO.1, and its corresponding amino acid sequence is as shown in SEQ ID NO.2.

[0014] Furthermore, the crtYB gene is first subjected to codon optimization, and the optimized nucleotide sequence is as shown in SEQ ID NO.3, and the corresponding amino acid sequence is as shown in SEQ ID NO.4.

[0015] Furthermore, the crtS gene is first subjected to codon optimization, and the optimized nucleotide sequence is as shown in SEQ ID NO.5, and the corresponding amino acid sequence is as shown in SEQ ID NO.6.

[0016] Furthermore, the nucleotide sequences of the upstream and downstream homologous arms of the crtC gene fragment are as shown in SEQ ID NO.7, and it is derived from Rhodopseudomonas palustris.

[0017] The present invention also provides an engineered strain of Rhodopseudomonas palustris constructed by using the construction method described above.

[0018] The present invention also provides the application of the engineered strain of Rhodopseudomonas palustris in the production of astaxanthin.

[0019] Furthermore, the usage method of the engineered strain of Rhodopseudomonas palustris is as follows:

[0020] (1) Activate the engineered strain of Rhodopseudomonas palustris and culture to obtain a seed solution;

[0021] (2) Transfer the seed solution to a medium at an inoculation amount of 5%-10%, add a carbon source, culture at 30°C, use an ultraviolet spectrophotometer to measure the absorbance value at 660 nm of OD until OD no longer changes, and centrifuge to collect the bacterial cells;

[0022] (3) Add an extractant to the bacterial cells, place them in an incubator and shake, and use a needle tip to crush the precipitate every 5 min - 10 min until the cell precipitate turns white; centrifuge, take the supernatant, the filtered liquid contains astaxanthin, and then use HPLC to detect the yield of astaxanthin.

[0023] Furthermore, the medium is a PM liquid medium containing 20 mM sodium acetate.

[0024] Furthermore, the extractant is a mixed solution of 1 mL of 5% (w / v) potassium hydroxide and 30% (v / v) methanol.

[0025] Furthermore, the conditions for detecting astaxanthin production are as follows: chromatographic column: C18 (4.6×250 mm, 5 μm), column temperature: 30 °C; flow rate: 0.5 mL / min; injection volume: 5 μL; detection wavelength: 254 nm; mobile phase A: 50 mmol / L potassium dihydrogen phosphate (weigh 6.8045 g of potassium dihydrogen phosphate and make up to 1000 mL with water), mobile phase B: pure acetonitrile. Gradient elution conditions: within 0 - 10 min, phase A decreases from 98% to 95%, and phase B increases from 2% to 5%; within 10 - 15 min, phase A decreases from 95% to 80%, and phase B increases from 5% to 20%; within 15 - 16 min, phase A increases from 80% to 98%, and phase B decreases from 20% to 2%, and stops after maintaining for 9 min.

[0026] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0027] First, the present invention obtains strain LMJ01 by adaptive evolution using Rhodopseudomonas palustris CGA009 with NaHCO 3 as the sole carbon source, and the generation time of this strain can be shortened by half. On this basis, the crtC in the genome of Rhodopseudomonas palustris is knocked out through a homologous recombination strategy mediated by the suicide plasmid pJQ200SK to obtain the engineered strain △crtC. On the basis of this engineered strain, the present invention overexpresses cytochrome P450 reductase crtR, lycopene β-cyclase crtYB, and astaxanthin synthase crtS through plasmids, and finally obtains an engineered strain of Rhodopseudomonas palustris with high astaxanthin production, named engineered strain RPLA3, and its astaxanthin production can reach 53.4 mg / g DCW.

[0028] And the engineered strain RPLA3 can use substances present in various industrial wastes such as acetate, malate, and propionate as carbon sources, and can also use CO 2 as the sole carbon source, and has an advantage in energy utilization compared with heterotrophic microorganisms such as Escherichia coli and Saccharomyces cerevisiae. The engineered strain of Rhodopseudomonas palustris constructed in the present invention has a significant effect of increasing astaxanthin production and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the plasmid map of the constructed vector pBBR-crtR-crtYB-crtS.

[0030] Figure 2 It is the plasmid map of pJQ200SK-△crtC in the present invention.

[0031] Figure 3To construct the astaxanthin yield of the engineering strain. Detailed implementation manners

[0032] The technical solutions of the present invention will be further described in detail in conjunction with the following specific examples.

[0033] In the following examples, unless otherwise specified, the experimental methods used are all conventional methods, and the materials, reagents, etc. used can be purchased from biological or chemical reagent companies.

[0034] Example 1: Preparation of the medium for Rhodopseudomonas palustris

[0035] 1. Prepare the Metal 44 solution according to the following method:

[0036] Metal 44 100 mL EDTA 0.25 g <![CDATA[ZnSO 4 ·7H 2 O]]> 1.095 g <![CDATA[FeSO 4 ·7H 2 O]]> 0.5 g <![CDATA[MnSO 4 ·H 2 O]]> 0.154 g <![CDATA[CuSO 4 ·5H 2 O]]> 0.0392 g <![CDATA[Co(NO 3 ) 2 ·6H 2 O]]> 0.025 g <![CDATA[Sodium 2 Boron 4 Oxygen 7 ·10 Water molecules 2 > 0.0177 g

[0037] Dissolve EDTA in 80 mL of distilled water, stir, adjust the pH to 5.0 with 10M NaOH (the pH meter is inserted into the solution and stirred with a magnetic stirrer, and the reaction process is slow). Add other metal salts in sequence (add the next one after the previous one is completely dissolved), and make up to 100 ml. The pH of the prepared Metal 44 solution is 2.4, and it is a clear lime green solution. After filtration sterilization, it is stored in a glass bottle, wrapped with aluminum foil, and stored at 4°C.

[0038] 2. Prepare the concentrated solution according to the following method:

[0039] Concentrate composition 100 mL concentrate Nitrilotriacetic acid (NTA) 2 g <![CDATA[Anhydrous MgSO 4 > 2.89 g <![CDATA[CaCl 2 > 5.03 g <![CDATA[(NH 4 ) 6 Mo 7 O 24 ·4H 2 O]]> 0.00185g <![CDATA[FeSO 4 ·7H 2 O]]> 0.0198 g Metal 44 10 mL

[0040] Dissolve NTA in 60 mL of water, add 14.6 g of KOH for neutralization, add the drugs in sequence according to the table, adjust the pH to 6.8 and then make up to 100 mL. A precipitate will form when adjusting the pH with KOH, but it can eventually be redissolved by stirring. When the pH approaches 6.8, the color of the solution will change from dark yellow to straw color. After filtration sterilization, it is stored in a glass bottle, wrapped with aluminum foil, and stored at 4°C.

[0041] 3. Prepare various carbon sources and antibiotics according to the following method:

[0042] 1 M sodium succinate: Weigh 27.015 g of sodium succinate powder and make up to 100 mL of ultrapure water. Filter twice with a sterilized water-based filter membrane in a laminar flow hood and store at low temperature for later use.

[0043] 2 M sodium acetate: Weigh 27.216 g of sodium acetate powder and make up to 100 mL of ultrapure water. Filter twice with a sterilized water-based filter membrane in a laminar flow hood and store at low temperature for later use.

[0044] 1 M sodium bicarbonate: Dissolve 8.41 g of sodium bicarbonate in 100 mL of ddH2 In 0, filter twice with a sterilized filter membrane in a laminar flow hood.

[0045] 0.1 M Sodium thiosulfate: Dissolve 1.24 g of sodium thiosulfate in 50 mL of ddH 2 In 0, filter twice with a sterilized filter membrane in a laminar flow hood.

[0046] 50% Sucrose: Weigh 250 g of sucrose and dissolve it in 500 mL of ddH 2 In 0, filter and sterilize with a disposable filter, and store it in a 4 o C refrigerator for later use.

[0047] Gentamicin stock solution (100 mg / mL): Weigh 1 g of gentamicin, dissolve it in 10 mL of ultrapure water, filter it with a water-based filter membrane, and store it at -20°C for later use.

[0048] Kanamycin stock solution (34 mg / mL): Weigh 340 mg of kanamycin, dissolve it in 10 mL of ultrapure water, filter it with a water-based filter membrane, and store it at -20°C for later use.

[0049] 4. Prepare the PM liquid medium according to the following method:

[0050] PM composition 1000 mL PM <![CDATA[ddH 2 O]]> 800 <![CDATA[Sodium 2 HPO 4 > 1.7745 g <![CDATA[KH 2 PO 4 > 1.10772 g <![CDATA[(NH 4 ) 2 SO 4 > 1.0 g Concentrate 1 mL <![CDATA[0.1M Na 2 S 2 O 3 ·5H 2 O]]> 1 mL 2 mg / mL p-aminobenzoic acid 1 mL Volume made up to 1000 mL

[0051] Pour the medium into a blue-capped bottle, bubble with nitrogen for 30 min, tighten with a rubber stopper, and place the medium and 16 mL test tubes (including rubber stoppers and clamps) in an anaerobic chamber; take 10 mL of the medium and dispense it into test tubes; tighten with rubber stoppers; take the test tubes out of the anaerobic chamber and sterilize them at 121°C under high-pressure steam for 20 min.

[0052] 5. Preparation of PM solid medium (2 x PM):

[0053] PM composition 2XPM <![CDATA[ddH 2 O]]> 80 <![CDATA[Sodium 2 HPO 4 > 0.3549 g <![CDATA[KH 2 PO 4 > 0.340225 g <![CDATA[(NH 4 ) 2 SO 4 > 0.2 g Concentrate 0.2 mL <![CDATA[0.1M Na 2 S 2 O 3 ·5H 2 O]]> 20 μL 2 mg / mL p-aminobenzoic acid 0.2 mL Volume made up to 100 mL

[0054] For every 100 mL of 2XPM and 100 mL of ddH with 3.5 g of agar powder added 2 O are sterilized at 121°C under high-pressure steam for 20 minutes respectively;

[0055] When pouring the CA plate, mix well, and add 2 mL of 2 M sodium acetate when it is not too hot, and the final concentration is 20 mM;

[0056] When pouring the PMS + Gm plate, mix well, and add 2 mL of 1 M sodium succinate when it is not too hot, and the final concentration is 10 mM and 200 μL of 100 mg / mL Gm, and the final concentration is 100 μg / mL.

[0057] Example 2: Adaptive evolution

[0058] (1)Pick a monoclonal of Rhodopseudomonas palustris CGA009 into 10 mL of PM medium, add 20 mM NaHCO 3 as a carbon source, and culture it in a 30 °C light incubator to obtain strain LMJ01. The source of the Rhodopseudomonas palustris CGA009 strain is the same as that of CN116904492A. Specifically, it is provided by the Harwood Laboratory of the University of Washington School of Medicine in the United States, and the website is: https: / / depts.washington.edu / cshlab / html / organisms / rhodopseudomonas.html. The source method of the above strain has been made public before the filing date and can be obtained through the contact information in the website.

[0059] (2)Add 20 mM NaHCO 3 as the sole carbon source, and culture strain R. palustris LMJ01 in a 30 °C light incubator.

[0060] (3)When OD 660 = 0.8, transfer it according to a transfer amount of 3%.

[0061] (4)Continuously batch culture for 50 generations.

[0062] Example 3: Construction of R. palustris LMJ01 △crtC

[0063] (1)Obtain the crtC gene fragment and the sequences of 1000 bp upstream and downstream of it (SEQ ID NO.7) according to the sequence number of crtC (GenBank No. CAE26959.1) in strain R. palustris LMJ01.

[0064] Extract the genome of R. palustris LMJ01 according to the genomic DNA extraction kit Ezup Column Fungi genomic DNA Purification Kit (Sangon Biotech, product number B518259-0050).

[0065] Use the genome of R. palustris LMJ01 as a template to amplify the upstream and downstream homologous arms of the crtC gene fragment. The amplification system is shown as follows:

[0066] Template 100 ng Primer 1 0.5 μM Primer 2 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme, catalog number P505-d1) 1 μL 2×Phanta Max Buffer 25 μL dNTP 4 μL Ultra-pure water Volume made up to 50 μL

[0067] The PCR program was as follows: 95 °C for 3 min; 30 cycles × (95 °C for 15 s, 55 °C for 15 s, 72 °C for 2 min); 72 °C for 5 min; 16 °C ∞. The PCR products were purified by gel extraction using a Gel Extraction and Purification Kit (Vazyme, catalog number DC301-01).

[0068] The primer sequences are as follows:

[0069] △crtC-up-F:

[0070] 5’-AAATCTAGAAGATCGCCGCTCCCTTCGAT-3’ (SEQ ID NO.8);

[0071] △crtC-up-R:

[0072] 5’-GGCTACGCCTGGTGGTACATTCGAAGACACTCCGTTCTAC-3’ (SEQ ID NO.9);

[0073] △crtC-down-F:

[0074] 5’-GTAGAACGGAGTGTCTTCGAATGTACCACCAGGCGTAGCC-3’ (SEQ ID NO.10);

[0075] △crtC-down-R:

[0076] 5’-TTGTCTAGAATGACCTGGAGCATGGTGGC-3’ (SEQ ID NO.11).

[0077] (2)The upstream and downstream homologous arms were ligated by Overlap PCR. The amplification system was as follows, and the upstream and downstream homologous arm ligation fragment (SEQ ID NO.7) was obtained:

[0078] Template 1 100 ng Template 2 100 ng △crtC-up-F 0.5 μM △crtC-down-R 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme, catalog number P505-d1) 1 μL 2×Phanta Max Buffer 25 μL dNTP 4 μL Ultra-pure water Volume made up to 50 μL

[0079] The PCR program was as follows: 95 °C for 3 min; 30 cycles × (95 °C for 15 s, 55 °C for 15 s, 72 °C for 4 min); 72 °C for 5 min; 16 °C ∞. The PCR products were purified by gel extraction using a Gel Extraction and Purification Kit (Vazyme, catalog number DC301-01).

[0080] (3) Separately digest the Overlap product and the suicide plasmid pJQ200SK with Xba I to obtain the PCR fragment after Xba I digestion and the linearized plasmid fragment pJQ200SK; use a gel extraction and purification kit (Vazyme, product number DC301-01) for gel extraction and purification.

[0081] (4) Use T4 ligase to ligate the two fragments, and the reaction system is as follows:

[0082] PCR fragment 3:1 molar concentration Linearized pJQ200SK 100 ng T4 DNA Ligase (ThermoScientific, catalog number #EL0011) 1 μL 10 × T4 DNA ligase Buffer 1 μL Ultra-pure water Volume made up to 10 μL

[0083] Incubate in a 22°C water bath for 2 h.

[0084] (5) Transform the T4 ligation product into Escherichia coli S 17-1 competent cells, screen through gentamicin resistance, and use the verification primers △crtC-yz-F and △crtC-yz-R for colony PCR verification. After the positive clones screened are verified by sequencing, the plasmid pJQ200SK-△crtC is obtained;

[0085] The colony PCR reaction system is as follows:

[0086] Single colony 1 Primer 1 0.5 μM Primer 2 0.5 μM 2 × Taq Plus Master Mix (Vazyme, catalog number P212-01) 5 μL Ultra-pure water Volume made up to 10 μL

[0087] The PCR program is: 95°C for 3 min; 30 cycles × (95°C for 15 s, 55°C for 15 s, 72°C for 1 min); 72°C for 5 min; 16°C ∞.

[0088] The primer sequences are as follows:

[0089] △crtC-yz-F:

[0090] 5’- GCAACGGCGTTAGTTGTGGC-3’ (SEQ ID NO.12);

[0091] △crtC-yz-R:

[0092] 5’- CTGCTTCCAAGACGACGTGA-3’ (SEQ ID NO.13).

[0093] (6) Transform the plasmid with successful sequencing into Rhodopseudomonas palustris by the method of conjugation transfer. Culture on a CA plate without resistance at 30°C, and transfer the single colonies grown to a PMS solid medium (plate) for screening through gentamicin resistance;

[0094] (7) Pick 6 single colonies from the resistance plate and streak them on two PMS + 10% sucrose plates without resistance (each plate is divided into three areas);

[0095] (8) Select multiple single colonies from the plate containing PMS + 10% sucrose without resistance, and streak them on the plates containing PMS + 10% sucrose without resistance and PMS + 10% sucrose with gentamicin resistance respectively (the two plates are divided into multiple regions. For each colony, first streak on the plate of PMS + 10% sucrose with gentamicin resistance, and then streak on the plate of PMS + 10% sucrose without gentamicin resistance). If there are colonies on the latter plate but none on the former plate, use the above verification primers for colony PCR verification. After the positive clones are verified by sequencing, the engineered strain R. palustris LMJ01△crtC is obtained.

[0096] Example 4: Construction of plasmids

[0097] (1) pBBR-crtR-crtYB-crtS plasmid

[0098] The crtR, crtS and crtYB genes were respectively codon-optimized to obtain nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, and their amino acid sequences shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6. They were chemically synthesized by Genewiz to the pUC-57 vector, and an RBS sequence (TTGTAGTCCAATTACAATAAAGGGAGGTAGTTA) was added in front of ATG to obtain pUC-crtR, pUC-crtS and pUC-crtYB vectors respectively.

[0099] Using pUC-crtR, pUC-S and pUC-crtYB as templates respectively, and crtR-F and crtR-R, crtS-F and crtS-R, crtYB-F and crtYB-R as primers, the crtR gene was amplified by PCR. The PCR reaction system is as follows:

[0100] 2 x Phanta Max Buffer 25 μL dNTP Mix (10 mM each) 1 μL F 2 μL R 2 μL Phanta Max Super-Fidelity DNA Polymerase 1 μL Plasmid 1 μL DDW To 50 μL

[0101] PCR amplification program: 95 o °C pre-denaturation for 3 min; 95 o °C denaturation for 15 s; 65 o °C annealing for 15 s, 72 o °C extension for 1 min; 32 cycles, 72 o °C extension for 5 min. The PCR products were purified by gel extraction using a gel extraction and purification kit (Vazyme, product number DC301-01).

[0102] The primer sequences are as follows:

[0103] crtR-F:

[0104] CCTAGGTACCTGCACCTATAGGAAAGAGGAGGAAAACCTAAATGGCCACCCTCTCGGAC (SEQ ID NO.14);

[0105] crtR-R:

[0106] ACTGAAGCTTGCTCCAGACGTCCATCAGCA (SEQ ID NO.15);

[0107] crtS-F:

[0108] AAGCTTACTGTCGAAACGTTAGGAGGGATCTATGTTCATCCTGGTCCTCCTCAC (SEQ ID NO.16);

[0109] crtS-R:

[0110] ATCGCTGCAGGACCGGCTTGACCTGCAG (SEQ ID NO.17);

[0111] crtYB-F:

[0112] ATCGCTGCAGTTGTAGTCCAATTACAATAAAGGGAGGTAGTTAATGACCGCGCTCGCC (SEQ ID NO.18);

[0113] crtYB-R:

[0114] ACTGACTAGTCTGGCCCTCCCAGCC (SEQ ID NO.19).

[0115] The crtR, crtS and crtYB genes were ligated by Overlap PCR, and the amplification system is as follows:

[0116] Template 1 100 ng Template 2 100 ng crtR-F 0.5 μM crtYB-R 0.5 μM Phanta Max Super-Fidelity DNA Polymerase (Vazyme, catalog number P505-d1) 1 μL 2×Phanta Max Buffer 25 μL dNTP 4 μL Ultra-pure water Volume made up to 50 μL

[0117] The PCR program was: 95 °C for 3 min; 30 cycles × (95 °C for 15 s, 55 °C for 15 s, 72 °C for 4 min); 72 °C for 5 min; 16 °C ∞. The PCR products were purified by gel extraction using a Gel Extraction Purification Kit (Vazyme, catalog number DC301-01).

[0118] The pBBR1MCS-5 plasmid was double-digested with Kpn I and Xba I (Takara), and the digestion system is as follows:

[0119] 10 x Q.cut Buffer 10 μL Kpn I 5 μL Hind Ⅲ 5 μL pBBR1MCS-5 plasmid 3 μg <![CDATA[ddH 2 O]]> To 100 μL

[0120] Place the restriction enzyme reaction system in a 37 o °C water bath for 2 - 3 h. Then, use the E.Z.N.A. TM Gel & PCR Clean Up Kit (Omega) kit to perform gel recovery and purification on the PCR reaction system and the restriction enzyme reaction system, and measure their concentrations.

[0121] Use the In-Fusion HD Cloning kit (Takara) to clone the crtR, crtYB, and crtS gene fragments obtained by PCR into the plasmid digested with double restriction enzymes. The system is as follows:

[0122] 5 x In-Fusion HD Enzyme Premix 2 μL Double-digested linearized pBBR1MCS-5 plasmid 50 ng Recovered gene fragment 55.75 ng (3:1) <![CDATA[ddH 2 O]]> Up to 10 μL

[0123] Place the ligation system in a 50 o °C water bath for 1 h, then transform it into E. coli S 17-1 competent cells, and spread the transformed bacterial solution on an LB + Gm (100 μg / mL) plate, and incubate it overnight in a 37°C constant temperature incubator. Screen positive clones by PCR, extract the recombinant plasmid from the positive clones, and then identify it by sequencing to obtain the pBBR-crtR-crtYB-crtS plasmid.

[0124] Example 5: Construction of R. palustris LMJ01△crtC / pBBR-crtR-crtYB-crtS

[0125] Transform the successfully sequenced plasmid pBBR-crtR-crtYB-crtS into the engineered strain R. palustris LMJ01△crtC by the method of conjugation transfer, screen it by kanamycin resistance, and use the verification primers PRYS-yz-F and PRYS-yz-R to perform colony PCR verification. After the positive clones are verified by sequencing, the engineered strain R. palustrisLMJ01△crtC / pBBR-crtR-crtYB-crtS is obtained. The colony PCR system is as follows:

[0126] Single colony 1 Primer 1 0.5 μM Primer 2 0.5 μM 2 × Taq Plus Master Mix (Vazyme, catalog number P212-01) 5 μL Ultra-pure water Make up to 10 μL

[0127] The PCR program is: 95°C for 3 min; 30 cycles × (95°C for 15 s, 55°C for 15 s, 72°C for 1 min); 72°C for 5 min; 16°C ∞.

[0128] The primer sequences are as follows:

[0129] PRYS-yz-F:

[0130] CGGAACGGTCTGCGTTGTCGG (SEQ ID NO.20);

[0131] PRYS-yz-R:

[0132] CTTCGCTATTACGCCAGCTGG (SEQ ID NO.21).

[0133] Example 6: Fermentation Test of Engineered Strain

[0134] Pick a monoclonal into 10 mL of PM medium, add 20 mM sodium acetate as a carbon source, add gentamicin, and culture in a 30°C light incubator to obtain a seed solution.

[0135] Transfer the seed solution to 10 mL of PM medium at an inoculation amount of 5%, add sodium acetate as a carbon source with a final concentration of 20 mM, culture in a 30°C light incubator, and use an ultraviolet spectrophotometer to measure the absorbance value at 660 nm for OD until OD no longer changes. Centrifuge to collect 500 μL of bacterial cells.

[0136] Example 7: Astaxanthin Extraction and Detection

[0137] Add an extraction agent (a mixed solution of 1 mL of 5% (w / v) potassium hydroxide and 30% (v / v) methanol) to the bacterial cells, place it in an incubator and shake. Pierce the precipitate with a needle tip every 5 - 10 minutes until the cell precipitate turns white; centrifuge, take the supernatant. The filtered liquid contains astaxanthin, and then use HPLC to detect the yield of astaxanthin.

[0138] Detection conditions: Chromatographic column: C18 (4.6×250 mm, 5 μm), column temperature: 30°C; flow rate: 0.5 mL / min; injection volume: 5 μL; detection wavelength: 254 nm; mobile phase A: 50 mmol / L potassium dihydrogen phosphate (weigh 6.8045 g of potassium dihydrogen phosphate and make up the volume to 1000 mL with water), mobile phase B: pure acetonitrile.

[0139] Gradient elution conditions: Within 0 - 10 minutes, phase A decreases from 98% to 95%, and phase B increases from 2% to 5%; within 10 - 15 minutes, phase A decreases from 95% to 80%, and phase B increases from 5% to 20%; within 15 - 16 minutes, phase A increases from 80% to 98%, and phase B decreases from 20% to 2%, and stop after maintaining for 9 minutes.

[0140] Fermentation yield calculation: Astaxanthin was detected in the fermentation broth of the engineered strains R. palustris LMJ01 / pBBR-crtR-crtYB-crtS and R. palustris LMJ01△crtC / pBBR-crtR-crtYB-crtS compared with the wild-type strain. The astaxanthin yields of the engineered strains △crtC and RPLA3 were 30.58 mg / g DCW and 53.4 mg / g DCW, respectively.

[0141] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions required to be protected by the present invention.

Claims

1. A method for constructing an engineered strain of Rhodopseudomonas palustris that produces high astaxanthin, characterized in that: The specific steps include: (1) Adaptive evolution of Rhodopseudomonas palustris using NaHCO3 as the sole carbon source was performed to obtain an evolved strain; (2) Amplification C The upstream and downstream homology arms of the gene fragment are connected, and the obtained products are digested with the suicide plasmid pJQ200SK, connected, and transformed into competent cells to obtain the recombinant plasmid pJQ200SK-△crtC; (3) The positive recombinant plasmid pJQ200SK-△crtC was transformed into the evolved strain, and after resistance screening and sequencing verification, the engineered strain △crtC was obtained; (4) Amplification of genes related to astaxanthin synthesis crtR Gene 、crtYB Gene 、crtS Gene; (5) The amplified product was seamlessly connected with the plasmid pBBRMCS-5 and transformed into competent cells to obtain the recombinant plasmid pBBR-crtR-crtYB-crtS; (6) The recombinant plasmid pBBR-crtR-crtYB-crtS is transformed into the engineered strain △crtC, and after resistance screening and sequencing verification, the engineered strain of Rhodopseudomonas palustris that produces high astaxanthin is obtained.

2. The construction method according to claim 1, characterized in that: In step (1), the adaptive evolution is carried out with NaHCO3 as the only carbon source, so that the final concentration of CO2 reaches 20 mM. 660 =0.8, the evolved strain was obtained and the transfer was performed at a 3% transfer rate.

3. The construction method according to claim 1, characterized in that: Optimized crtR The nucleotide sequence of the gene is shown in SEQ ID NO.1; The corresponding amino acid sequence is shown in SEQ ID NO.

2.

4. The construction method according to claim 1, characterized in that: Optimized ikB The nucleotide sequence of the gene is shown in SEQ ID NO.3; The corresponding amino acid sequence is shown in SEQ ID NO.

4.

5. The construction method according to claim 1, characterized in that: Optimized tS The nucleotide sequence of the gene is shown in SEQ ID NO.5; The corresponding amino acid sequence is shown in SEQ ID NO.

6.

6. The engineered bacterium Rhodopseudomonas palustris constructed by the construction method according to any one of claims 1 to 5.

7. Use of the engineered Rhodopseudomonas palustris according to claim 6 in producing astaxanthin or increasing the astaxanthin content.

8. The use according to claim 7, characterized in that: The method for using the Rhodopseudomonas palustris engineered bacteria is as follows: (1) activating the engineered bacteria of Rhodopseudomonas palustris and culturing to obtain a seed solution; (2) Transfer the seed solution to the culture medium at an inoculum rate of 5%-10%, add a carbon source, and culture at 30°C. Use a UV spectrophotometer to measure the absorbance value of OD at 660 nm until OD no longer changes, and collect the bacteria by centrifugation. (3) Add the extractant to the bacteria, place it in an incubator and shake it. Use a needle tip to break up the precipitate every 5-10 minutes until the cell precipitate turns white. Centrifuge and take the supernatant. The filtered liquid contains astaxanthin, and the astaxanthin production is then detected by HPLC.

9. The use according to claim 8, characterized in that: The extractant is a mixed solution of potassium hydroxide and methanol.

10. The use according to claim 9, characterized in that: The conditions for HPLC detection of astaxanthin production were as follows: chromatographic column: C18, column temperature: 30°C; flow rate: 0.5 mL / min; injection volume: 5 μL; detection wavelength: 254 nm; mobile phase A: 50 mmol / L potassium dihydrogen phosphate, mobile phase B: pure acetonitrile; Gradient elution conditions: within 0-10 min, phase A decreased from 98% to 95%, and phase B increased from 2% to 5%; within 10-15 min, phase A decreased from 95% to 80%, and phase B increased from 5% to 20%; within 15-16 min, phase A increased from 80% to 98%, and phase B decreased from 20% to 2%, and stopped after maintaining for 9 min.

Images