A molecular marker related to the sustained fertility ability of breeding hens in the later period and application thereof

By detecting SNP molecular markers in breeder chickens, individuals with high or low continuous fertilization capacity can be screened out, solving the problems of high cost and low efficiency in existing technologies and achieving efficient and precise selection in breeder chicken breeding.

CN120082658BActive Publication Date: 2025-12-05INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510337374.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-21
Publication Date
2025-12-05
Estimated Expiration
2045-03-21

AI Technical Summary

Technical Problem

Existing technologies are costly and inefficient in selecting and breeding healthy breeder chickens with sustained fertilization capabilities, making it difficult to achieve early and precise trait selection.

Method used

This invention provides a SNP molecular marker associated with the sustained fertilization ability of healthy breeding chickens in the later stages of reproduction. By detecting the genotype of the SNP locus, individuals with high or low sustained fertilization ability can be screened out. Specific primer pairs are designed for genotype identification and can be used for breeding chickens.

Benefits of technology

This has enabled precise selection of breeding chickens at the genetic level to improve their ability to continuously fertilize in the later stages of reproduction, thus improving breeding efficiency and accuracy, reducing the frequency of artificial insemination and individual damage, and promoting the development of the breeding chicken industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120082658B_ABST
    Figure CN120082658B_ABST
Patent Text Reader

Abstract

The present application relates to the field of livestock breeding technology, and discloses a molecular marker related to the sustained fertilization ability of a healthy breeding hen in the later stage of reproduction and application thereof.The molecular marker related to the sustained fertilization ability of a healthy breeding hen in the later stage of reproduction is the 251st nucleotide in SEQ ID NO:1, and the polymorphic form is C or G.The SNP molecular marker related to the sustained fertilization ability of a healthy breeding hen in the later stage of reproduction provided by the present application can be used to select the sustained fertilization ability of a healthy breeding hen in the later stage of reproduction at the genetic level, directly screen the sustained fertilization ability of a healthy breeding hen in the later stage of reproduction from the root source, accurately grasp the genetic information, effectively avoid the disadvantages of traditional methods, significantly improve the efficiency and accuracy of selection, and can be applied to large-scale breeding hen breeding practice to promote industrial development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of livestock and poultry breeding technology, and more specifically, to a molecular marker related to the sustained fertilization ability of healthy breeding chickens in the later stages of reproduction and its application. Background Technology

[0002] The sustained fertilization capacity of a hen refers to its ability to continuously produce fertilized eggs for a period of time after receiving semen from a rooster under artificial insemination or natural mating conditions. Within a healthy flock of hens, there is significant variation in sustained fertilization capacity among different breeds and individuals, ranging from as long as 4 weeks to as short as 0-4 days. Hens with shorter sustained fertilization capacities inevitably reduce fertilization rates and increase the labor intensity of artificial insemination. Given the increasingly longer breeding cycles of breeder chickens, selecting individuals that can maintain sustained fertilization capacity for a longer period in the later stages of egg production helps reduce the frequency of artificial insemination and minimizes individual injury and disease infection caused by insemination. Determining the sustained fertilization capacity of hens is time-consuming and labor-intensive, requiring continuous egg collection and incubation over a considerable period to obtain results. This necessitates further optimization of the cost and breeding progress of traditional breeding methods based on trait testing and pedigree combinations. Genome-wide association analysis (GWAS) can uncover genetic variations such as SNPs associated with complex traits at the genome level. Using molecular markers like SNPs for selection of these variations enables early and precise selection of traits, thereby improving breeding efficiency and genetic progress at the genetic level. Based on this, a molecular marker associated with the sustained fertilization ability of healthy breeder chickens in the later stages of reproduction is proposed, and its application in breeder selection holds promise for developing breeder chickens that can maintain sustained fertilization ability for a longer period in the later stages of egg production. Summary of the Invention

[0003] The purpose of this invention is to provide a molecular marker related to the sustained fertilization ability of healthy breeding chickens in the later stages of reproduction and its application.

[0004] To achieve the above objectives, the present invention provides the following technical solution:

[0005] One of the technical solutions of this invention:

[0006] A SNP molecular marker associated with the sustained fertilization ability of healthy breeding chickens in the later stages of reproduction, wherein the SNP molecular marker is nucleotide 251 in SEQ ID NO: 1, and the polymorphism is C or G.

[0007] Furthermore, when the SNP molecular marker is CC genotype, the breeder chickens have high continuous fertilization ability in the later stages of reproduction; when the SNP molecular marker is GG genotype, the breeder chickens have low continuous fertilization ability in the later stages of reproduction.

[0008] The second technical solution of this invention:

[0009] A primer pair for detecting SNP molecular markers related to the sustained fertilization ability of healthy breeding chickens in the later stages of reproduction, wherein the upstream primer has the nucleotide sequence GCTACACCAGTGCTGAATAGAT and the downstream primer has the nucleotide sequence CTGCCAACACCACAAAGAAAC.

[0010] The third technical solution of this invention:

[0011] The above-mentioned application of a SNP molecular marker related to the sustained fertilization ability of healthy breeding chickens in the later stages of reproduction in identifying or assisting in the identification of the sustained fertilization ability of breeding chickens in the later stages of reproduction is as follows: the application is to detect the genotype of SNP in the test chickens, and the test chickens with the CC genotype are individuals with high sustained fertilization ability, and the test chickens with the GG genotype are individuals with low sustained fertilization ability.

[0012] Fourth technical solution of the present invention:

[0013] The above-mentioned application of a SNP molecular marker related to the sustained fertilization ability of healthy breeding chickens in the later stages of reproduction in chicken breeding is as follows: the application is to detect the genotype of SNP in the chicken to be tested, and select parents with the genotype CC for breeding of strains with high sustained fertilization ability.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0015] This invention provides an SNP molecular marker related to the sustained fertilization ability of healthy breeding chickens in the later stages of reproduction. It can select for sustained fertilization ability of breeding chickens in the later stages of reproduction at the gene level, directly screen for sustained fertilization ability of breeding chickens in the later stages of reproduction from the root, accurately grasp genetic information, effectively avoid the drawbacks of traditional methods, significantly improve the efficiency and accuracy of breeding, and can be applied on a large scale in breeding chicken practice to promote the development of the industry.

[0016] This invention provides a primer pair for detecting SNP molecular markers related to the sustained fertilization ability of healthy breeding chickens in the later stages of reproduction, which further facilitates the detection of SNP molecular markers and the identification of genotypes, and provides strong technical support for breeding chickens. Attached Figure Description

[0017] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Furthermore, the same reference numerals denote the same parts throughout the drawings. In the drawings:

[0018] Figure 1Manhattan plot of genome-wide association analysis of the trait of effective fertilization days at 90 weeks of age in breeder chickens. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention. It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the present invention.

[0020] Furthermore, regarding the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included within this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Example 1

[0025] Identifying SNP molecular markers related to the ability of breeding chickens to sustain fertilization in the later stages of reproduction.

[0026] 1. Laboratory animals

[0027] This embodiment uses a mixed population of 444 birds (including White Leghorn chickens, Beijing Oil chickens, and reciprocal crosses of White Leghorn and Beijing Oil chickens). During the rearing period, the birds were allowed free access to feed and water, and the rearing standards followed the relevant provisions of the industry standard (NY / T 33-2004).

[0028] 2. Phenotypic determination

[0029] When the flock is raised to 90 weeks of age, healthy breeding chickens are artificially inseminated twice. The number of days between the first and last fertilized eggs laid within 18 days (effective fertilization days) is recorded to reflect the continuous fertilization ability of breeding chickens in the later stage of reproduction.

[0030] 3. Extraction of genomic DNA

[0031] 0.5 mL of venous blood was collected from the wing vein of all experimental chickens using anticoagulated vacuum blood collection tubes. Whole-genome DNA was extracted using the phenol-chloroform extraction method. DNA samples meeting the required concentration and purity were then subjected to agarose gel electrophoresis to further assess the purity and integrity of the DNA samples. Sample concentrations were required to be greater than 50 ng / μL, with a purity OD260 / 280 of 1.8–2.0 and good integrity. DNA samples were stored at -20℃ until use.

[0032] 4. Genome resequencing

[0033] DNA samples from all experimental chickens were resequencing their entire genomes using the DNBSEQ sequencing platform according to standard operating procedures, with a sequencing depth of approximately 15×. Sequence alignment and genotype extraction were performed using BWA and GATK software. After further quality control using SNP count rate and MAF, 11,892,646 SNPs and 444 individuals were obtained for subsequent analysis.

[0034] 5. Genome-wide association analysis

[0035] After compiling pedigree data, phenotypic data, and genomic SNP locus data, a genome-wide association analysis was performed using ADDO software. The univariate mixed linear model was as follows:

[0036] y = Xb + jα + u + e

[0037] y - phenotypic value;

[0038] b - Fixed effects (including population effects and egg production at 18 days);

[0039] X – The corresponding relation matrix;

[0040] j – Additive genotype of the SNP locus to be detected;

[0041] α-Additive SNP effect;

[0042] u - Random animal effects, subject to Where G is the genome additive relation matrix. It is additive genetic variance;

[0043] e-obey The residual effect, where I is the identity matrix, This refers to the residual variance. The significance threshold is defined as P < 1E⁻⁵.

[0044] GWAS analysis results are as follows Figure 1 As shown, the effective fertilization days at 90 weeks of age in breeder chickens is significantly associated with the 26.87 Mb region on chromosome 2 (chr2:80507424-107379873). Further verification of all loci in the associated region of the genome led to the identification of the chr2:107372399 locus as a candidate locus.

[0045] The genetic markers affecting the number of days of effective fertilization in breeder chickens at 90 weeks of age are shown in Table 1.

[0046] Table 1 Genetic markers affecting the number of days of effective fertilization in chickens at 90 weeks of age.

[0047]

[0048] Example 2

[0049] Correlation between different genotypes at the chr2:107372399 locus and the sustained fertilization capacity of breeder chickens in the later stages of reproduction

[0050] 1. Laboratory animals

[0051] This embodiment uses a mixed population of 444 birds (including White Leghorn chickens, Beijing Oil chickens, and reciprocal crosses of White Leghorn and Beijing Oil chickens). During the rearing period, the birds were allowed free access to feed and water, and the rearing standards followed the relevant provisions of the industry standard (NY / T 33-2004).

[0052] 2. Phenotypic determination

[0053] When the flock is raised to 90 weeks of age, after two consecutive artificial inseminations, the number of days between the first and last fertilized eggs laid within 18 days (effective fertilization days) is recorded to reflect the continuous fertilization ability of the breeder chickens in the later stages of reproduction.

[0054] 3. Extraction of genomic DNA

[0055] 0.5 mL of venous blood was collected from the wing vein of all experimental chickens using anticoagulated vacuum blood collection tubes. Whole-genome DNA was extracted using the phenol-chloroform extraction method. DNA samples meeting the required concentration and purity were then subjected to agarose gel electrophoresis to further assess the purity and integrity of the DNA samples. Sample concentrations were required to be greater than 50 ng / μL, with a purity OD260 / 280 of 1.8–2.0 and good integrity. DNA samples were stored at -20℃ until use.

[0056] 4. Genotyping at the chr2:107372399 locus

[0057] DNA samples from all experimental chickens were resequencing their entire genomes using the DNBSEQ sequencing platform according to standard operating procedures, with a sequencing depth of approximately 15×. Sequence alignment and genotype extraction were performed using BWA and GATK software. After further quality control using SNP count rate and MAF, 11,892,646 SNPs and 444 individuals were obtained for subsequent analysis.

[0058] After organizing the pedigree data, phenotypic data, and genomic SNP locus data, the chr2:107372399 locus was identified, and the genotype of the chr2:107372399 locus was classified into three types: GG genotype, CG genotype, and CC genotype.

[0059] 5. Determination of phenotypic dominant genotypes

[0060] Table 2 shows the effective fertilization days at 90 weeks of age for individuals with different genotypes at the chr2:107372399 SNP locus in chickens. At the chr2:107372399 locus, the effective fertilization days at 90 weeks of age were 6.13 days for individuals with the GG genotype, 8.32 days for individuals with the CG genotype, and 9.93 days for individuals with the CC genotype.

[0061] Data show that the CC genotype is significantly associated with a longer effective fertilization period, while the GG genotype is associated with a shorter effective fertilization period.

[0062] Table 2. Number of days of effective fertilization at 90 weeks of age in individuals with different genotypes at the chicken chr2:107372399 SNP locus.

[0063]

[0064] Example 3

[0065] Establishment of a molecular marker detection method for the chr2:107372399 SNP site and its application in breeding

[0066] 1. Construction of molecular marker detection method

[0067] Based on the DNA sequence information near the chr2:107372399 SNP site published in the Ensemble database, this embodiment designed and synthesized specific primers for PCR amplification.

[0068] The nucleotide sequence of SEQ ID NO: 1 corresponds to the nucleotide at position 107372399 from the 5' end on chromosome 2 and the region 250 bases upstream and downstream of it.

[0069] SEQ ID NO: 1:

[0070] TGGACACACCAGCTCTCCAGACACAGCTACACCAGTGCTGAATAGATGGGAAGGATCAGCTCTCTTG

[0071] ACTTGCTGGCAACGCCCTTCCACATGCAGCCCAGGGAACTGTTGGCCTCCTTGCTGTGAGGATGCAG

[0072] TACTGAGTTACATTCAACTTGGTATCCACCAGGGCCCACAGGTCTTTTTTCTGCCACGGGACTTTCCAGACGTTTGGCCCCAACGTATTTTGGGGCATAGGGTTTTTCCTGCCCAGTG / CCAAGATTCTGCAC TTTTCTTTGAACATCAACAATGAACATGGGAAGGAATCAGTAATAGGTAACGTTTATGACACTGATTACAGTGCAGTTCTCTCAATGTTCCATGAAGAAAAGCTGATGAGAATACATTTTGTATGTAAAATATTTGTGTGAGATATTGTGCTTTCCAGAAAATGGAAGTAGGACTTCATAGAATGCTGCCCATGCAAAAAACAAAACAACCCTGTTTCTTTGTGGTGTTGGCAG

[0073] The PCR amplification primer sequences are shown in Table 3;

[0074] Table 3 PCR amplification primer sequences

[0075]

[0076] The PCR amplification system is shown in Table 4;

[0077] Table 4 PCR amplification system

[0078]

[0079]

[0080] PCR amplification conditions are shown in Table 5;

[0081] Table 5 PCR amplification conditions

[0082]

[0083] The amplified products were analyzed using first-generation sequencing technology to determine the genotype at the chr2:107372399 locus; the genotype results covered three types: GG, CG, and CC.

[0084] 2. Using the chr2:107372399 molecular marker to select breeder chickens for sustained fertilization during the later stages of reproduction.

[0085] In order to select individuals with high continuous fertilization capacity in the later stage of breeding, this embodiment selected 92 healthy white Leghorn chickens as research subjects. At 5 weeks of age, blood samples were collected from each research subject, and then genomic DNA was extracted according to step 3 of embodiment 1. The target site sequence was amplified using specific primers, and genotyping was carried out using first-generation sequencing technology.

[0086] The genotyping results showed that there were 7 individuals with the GG genotype, 43 individuals with the CG genotype, and 42 individuals with the CC genotype.

[0087] Given the advantage of longer fertilization days for certain genotypes, individuals with the CC genotype were preferentially selected. Subsequently, these chickens were raised to 90 weeks of age, and their effective fertilization days were measured. Table 6 shows the correlation between the chicken chr2:107372399 SNP locus in White Leghorn chickens and the effective fertilization days at 90 weeks of age for different genotypes. The average effective fertilization days at 90 weeks of age were 3.57 days for the GG genotype, 7.30 days for the CG genotype, and 8.86 days for the CC genotype. Table 6 shows the correlation between the chicken chr2:107372399 SNP locus in White Leghorn chickens and the effective fertilization days at 90 weeks of age.

[0088] Table 6. Correlation between the chicken chr2:107372399 locus and the number of days of effective fertilization at 90 weeks of age in different genotypes of White Leghorn chickens.

[0089]

[0090] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the specific implementation of the present invention. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. A primer pair of a SNP molecular marker related to the persistent fertility ability of a breeder hen in the later reproductive period for use in identifying or assisting in identifying the persistent fertility ability of a breeder hen in the later reproductive period, characterized in that, the primer pair of the SNP molecular marker is SEQ ID NO: 1 and SEQ ID NO:

2. The application is specifically: detecting the genotype of the SNP in the to-be-tested chicken, the to-be-tested chicken individual with the genotype of CC is an individual with high sustained fertility, and the to-be-tested chicken individual with the genotype of GG is an individual with low sustained fertility; the breeding chicken is a white leihang chicken, a Beijing oil chicken and a white leihang and Beijing oil chicken crossbreeding population; In the primer pair for detecting the SNP molecular marker related to the sustained fertility of the breeding chicken in the later period of health, the nucleotide sequence of the upstream primer is GCTACACCAGTGCTGAATAGAT, and the nucleotide sequence of the downstream primer is CTGCCAACACCACAAAGAAAC.

2. The primer pair of the SNP molecular marker related to the persistent fertility of the breeding late-stage of the healthy breeding chicken of claim 1 in the chicken breeding, characterized in that, The application is specifically: detecting the genotype of the SNP in the to-be-tested chicken, selecting the parent with the genotype of CC to breed the high sustained fertility strain, and the breeding chicken is a white leihang chicken, a Beijing oil chicken and a white leihang and Beijing oil chicken crossbreeding population.

Citation Information

Patent Citations

  • SNP molecular markers related to chicken-fertilization duration time characters and application thereof

    CN105506086A

  • SNP molecular marker related to sperm storage capacity of hen and application of SNP molecular marker

    CN109943640A