Products and methods for detecting cd71 bi-allelic edited cells using crisper / cas12a system

By using the CRISPR/Cas12a system to bind to specific crRNA, and then performing PCR amplification using DNA probes and primer pairs, followed by detection using fluorescent signals or colloidal gold test strips, the low efficiency of traditional CD71 gene bicelestem-edited cell detection has been solved, achieving efficient and economical cell screening.

CN120082641BActive Publication Date: 2025-11-18AGSINO GENSOURCES CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510114895.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-24
Publication Date
2025-11-18
Estimated Expiration
2045-01-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently and accurately detecting CD71 gene bicelestem-edited cells. Traditional gene sequencing technologies are cumbersome and time-consuming, making it difficult to achieve rapid, high-throughput detection.

Method used

By utilizing the CRISPR/Cas12a system, specific crRNAs were designed to bind to the LbCas12a protein. After PCR amplification using DNA probes and primer pairs, the reaction was combined with fluorescence signals or colloidal gold test strips for detection, enabling efficient screening of CD71 biallelic edited cells.

Benefits of technology

It achieves a simple and efficient detection method for CD71 biallelic edited cells, suitable for large-scale batch processing, cost-effective, and can screen cells carrying specific biallelic edits in a short time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120082641B_ABST
    Figure CN120082641B_ABST
Patent Text Reader

Abstract

The application discloses a product and method for detecting CD71 double allelic gene edited cells by using a CRISPR / Cas12a system, and belongs to the technical field of biotechnology. The technical problem solved by the application is how to detect CD71 double allelic gene edited cells. The product for detecting CD71 double allelic gene edited cells disclosed by the application comprises crRNA with a target sequence of SEQ ID NO. 5, LbCas12a protein, LbCas12a protease cutting buffer, DNA probe 1 (6-FAM-TTATT-BHQ1) or DNA probe 2 (6-FAM-TTTTTTTATTTTTTT-C6Biotin), and a primer pair shown in SEQ ID NO. 1 and SEQ ID NO. 2. The product of the application can be used for screening CD71 double allelic gene edited cells induced by CRISPR / Cas9.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to products and methods for detecting CD71 biallelic edited cells using the CRISPR / Cas12a system. Background Technology

[0002] The CRISPR / Cas9 system is a powerful gene-editing tool. Its principle is based on the Cas9 endonuclease, guided by gRNA, which recognizes and cuts specific DNA sequences. In cellular gene editing, by designing gRNAs that target specific genes, the Cas9 enzyme can precisely cut at the target gene site. This process causes DNA double-strand breaks, triggering intracellular DNA repair mechanisms, including non-homologous end joining and homologous recombination repair. Mutations such as insertions, deletions, or substitutions may occur during this process, thus achieving the goal of gene editing. When two alleles of a specific gene are edited simultaneously, bicelestem-edited cells can be generated. These bicelestem-edited cells have significant research value in gene function studies, disease model construction, and gene therapy.

[0003] The CD71 gene, also known as transferrin receptor 1 (TfR1), is a type II transmembrane glycoprotein that binds to transferrin (Tf). It plays a crucial role in cellular iron uptake, specifically binding to the transferrin-iron complex and transporting iron ions into the cell via receptor-mediated endocytosis to meet the iron requirements of cell growth, proliferation, and various metabolic processes. In addition to these functions, CD71 has shown potential as a drug delivery carrier. Studies have shown that transferrin, as a natural targeting carrier, can bind to specific drugs or substances to form stable complexes. These complexes are then precisely transported into the cell via the CD71 receptor on the cell surface. Furthermore, the CD71 gene is highly expressed during erythropoiesis, playing an indispensable role in erythrocyte development and maturation. Simultaneously, the CD71 gene is also highly expressed in some tumor cells, closely related to tumor cell proliferation, invasion, and metastasis. Other studies have shown that CD71 can act as a viral entry receptor, participating in the early invasion of host cells by various viruses. Given the numerous biological functions of CD71, obtaining CD71 bis-allelic edited cells is of great significance for studying the function of the CD71 gene.

[0004] However, efficient and accurate detection of biallelic gene-edited cells has always been a challenge. While traditional gene sequencing technologies can accurately detect changes in gene sequences, the process is cumbersome and time-consuming, hindering rapid, high-throughput detection. The CRISPR / Cas12a system is an RNA-guided DNA endonuclease technology. Its core lies in the Cas12a protein forming a complex with specifically designed CRISPR RNA (crRNA). This complex precisely recognizes and targets DNA regions containing specific PAM sequences, cleaving downstream of the PAM sequence to create double-strand breaks. Furthermore, the CRISPR / Cas12a detection system is relatively simple and can obtain results in a short time, promising to provide an efficient and convenient detection method for biallelic gene-edited cells. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to detect CD71 gene biallelic edited cells.

[0006] To address the aforementioned technical problems, this invention first provides a product for detecting CD71 biallelic edited cells using the CRISPR / Cas12a system, containing crRNA, the target sequence of which is SEQ ID NO.5.

[0007] In the above products, the crRNA may be the single-stranded RNA shown in SEQ ID NO.8.

[0008] In one embodiment of the present invention, the crRNA is transcribed from a double-stranded DNA consisting of SEQ ID NO.6 and SEQ ID NO.7.

[0009] The above products may also contain DNA probe 1 or DNA probe 2, wherein DNA probe 1 is a single-stranded DNA with fluorescent groups (such as 6-FAM groups) and quenching groups (such as BHQ1 groups) labeled at both ends respectively;

[0010] The DNA probe 2 is a single-stranded DNA with Biotin and 6-FAM groups labeled at both ends, respectively, and its sequence is shown in SEQ ID NO.9.

[0011] Specifically, the DNA probe 1 can be: 6-FAM-TTATT-BHQ1.

[0012] The DNA probe 2 can be: 6-FAM-TTTTTTTATTTTTTT-C6Biotin.

[0013] The above products may also contain LbCas12a protein and LbCas12a protease digestion buffer (such as 10×LbCas12aCleavage Buffer (product of Guangzhou Aidi Gene Technology Co., Ltd., catalog number EDE0005-B)).

[0014] The LbCas12a protein is a product of Guangzhou Aidi Gene Technology Co., Ltd., catalog number EDE0005.

[0015] The LbCas12a protease digestion buffer can be 10×LbCas12a Cleavage Buffer (product of Guangzhou Aidi Gene Technology Co., Ltd., catalog number EDE0005-B).

[0016] The above products may also contain primer pairs, which consist of two single-stranded DNA molecules as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0017] The above-mentioned product may be composed of the crRNA and the LbCas12a protein, or it may be composed of the crRNA, the LbCas12a protein, and the LbCas12a protease digestion buffer, or it may be composed of the crRNA, the LbCas12a protein, and the DNA probe 1, or it may be composed of the crRNA, the LbCas12a protein, and the DNA probe 2, or it may be composed of the crRNA, the LbCas12a protein, the DNA probe 1, and the LbCas12a protease digestion buffer, or it may be composed of the crRNA, the LbCas12a protein, the DNA probe 2, and the LbCas12a protease digestion buffer, or it may be composed of the crRNA and the LbCas12a protein. The as12a protein and the primer pair can also be composed of the crRNA, the LbCas12a protein, the LbCas12a protease digestion buffer, and the primer pair; or the crRNA, the LbCas12a protein, the DNA probe 1, and the primer pair; or the crRNA, the LbCas12a protein, the DNA probe 2, and the primer pair; or the crRNA, the LbCas12a protein, the DNA probe 1, the LbCas12a protease digestion buffer, and the primer pair; or the crRNA, the LbCas12a protein, the DNA probe 2, the LbCas12a protease digestion buffer, and the primer pair.

[0018] The product may be a reagent kit.

[0019] This invention also provides a method for detecting CD71 biallelic edited cells using the CRISPR / Cas12a system for non-diagnostic purposes. The method includes: performing PCR amplification on the genomic DNA of test cells and wild-type cells using the primer pairs to obtain PCR products of test cells and wild-type cells respectively; reacting the PCR products, the crRNA, the DNA probe 1, and the LbCas12a protein in LbCas12a protease digestion buffer to obtain LbCas12a products; comparing the fluorescence signals of the LbCas12a products of test cells and wild-type cells, wherein test cells with significantly lower fluorescence signals than wild-type cells are considered or candidate CD71 biallelic edited cells, and test cells with no significant difference in fluorescence signals between LbCas12a products and wild-type cells are not considered or candidate CD71 biallelic edited cells.

[0020] This invention also provides a method for detecting CD71 biallelic edited cells using the CRISPR / Cas12a system for non-diagnostic purposes. The method includes: performing PCR amplification on the genomic DNA of the cells to be tested using the primers to obtain the PCR product of the cells to be tested; reacting the PCR product, the crRNA, the DNA probe 2, and the LbCas12a protein in LbCas12a protease digestion buffer to obtain the LbCas12a product; and detecting the LbCas12a product using a Cas12-specific nucleic acid colloidal gold test strip. Cells to be tested that do not show color at the T line (detection line) are or are candidates for CD71 biallelic edited cells, while cells to be tested that show color at the T line (detection line) are not or are not candidates for CD71 biallelic edited cells.

[0021] In one embodiment of the present invention, the Cas12-specific nucleic acid colloidal gold test strip is manufactured by Guangzhou Aidi Gene Technology Co., Ltd., with product number JY0301.

[0022] In this invention, the CD71 biallelic edited cells can be cells with biallelic editing of the third exon of CD71. The CD71 biallelic edited cells can also be cells with biallelic editing of the DNA fragment shown in SEQ ID NO.3.

[0023] Specifically, the CD71 biallelic edited cells detected in this invention can be cells edited using the CRISPR / Cas9 system with SEQ ID NO.4 as the target sequence of sgRNA.

[0024] The aforementioned biallelic gene editing refers to cells in which both alleles of CD71 are edited.

[0025] This invention, based on the CRISPR / Cas12a method, develops a product and corresponding method for screening CD71 gene biallelic edited cells induced by CRISPR / Cas9. This invention features high specificity, a simple and efficient operation process, and economical cost, making it suitable for large-scale batch processing. Through the implementation of this invention, cells carrying specific biallelic edits can be efficiently screened in a short time, providing solid technical support for accelerating gene function analysis and promoting innovation in gene editing technology.

[0026] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0027] Figure 1 The image shows the electrophoresis results of wild-type pig ileal epithelial cells after PCR amplification in Example 1. Note: M, 1000bp GsDL1002 DNA Marker; WT-1 to WT-5, DNA samples from wild-type pig ileal epithelial cells after PCR amplification.

[0028] Figure 2 This is the sequencing result of the porcine CD71 gene standard plasmid in Example 1. Note: The CD71 standard plasmid sequence is the sequencing result of pClone-EZ-TOPO-WT containing the target sequence fragment, where the selected region is the target sequence of sgRNA.

[0029] Figure 3 The results show the fluorescence intensity detection of crRNA targeting the wild-type sequence of the porcine CD71 gene in Example 1. Significant differences exist between data labeled with different lowercase letters. P <0.05), there was no significant difference between data points labeled with the same lowercase letter ( P >0.05).

[0030] Figure 4 The results of the colloidal gold test strip detection of crRNA targeting the wild-type sequence of the porcine CD71 gene in Example 1 are shown.

[0031] Figure 5 These are the TA clone sequencing results for two monoclonal cell lines in Example 2. A: Sequencing results for monoclonal cell line 2-1; B: Sequencing results for monoclonal cell line 2-3.

[0032] Figure 6The results of detecting crRNA-F1, crRNA-F2, crRNA-F4, and crRNA-F5 in two monoclonal cell lines using a fluorescence reporter system in Example 2 are shown. A: Detection results of the crRNA-F1 system; B: Detection results of the crRNA-F2 system; C: Detection results of the crRNA-F4 system; D: Detection results of the crRNA-F5 system. Significant differences exist between data labeled with different lowercase letters within the same graph. P <0.05), there was no significant difference between data points labeled with the same lowercase letter ( P >0.05).

[0033] Figure 7 This is the result of using a fluorescent reporter system to detect single-clonal cells with crRNA-F5 in Example 3. Significant differences exist between data labeled with different lowercase letters. P <0.05), there was no significant difference between data points labeled with the same lowercase letter ( P >0.05).

[0034] Figure 8 This is the result of using the colloidal gold test strip system to detect crRNA-F5 in monoclonal cells in Example 3.

[0035] Figure 9 The results of TA cloning of CD71 bicelestem-edited cells (2-6#) obtained in Example 3 are shown. Detailed Implementation

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.

[0037] The following examples use GraphPad Prism 9.0 statistical software to process the data. The experimental results are expressed as mean ± standard error and are tested using a one-way ANOVA test.

[0038] CloneSmarter TOPO Cloning Vector Reagent Kit: Product of Sino-American Taihe Biotechnology (Beijing) Co., Ltd., catalog number C5865-50;

[0039] LbCas12a protein: Product of Guangzhou Aidi Gene Technology Co., Ltd., catalog number EDE0005;

[0040] 10×LbCas12a Cleavage Buffer: Product of Guangzhou Aidi Gene Technology Co., Ltd., item number EDE0005-B;

[0041] Cas12 Dedicated Nucleic Acid Colloidal Gold Test Strip: Guangzhou Aidi Gene Technology Co., Ltd., Product No. JY0301.

[0042] Example 1. Establishment of a PCR-CRISPR / Cas12a nucleic acid detection system

[0043] 1. Construction of standard plasmids

[0044] Primers were designed to amplify a portion of the third exon of the porcine CD71 gene (GenBank: NC_010455.5). The primers are as follows:

[0045] CD71-F: 5′-TGAGGATTCAAGGTAGGCT-3′ (SEQ ID NO. 1);

[0046] CD71-R: 5′-CTGATGCCCTTGTGGATAG-3′ (SEQ ID NO. 2).

[0047] Genomic DNA was extracted from wild-type (WT) porcine ileal epithelial cells (Xu Changjiang, Wang Xiaopeng, Xu Kui, Zhang Xiuling, Xiang Guangming, Zhao Haiquan, Mou Yulian, Lin Xiao, Li Kui. Construction of pAPN gene knockout IPI-2I cell line using CRISPR / Cas9 editing system. Chinese Journal of Animal Husbandry and Veterinary Medicine, 2021, 48(7): 2282-2290.), and amplified by PCR using CD71-F and CD71-R. The amplified product was 591 bp in length, and its sequence was (SEQ ID NO.3).

[0048] After the PCR reaction, agarose gel electrophoresis was performed. The electrophoresis results showed that the target fragment was obtained, such as... Figure 1 As shown in the figure. The PCR product was then purified by gel extraction. The purified product was cloned using TA and ligated into the pClone-EZ-TOPO vector (China-US Taihe Biotechnology (Beijing) Co., Ltd., C5865-50). Sequencing verification confirmed that the obtained recombinant plasmid with the correct sequence was the porcine CD71 gene standard plasmid pClone-EZ-TOPO-WT. Partial results of plasmid sequencing are shown below. Figure 2 As shown.

[0049] 2. crRNA target design

[0050] Based on the DNA sequence within a 40 bp range upstream and downstream of the sgRNA (AGGTCTGCCCAAAATAAGCG (SEQ ID NO.4)) in the third exon of the porcine CD71 gene, PAM sequences marked by TTN or TTTN were searched, and 20 to 25 bp were extended downstream of the PAM sequence as candidate target sites for recognition by the CRISPR / Cas12a system. Six candidate target sites were designed based on rules such as sequence GC content and sequence complementarity, and named crRNA-T1 to crRNA-T6 respectively. The candidate target site sequences are shown in Table 1.

[0051] Table 1 Candidate target site sequences

[0052]

[0053] 3. Preparation of specific crRNA in vitro transcription template

[0054] Based on the candidate target site sequences, T7 promoter sequences (TAATACGACTCACTATAGGG) and crRNA repeat region template sequences (TAATTTCTACTAAGTGTAGAT) were added to form specific crRNA in vitro transcription templates, resulting in positive-strand DNA crRNA-T7-F1 to crRNA-T7-F6. Complementary negative-strand DNA crRNA-T7-R1 to crRNA-T7-R6 were obtained from the positive-strand DNA, as shown in Table 2. The bolded portion represents the T7 promoter sequence, and the boxed portion represents the crRNA repeat region template.

[0055] Table 2. Specific crRNA in vitro transcription template positive and negative strand DNA sequences

[0056]

[0057] Each single-stranded DNA in Table 2 was synthesized separately, and specific crRNA in vitro transcription templates were prepared by annealing. Specific crRNA in vitro transcription templates crRNA-T7-1, crRNA-T7-2, crRNA-T7-3, crRNA-T7-4, crRNA-T7-5, and crRNA-T7-6 were obtained by mixing crRNA-T7-F1 with crRNA-T7-R1, crRNA-T7-F2 with crRNA-T7-R2, crRNA-T7-F3 with crRNA-T7-R3, crRNA-T7-F4 with crRNA-T7-R4, crRNA-T7-F5 with crRNA-T7-R5, and crRNA-T7-F6 with crRNA-T7-R6, respectively.

[0058] 4. In vitro transcription of specific crRNA

[0059] The specific crRNA in vitro transcription system was prepared using the T7 in vitro transcription kit (Invitrogen, AM1354) as shown in Table 3.

[0060] Table 3. Specific crRNA in vitro transcription system

[0061]

[0062] The transcription system was incubated overnight at 37°C. crRNA was recovered using an RNA purification and recovery kit (Invitrogen, 12183018A). The crRNAs obtained from the in vitro transcription of the specific crRNA templates crRNA-T7-1, crRNA-T7-2, crRNA-T7-3, crRNA-T7-4, crRNA-T7-5, and crRNA-T7-6 were crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, crRNA-F5, and crRNA-F6, respectively, and their sequences are shown in Table 4.

[0063] Table 4 crRNA Sequences

[0064]

[0065] 5. Establishment of a PCR-CRISPR / Cas12a nucleic acid detection system

[0066] (1) CRISPR / Cas12a fluorescence detection

[0067] The CRISPR / Cas12a fluorescence detection system is shown in Table 5.

[0068] Table 5 CRISPR / Cas12a fluorescence detection system

[0069]

[0070] The DNA probe is a single-stranded DNA probe double-labeled with 6-FAM and BHQ1 groups, specifically 6-FAM-TTATT-BHQ1.

[0071] The PCR product was obtained by PCR amplification using the standard plasmid pClone-EZ-TOPO-WT as a DNA template and CD71-F and CD71-R primers.

[0072] Prepare detection systems for crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, crRNA-F5, and crRNA-F6 according to the above system. Set up four technical replicates for each detection system, and use the system without crRNA as a negative control (NC).

[0073] The prepared detection system was reacted in a real-time PCR instrument (Thermo Scientific, QuantStudio™ 5), the reaction temperature was set to 37℃, and the program was to detect the fluorescence intensity every 30 seconds for a total of 120 times.

[0074] The results are as follows Figure 3 As shown, compared with NC, the fluorescence intensity of the crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, and crRNA-F5 groups was significantly increased. P <0.05), indicating that it has a targeted cleavage effect on the wild-type CD71 gene sequence; crRNA-F6 only produces a low fluorescence signal and is not significantly different from NC ( P >0.05), indicating that it does not have a targeted cleavage effect on the wild-type CD71 gene sequence. In contrast, the fluorescence intensity of crRNA-F3 is significantly lower than ( P <0.05) Fluorescence intensity of crRNA-F1, crRNA-F2, crRNA-F4, and crRNA-F5.

[0075] (2) CRISPR / Cas12a colloidal gold test strip detection

[0076] The CRISPR / Cas12a colloidal gold test strip detection system is shown in Table 6.

[0077] Table 6 CRISPR / Cas12a Colloidal Gold Test Strip Detection System

[0078]

[0079] Among them, the colloidal gold probe is a single-chain colloidal gold probe double-labeled with the Biotin group and the 6-FAM group, namely 6-FAM-TTTTTTTATTTTTTT(SEQ ID NO.9)-C6Biotin.

[0080] The PCR product was obtained by PCR amplification using the standard plasmid pClone-EZ-TOPO-WT as a DNA template and CD71-F and CD71-R primers.

[0081] Prepare the crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, crRNA-F5, and crRNA-F6 detection systems (denoted as WT in the figure) according to the above system. Set up four technical replicates for each detection system, and use the system without crRNA as a negative control (NC).

[0082] The prepared detection system was tested on a PCR instrument (BIO-RAD, C1000 Touch). TM The reaction was carried out at 37°C for 30 minutes to obtain the reaction product. Then, the test strip was inserted into the reaction product in the reaction tube, and the test result was read after the reading area was completely wetted.

[0083] The results are as follows Figure 4 As shown, compared to NC, crRNA-F1, crRNA-F2, crRNA-F3, crRNA-F4, and crRNA-F5 can all specifically recognize the CD71 gene wild-type sequence, i.e., the T line of the test strip shows color, indicating a positive result; while crRNA-F6 cannot specifically recognize the CD71 gene wild-type sequence, and only the C line of the test strip shows color, indicating a negative result. NC only shows color in the C line, indicating a negative result.

[0084] Based on the combined results of fluorescence intensity detection and test strip detection, the crRNA-F1, crRNA-F2, crRNA-F4, and crRNA-F5 systems were selected for subsequent detection.

[0085] Example 2. Detection and analysis of monoclonal cell samples using the CRISPR / Cas12a nucleic acid detection system for CD71 gene bicelestem-edited cells.

[0086] The PCR-CRISPR / Cas12a detection system constructed in this invention was used to screen cells in monoclonal cell samples that had undergone bicelestem editing of the CD71 gene.

[0087] Preparation of two monoclonal cell lines: The monoclonal cells were gene-edited cells obtained by CRISPR / Cas9 gene editing of porcine ileal epithelial cells (IPI-2I), with the sgRNA targeting AGGTCTGCCCAAAATAAGCG (SEQ ID NO. 4). The obtained monoclonal cells were sequenced to determine their genotypes.

[0088] The lysis products of the two obtained monoclonal cell lines (2-1# and 2-3#) were used as templates for PCR amplification using CD71-F and CD71-R primers. The resulting PCR products were cloned using TA and ligated into the pClone-EZ-TOPO vector. Sequencing was performed, and the results are shown in the figure. Figure 5 Among them, 2-1# is wild-type cell and 2-3# is CD71 gene bis-allelic edited cell.

[0089] Following the "CRISPR / Cas12a fluorescence detection" method in step 5 of Example 1, the fluorescence intensity of the PCR products of the two monoclonal cells with the known genotypes were detected using four different nucleic acid detection systems: crRNA-F1, crRNA-F2, crRNA-F4, and crRNA-F5.

[0090] Experimental results are as follows Figure 6 As shown, the fluorescence signal intensity of the four crRNA nucleic acid detection systems was analyzed. The results showed that, compared with wild-type cells (2-1#), there was no significant difference in fluorescence intensity among the CD71 gene biallelic edited cells (2-3#) crRNA-F1, crRNA-F2, and crRNA-F4 groups. P >0.05), indicating that these detection systems cannot effectively distinguish between wild-type cells and biallelic edited cells. In contrast, the crRNA-F5 detection system showed a significantly lower fluorescence signal intensity than 2-1# when detecting monoclonal cells 2-3#. P The fluorescence intensity was <0.05%, indicating that the detection system has high specificity for the target DNA sequence, can identify biallelic edited cells, and produce a specific low fluorescence signal. Therefore, crRNA-F5 was chosen for subsequent detection in this study.

[0091] Example 3: Application of the crRNA-F5 nucleic acid detection system in the detection and analysis of monoclonal cell samples.

[0092] CD71 gene Cas9 / sgRNA editing: Using porcine ileal epithelial cells (IPI-2I) as material, the CD71 gene was edited using CRISPR / Cas9 technology to obtain monoclonal cells. The target site of the sgRNA was AGGTCTGCCCAAAATAAGCG (SEQ ID NO.4).

[0093] Using the lysate of the obtained monoclonal cell samples as templates, PCR amplification was performed using CD71-F and CD71-R primers. Following the "CRISPR / Cas12a fluorescence detection system" in step 5 of Example 1, the fluorescence signal of the PCR products of each monoclonal cell was detected by crRNA-F5.

[0094] The results are as follows Figure 7 As shown, compared with other monoclonal cells, the fluorescence intensity of cells 2-6# was significantly reduced ( P <0.05); and compared with NC, there was no significant difference in fluorescence intensity between 2-6# ( P >0.05), indicating that 2-6# are CD71 gene bicelestem-edited cell samples.

[0095] Using the PCR products of the above-mentioned monoclonal cell samples as detection templates, the colloidal gold test strips were used for detection and analysis according to the "CRISPR / Cas12a colloidal gold test strip detection" method in step 5 of Example 1, and the crRNA-F5 nucleic acid detection system was used.

[0096] The results are as follows Figure 8 As shown, crRNA-F5 specifically recognizes samples containing the wild-type CD71 gene sequence and causes the T line of the test strip to develop, indicating a positive result; while samples with biallelic CD71 gene editing and the control group without crRNA only show the C line, indicating a negative result. The colloidal gold test strip results indicate that cells 2-6# are CD71 gene biallelic edited cells.

[0097] In summary, both the fluorescence intensity test results and the colloidal gold test strip results indicate that monoclonal cells #2-6 are bicelestem-edited cells.

[0098] To verify the accuracy of the rapid detection method for CRISPR / Cas9-induced biallelic gene editing cells proposed in this invention, the PCR products of monoclonal cells #2-6 were TA cloned and then ligated into the pClone-EZ-TOPO vector for sequencing.

[0099] Sequencing results as follows Figure 9 As shown, cells 2-6# obtained through screening were cells that underwent bicelestem editing of the CD71 gene at the Cas9 / sgRNA target site. This result is completely consistent with the screening results obtained using the crRNA-F5 nucleic acid detection system. These sequencing results demonstrate the accuracy, reliability, and practicality of crRNA-F5 in specifically screening samples with bicelestem editing of the CD71 gene.

[0100] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A product of CD71 third exon biallelic gene editing cells detected using the CRISPR / Cas12a system, containing crRNA, DNA probe 1 or DNA probe 2, and primer pair, wherein the crRNA is the single-stranded RNA shown in SEQ ID NO. 8; The DNA probe 1 is a single-stranded DNA with fluorescent and quenching groups labeled at both ends, and the sequence of the DNA probe 1 is TTATT; The DNA probe 2 is a single-stranded DNA with Biotin and 6-FAM groups labeled at both ends, and its sequence is shown in SEQ ID NO. 9; The primer pair consists of two single-stranded DNA molecules as shown in SEQ ID NO.1 and SEQ ID NO.2; The CD71 third exon biallelic gene-edited cells were cells edited using the CRISPR / Cas9 system with SEQ ID NO.4 as the target sequence of sgRNA.

2. The product according to claim 1, characterized in that: The product also contains LbCas12a protein and LbCas12a protease digestion buffer.

3. Methods for detecting CD71 third exon biallelic edited cells using the CRISPR / Cas12a system, including: The genomic DNA of the test cells and wild-type cells was amplified by PCR using the primers described in claim 1, respectively, to obtain the PCR products of the test cells and wild-type cells; The PCR product, the crRNA described in claim 1, the DNA probe 1 described in claim 1, and the LbCas12a protein described in claim 2 are reacted in LbCas12a protease digestion buffer to obtain the LbCas12a product. The fluorescence signals of the LbCas12a product of the test cells and wild-type cells are compared. The test cells with a fluorescence signal of LbCas12a product lower than that of wild-type cells are or are candidates for CD71 third exon biallelic gene editing cells. The test cells with a fluorescence signal of LbCas12a product that is no different from that of wild-type cells are not or are not candidates for CD71 third exon biallelic gene editing cells. The CD71 third exon biallelic gene-edited cells were cells edited using the CRISPR / Cas9 system with SEQ ID NO.4 as the target sequence of sgRNA.

4. Methods for detecting CD71 third exon biallelic edited cells using the CRISPR / Cas12a system, including: The genomic DNA of the cells to be tested was amplified by PCR using the primers described in claim 1 to obtain the PCR product of the cells to be tested. The PCR product, the crRNA described in claim 1, the DNA probe 2 described in claim 1, and the LbCas12a protein described in claim 2 are reacted in LbCas12a protease digestion buffer to obtain the LbCas12a product. The LbCas12a product is detected using a Cas12-specific nucleic acid colloidal gold test strip. Cells that do not show a T-line are or are candidates for CD71 third exon biallelic gene editing cells, while cells that show a T-line are not or are candidates for CD71 third exon biallelic gene editing cells. The CD71 third exon biallelic gene-edited cells were cells edited using the CRISPR / Cas9 system with SEQ ID NO.4 as the target sequence of sgRNA.

Citation Information

Patent Citations

  • open fuel nozzle

    DE586550A

  • Method for screening biallelic mutant cell lines by Cas12a protein

    CN110438161A

  • RPA-CRISPR / Cas12a-based kit for visually detecting botryosphaeria dothidea

    CN118755869A