Preparation method and application of TCR-T targeting FAM114A1 mutant tumor neoantigen in hepatocellular carcinoma

By screening and integrating the CDR3 sequence targeting the FAM114A1 mutant HCC neoantigen HCC3, TCR-T cells that can recognize and attack specific HLA-A02:01 positive and FAM114A1 mutant HCC cells were constructed, which solved the problem of difficult to effectively target the treatment of advanced hepatocellular carcinoma in the prior art and achieved efficient individualized therapeutic effects.

CN120098131APending Publication Date: 2025-06-06XIAMEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510275511.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-10
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art is difficult to effectively target the identification and treatment of advanced hepatocellular carcinoma (HCC), especially due to the huge differences in HLA typing and tumor antigen expression in different patients, making it difficult to widely use individualized TCR-T cell therapy.

Method used

By screening out the CDR3 sequence targeting the neoantigen HCC3 of the FAM114A1 mutant HCC tumor, and integrating it into T cells, TCR-T cells with targeting function were constructed, allowing them to recognize and attack HLA-A02:01 positive and expressing FAM114A1 mutation.

Benefits of technology

The efficient identification and killing of specific HLA-A02:01-positive and FAM114A1 mutant HCC cells was achieved, providing an individualized treatment plan, significantly improving the treatment effect and prognosis of patients with advanced hepatocellular carcinoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120098131A_ABST
    Figure CN120098131A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method and application of TCR-T targeting FAM114A1 mutant tumor neoantigen in hepatocellular carcinoma, and relates to molecular biology. By acquiring mutation analysis data of liver cancer and para-carcinoma tissues of an HCC patient, the tumor neoantigen HCC3 with an FAM114A1 mutation source is obtained through multi-step screening. And further obtaining a CDR3 sequence targeting the antigen, wherein the CDR3 sequence comprises an Alpha chain CDR3 amino acid sequence, a Beta chain CDR3 amino acid sequence and the like. TCR lentiviral vectors are constructed by using the sequences, TCR-T is constructed through the steps of extraction of endotoxin-free plasmids, connection, lentivirus packaging and the like, and the killing function of the TCR-T on T2 cells presenting FAM114A1 mutant antigen peptide is detected. The screened CDR3 sequence and the constructed TCR-T cell can be used for immunotherapy of hepatocellular carcinoma, and have a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and relates to a CDR3 sequence capable of targeting and recognizing a new tumor antigen from a FAM114A1 mutant hepatocellular carcinoma (HCC) and an application thereof on a TCR-T. Background Art

[0002] Primary liver cancer mainly includes hepatocellular carcinoma and intrahepatic bile duct carcinoma, of which hepatocellular carcinoma accounts for about 75% to 85% of cases. However, many HCC patients are diagnosed at an advanced stage, missing the best time for surgical intervention. Due to the lack of effective treatments, patients with advanced hepatocellular carcinoma face a grim prognosis. In view of this, there is an urgent need to develop innovative and effective treatment strategies to improve the treatment effect and prognosis of patients with advanced hepatocellular carcinoma.

[0003] Adoptive immunotherapy is a highly promising treatment method that injects autologous or allogeneic immune effector cells activated and expanded in vitro into the patient's body to target infections, autoimmune diseases and malignancies. Engineered T cell receptor-T cell (TCR-T) therapy and chimeric antigen receptor T cell (CAR-T), as the two newest and most effective adoptive immunotherapy technologies, have received widespread attention in recent years. In clinical trials, TCR-T therapy is particularly suitable for the treatment of solid tumors because of its ability to recognize intracellular antigens and its high sensitivity to low-copy number antigens.

[0004] Since TCR-T cells need to recognize both intracellular antigens and corresponding HLAs, and different patients may have huge differences in HLA typing and expressed tumor antigens, it is necessary to customize individualized TCR-T cells for each / each type of tumor patient. The key is to screen TCRs that specifically recognize tumor antigens. After screening specific TCRs, not only can specific targeting of tumor intracellular antigens be achieved, but it also plays a key role in anti-tumor immunity. Summary of the invention

[0005] The first purpose of the present invention is to provide a CDR3 sequence that can target FAM114A1 mutant HCC tumor neoantigens, which is a key sequence that can specifically recognize the mutant tumor neoantigens and provide a core material basis for the construction of TCR-T cells.

[0006] The second purpose of the present invention is to provide a method for preparing TCR-T cells, integrate the screened CDR3 sequences into T cells, and construct TCR-T cells with targeting function, so that they have the ability to recognize and attack liver cancer cells with FAM114A1 mutations.

[0007] The third object of the present invention is to provide the application of the prepared TCR-T, which can be used in the immunotherapy of HCC and provide potential candidate drugs for TCR-T cell therapy of hepatocellular carcinoma.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions.

[0009] A CDR3 sequence that can target FAM114A1 mutant HCC tumor neoantigens, comprising:

[0010] Alpha chain CDR3 amino acid sequence (as shown in SEQ ID NO: 1 in the sequence listing):

[0011] CILLSSGDKLTF;

[0012] Beta chain CDR3 amino acid sequence (as shown in SEQ ID NO: 2 in the sequence listing):

[0013] CAGSGTMGTNTGELFF

[0014] Alpha chain CDR3 nucleotide sequence (as shown in SEQ ID NO:3 in the sequence listing):

[0015] TGCATCCTGCTAAGCAGCGGAGACAAGCTGACTTTT;

[0016] Beta chain CDR3 nucleotide sequence (as shown in SEQ ID NO:4 in the sequence listing):

[0017] TGTGCCGGCTCCGGGACAATGGGAACAAACACCGGGGAGCTGTTTTTT;

[0018] The CDR3 sequence can specifically recognize HLA-A 02:01 The presented FAM114A1 mutant antigen peptide HCC3 includes:

[0019] The amino acid sequence of the antigen peptide HCC3 (as shown in SEQ ID NO: 5 in the sequence listing):

[0020] GEEFARHMLTELLFELHVAATPDK;

[0021] The nucleotide sequence of the antigen peptide HCC3 (as shown in the sequence table SEQ ID NO: 6):

[0022] Gctagcggcgaagaatttgcccacatgctgacagaactgctgtttgaactgcatgtggccgccacacctgataaagcggccgc;

[0023] The present invention provides an application of a CDR3 sequence in the preparation of a TCR-T cell for immunotherapy of hepatocellular carcinoma, wherein the TCR-T cell can specifically kill human hepatocellular carcinoma cells (which must meet the following characteristics: ① belonging to a human hepatocellular carcinoma cell line; ② having HLA-A 02:01 restrictive; ③ expressing the tumor neoantigen HCC3 produced by FAM114A1 mutation).

[0024] The method for screening tumor neoantigens in HCC comprises the following steps:

[0025] (1) From the public database NODE ( ) The whole exome sequencing data of liver cancer and adjacent tissues of 159 HCC patients were obtained for mutation analysis, compared with the SNP database, and the mutant genes (antigenic peptides) with a p value < 0.05 were screened, which were defined as those that were not expressed in normal tissues but highly expressed in HCC;

[0026] (2) Calculate peptides and HLA-A using MHC pan4.0 online software 02:01 (pMHC) binding affinity, Rank values ​​< 0.2 were defined as high-affinity antigen peptides;

[0027] (3) Perform overlap analysis on the high-affinity antigen peptides and liquid chromatography-mass spectrometry data, and select the top 20 overlapping genes;

[0028] (4) Five new antigens with the highest frequency that have not been reported for HCC TCR-T immunotherapy were screened out from the above 20 genes and named HCC1, HCC2, HCC3, HCC4, and HCC5;

[0029] (5) T2 cell peptide binding assay was used to further verify whether it could be bound by HLA-A 02:01 Presentation, finally screened out the tumor neoantigen HCC3 derived from FAM114A1 mutation for subsequent experiments. (The amino acid sequence of the antigen peptide HCC3 is shown in the sequence list SEQ ID NO:5, and the nucleotide sequence is shown in the sequence list SEQ ID NO:6)

[0030] A method for obtaining a CDR3 sequence targeting a FAM114A1 mutant tumor neoantigen HCC3 comprises the following steps:

[0031] (1) Synthesize the FAM114A1 mutated HCC neoantigen HCC3;

[0032] (2) HLA-A After the mononuclear cells were isolated from the peripheral blood of volunteers at 02:01, they were stimulated with antigen peptides in vitro, and the targeted HLA was sorted out by pMHC tetramer staining flow cytometry. 02:01 Restricted FAM114A1 mutant neoantigen-specific T cells;

[0033] (3) Extract total RNA of HCC-specific T cells, obtain cDNA by reverse transcription polymerase chain reaction, and obtain TCR immune repertoire by NSG sequencing after multiplex PCR;

[0034] (4) Perform bioinformatics analysis on the immune repertoire to obtain specific CDR3 sequences.

[0035] Alpha chain CDR3 amino acid sequence: CILLSSGDKLTF

[0036] Beta chain CDR3 amino acid sequence: CAGSGTMGTNTGELFF

[0037] Alpha chain CDR3 nucleotide sequence:

[0038] TGCATCCTGCTAAGCAGCGGAGACAAGCTGACTTTT

[0039] Beta chain CDR3 nucleotide sequence: TGTGCCGGCTCCGGGACAATGGGAAAAACACCGGGGAGCTGTTTTTT

[0040] The construction and killing detection of TCR-T targeting FAM114A1 mutant tumor neoantigen HCC3 includes the following steps:

[0041] (1) Constructing a TCR lentiviral vector; the lentiviral vector comprises an EF1α promoter, a TCR α / β-P2A fusion gene, a CopGFP reporter gene, and an MSCV retroviral element.

[0042] (2) Extraction of endotoxin-free plasmids;

[0043] (3) Connect TCR to lentiviral vector plasmid, use 293T cells for lentiviral packaging, and infect healthy HLA-A 02:01 Volunteer PBMC, construct TCR-T;

[0044] (4) Detect the killing function of the TCR-T against T2 cells presenting the FAM114A1 mutant antigen peptide HCC3.

[0045] The CDR3 sequence of the present invention that can target FAM114A1 mutant HCC tumor neoantigen can be used in the preparation of TCR-T cells for immunotherapy of hepatocellular carcinoma.

[0046] The TCR-T cells of the present invention can be used in the preparation of reagents for detecting the killing function of T2 cells presenting FAM114A1 mutant antigen peptides.

[0047] The TCR-T cells of the present invention can be used in the preparation of drugs for treating hepatocellular carcinoma, wherein the hepatocellular carcinoma refers to HLA-A 02:01 positive hepatocellular carcinoma expressing FAM114A1 mutant HCC3.

[0048] The present invention shows that the frequency of the Alpha chain-specific CDR3 sequence is as high as 29% in the immune repertoire obtained after stimulation with the tumor neoantigen HCC3 derived from the FAM114A1 mutation, which is more than 10% higher than the frequency of its non-specific CDR3, and the frequency of the Beta chain-specific CDR3 sequence is as high as 13.1%, which is more than 7% higher than the frequency of its non-specific CDR3. This shows that the CDR3 sequence has antigen specificity and exerts a functional killing effect after antigen peptide stimulation. Therefore, this CDR3 sequence can be used to construct TCR-T targeting HCC3 and verify the killing function.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] The present invention isolates and screens the specific TCR CDR3 sequence targeting FAM114A1 mutation from the peripheral blood of healthy people by optimizing the new antigen screening strategy. TCR-T cells that stably express the specific TCR sequence are constructed by lentiviral packaging, and are verified to have high killing activity against target cells loaded with HCC3 antigen peptides, which can be used for immunotherapy of liver cancer. Experiments show that TCR-T cells constructed based on TCR CDR3 sequences have high killing activity against target cells loaded with HCC3. The present invention is HLA-A 02:01 provides a new personalized treatment for advanced HCC patients who are positive and carry FAM114A1 mutations, filling the gap in TCR-T therapy for this target. Experiments have shown that TCR-T cells constructed based on TCR CDR3 sequences have high killing activity against target cells loaded with HCC3. The present invention is expected to significantly improve the treatment effect and prognosis of patients with advanced hepatocellular carcinoma, and this method has high specificity and effectiveness, which has obvious advantages over traditional treatment methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 It is a technical route flow chart.

[0052] Figure 2 This is a diagram showing the effect of T2 cells presenting antigen peptides.

[0053] Figure 3 It is the double restriction enzyme digestion map of the target plasmid and the original vector plasmid.

[0054] Figure 4 This is the HCC3 TCR-T vector plasmid map.

[0055] Figure 5 The figure shows the killing effect of HCC3 TCR-T on T2 cells presenting antigen peptides. Among them, (a) is the T2 mock group (blank control); (b) is the T2+T cell group, in which T2 cells are co-incubated with normal peripheral blood lymphocytes (T cells); (c) is the T2+HCC3 TCR-T group, in which T2 cells are co-incubated with constructed HCC3-specific TCR-T cells. DETAILED DESCRIPTION

[0056] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the following embodiments will further illustrate the present invention in conjunction with the accompanying drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. On the contrary, the present invention covers any substitution, modification, equivalent method and scheme made on the essence and scope of the present invention as defined by the claims.

[0057] Figure 1 This is a technical route flow chart of an embodiment of the present invention, and the specific steps are as follows:

[0058] The whole exome sequencing data of liver cancer and adjacent tissues of HCC patients were compared with the SNP database to screen out mutant genes that were not expressed in normal tissues but were highly expressed in HCC. MHC pan4.0 online software was used to predict (mutant gene) peptides and HLA-A 02:01 (pMHC) affinity, screening high-affinity antigen peptides, comparing the liquid chromatography-mass spectrometry data for re-analysis, screening out the new antigens with the highest mutation frequency that have not been reported for HCC TCR-T immunotherapy, and using T2 cell peptide binding experiments to further verify whether they can be bound by HLA-A 02:01 Presentation, and finally the new tumor antigens were screened out.

[0059] Targeted HLA-A was isolated from peripheral blood mononuclear cells from healthy donors by in vitro peptide stimulation and pMHC tetramer staining. 02:01 Restricted HCC neoantigen-specific T cells, immune repertoire sequencing was performed to screen high-frequency specific TCR genes, HCC antigen-specific TCR-T cells were prepared by lentiviral packaging, and co-cultured with T2 cells presenting HCC antigen peptides for killing experiments.

[0060] Example 1: Screening and validation of the new antigen HCC3

[0061] From NODE ( ) obtained whole exome sequencing data of liver cancer and adjacent tissues of 159 HCC patients for mutation analysis, compared the sequencing data with the SNP database, and screened out mutant genes that appeared frequently in cancer tissues but did not appear or appeared at a low frequency in adjacent tissues, including FAM114A1 mutations.

[0062] The mutation-related peptide sequences were input into the MHC pan4.0 online software to predict the association with HLA-A The software calculated the binding affinity of HCC3 and HLA-A The Rank value of 02:01 is <0.2, indicating that it has a high affinity.

[0063] Compare NODE ( ) were re-analyzed using liquid chromatography-mass spectrometry data from different sources, and the top 20 overlapping genes were selected. Five new antigens with the highest frequency that had not been reported for HCC TCR-T immunotherapy were screened out from the above 20 genes, including HCC3.

[0064] The FAM114A1 mutation was identified by analyzing the cancer / paracancer mutation data of 159 HCC patients; MHC pan4.0 prediction showed that HCC3 and HLA-A 02:01 has high affinity (Rank < 0.2); mass spectrometry coincidence analysis proves that HCC3 is highly expressed in tumor tissues. This confirms that HCC3 is a high-affinity neoantigen specific for HCC.

[0065] Example 2: Presentation of antigen peptides by T2 cells and screening of HCC3

[0066] (1) T2 cells according to 1 10 5 Each well was plated in a 96-well plate, and HCC1, HCC2, HCC3, HCC4, and HCC5 peptides with a final concentration of 10 ug / mL and β2-microglobulin with a final concentration of 5 ug / mL were added to each well. The plate was placed at 37°C and 5% CO 2 Incubate in an incubator for 18 h;

[0067] (2) After incubation, use HLA-A 02:01 Flow cytometry antibody staining T2 cells were stained for 15 min at 4°C, and HLA-A in T2 cells was detected by flow cytometry. The expression of 02:01 gives the following result: Figure 2 shown.

[0068] Figure 2 The results show that HLA-A in T2 cells increases with the addition of different antigen peptides. There were significant differences in the expression levels of HLA-A in T2 cells after HCC1 stimulation. The expression ratio of 02:01 was 0.16%, HCC2 was 0.23%, HCC3 was as high as 28.5%, HCC4 was 9.12%, HCC5 was 0.091%, and the negative control was 0.082%. The experiment showed that the presentation effect of HCC3 antigen peptide in T2 cells has a significant advantage. Figure 2 It can be seen that the expression level of HLA-A2 in T2 cells after the addition of HCC3 antigen peptide is much higher than that of other antigen peptides (such as HCC1, HCC2, HCC5) and negative controls. The experiment shows that the presentation effect of HCC3 antigen peptide in T2 cells has unique advantages. Highly expressed HLA-A2 means that more HCC3 antigen peptides form complexes with HLA-A2 molecules and are presented on the surface of T2 cells. High presentation efficiency makes HCC3 antigen peptide more likely to be recognized by T cells, thereby playing a key role in TCR-T immunotherapy, indicating that in the study of constructing TCR-T cells for liver cancer immunotherapy, HCC3 as an antigen peptide has higher feasibility and research value, and HCC3 can more effectively trigger the immune response of T cells.

[0069] Example 3: Acquisition and verification of CDR3 sequences targeting FAM114A1 mutant tumor neoantigen HCC3

[0070] (1) Use Ficoll lymphocyte separation medium (Solebo, P8900) for density gradient centrifugation to separate HLA-A 02:01Peripheral blood mononuclear cells (PBMC) from healthy volunteers;

[0071] (2) Synthesis of new tumor antigen HCC3 derived from FAM114A1 mutation:

[0072] The amino acid sequence of antigen peptide HCC3 (as shown in SEQ ID NO:5 in the sequence listing):

[0073] GEEFARHMLTELLFELHVAATPDK;

[0074] Antigenic peptide HCC3 nucleotide sequence (as shown in the sequence listing SEQ ID NO: 6):

[0075] Gctagcggcgaagaatttgcccacatgctgacagaactgctgtttgaactgcatgtggccgccacacctgataaagcggccgc;

[0076] For the antigenic peptides used in the present invention, subsequent experiments were performed;

[0077] (3) The prepared PBMCs were set up into a peptide-free group and a peptide-stimulated group. The peptide-stimulated group was continuously stimulated with HCC3 antigen peptide at a final concentration of 10 ug / ml to produce antigen-specific T cells. After 7 days, pMHC tetramer staining was performed to sort out HCC3-specific CD8 + T cells;

[0078] (4) Extract the total RNA of HCC-specific T cells obtained by sorting, and reverse transcribe the RNA into cDNA using a reverse transcription kit (Yeasen, 11141ES60). Design TCR constant region primers to obtain PCR products of TCR α chain and β chain through two rounds of nested PCR, and perform NGS sequencing to obtain the TCR immune repertoire. Use bioinformatics analysis tools to process and analyze the immune repertoire data, and obtain specific CDR3 sequences through specific algorithms and database comparisons, among which:

[0079] The amino acid sequence of TCRα chain CDR3 is: CILLSSGDKLTF;

[0080] The amino acid sequence of TCRβ chain CDR3 is: CAGSGTMGTNTGELFF;

[0081] The nucleotide sequence of TCRα chain CDR3 is: TGCATCCTGCTAAGCAGCGGAGACAAGCTGACTTTT;

[0082] The nucleotide sequence of TCRβ chain CDR3 is: TGTGCCGGCTCCGGGACAATGGGAACAAACACCGGGGAGCTGTTTTTT.

[0083] The data showed that the frequency of TCR α chain-specific CDR3 was as high as 29%, 10% higher than its non-specific CDR3 frequency, and the frequency of TCR β chain-specific CDR3 was as high as 13.1%, 7% higher than its non-specific CDR3 frequency, indicating that the CDR3 sequence is antigen-specific and exerts a functional killing effect after antigen peptide stimulation.

[0084] Example 4: Construction of TCR-T targeting FAM114A1 mutant tumor neoantigen HCC3

[0085] (1) Synthesizing the target sequence into the target plasmid: First, determine the nucleotide sequences of the TCRα and β chains targeting the FAM114A1 mutant tumor neoantigen HCC3 (as shown in SEQ ID NO: 3 and 4), connect the nucleotide sequences of the target TCRα and β chains using P2A, load them into the pUC57 vector (GenBank: L09137.1) to synthesize the fusion gene, so that the two ends contain NotI and NheI restriction sites respectively;

[0086] (2) The target plasmid and the original vector plasmid (pCDH-MCS-T2A-CopGFP-MSCV) were double-digested with NotI and NheI restriction endonucleases (purchased from New England Biolabs (Beijing) LTD) in a 50uL system and then recovered to recover the target fragment of the target plasmid and the vector fragment of the original vector plasmid; Figure 3 The results of double restriction digestion of the target plasmid and the original vector plasmid are shown. Figure 3 It can be seen that after the target plasmid and the original vector plasmid were double-digested with NotI and NheI restriction endonucleases, bands of different sizes appeared on the gel electrophoresis map. Among them, the position of the fragment band produced by the target plasmid digestion was consistent with the expected size of the fragment containing the target TCRα and β chain nucleotide sequence, indicating that the target gene fragment was successfully cut out from the target plasmid. The original vector plasmid also produced a clear band after digestion, and its size was consistent with the expected vector fragment, which proved the accuracy and effectiveness of the digestion reaction.

[0087] (3) Use T4 DNA ligase (NEB, M0202S) to connect the recovered target fragment and vector fragment in a 10 μL microsystem: target fragment (150 ng), vector fragment (50 ng), T4 ligation buffer (10×), T4 ligase 1 μL, and incubate at 4°C for 16 h. T4 ligase can catalyze the formation of a phosphodiester bond between the 5' phosphate group and the 3' hydroxyl group of the DNA fragment, thereby connecting the target fragment and the vector fragment into a complete recombinant plasmid. After the ligation reaction is completed, the obtained recombinant plasmid is sequenced and verified. The recombinant plasmid is transformed into DH5α competent cells (Biyuntian Biotechnology, D1031S), spread on LB plates containing ampicillin (50 μg / mL), and cultured at 37°C for 12 h. Pick a single clone, extract plasmid DNA for Sanger sequencing (BGI), and confirm the sequence accuracy. By screening positive clones containing recombinant plasmids, extract plasmid DNA for sequencing. The sequencing results were compared with the expected TCRα and β chain fusion gene sequences to ensure that the target gene was accurately connected to the original vector plasmid without errors such as base mutation, deletion or insertion, thereby obtaining the correct HCC3-specific TCR-T lentiviral vector. The lentiviral vector plasmid map is shown in Figure 4 As shown. Figure 4 It can be seen that the layout and function of each key element of HCC3TCR-T, the TCR α / β-P2A fusion gene is correctly inserted downstream of the EF1α promoter of the vector, and the CopGFP reporter gene and MSCV retroviral elements are included. This map provides an important reference for vector construction, transfection and subsequent research on TCR-T cells.

[0088] Example 5: Study on the killing effect of HCC3-specific TCR-T

[0089] (1) The constructed lentiviral vector carrying the TCR gene targeting the FAM114A1 mutant tumor neoantigen HCC3 was packaged using 293T cells to produce a large number of lentiviral particles with infectious activity. The packaged lentiviral supernatant was collected and, after appropriate concentration and purification, infected with healthy HLA-A 02:01 Volunteer PBMC (peripheral blood mononuclear cells) to construct HCC3-specific TCR-T;

[0090] (2) Prepare T2 cells to present antigen peptides in advance. T2 cells follow 1 10 5 The cells were plated into a 96-well plate, and HCC3 peptide at a final concentration of 10 ug / mL and β2-microglobulin at a final concentration of 5 ug / mL were added to each well. The plate was placed at 37°C and 5% CO. 2The cells were cultured in an incubator for 18 h to allow T2 cells to present the HCC3 peptide fragments on the cell surface;

[0091] (3) Use 4 μM CFSE (carboxyfluorescein diacetate succinimidyl ester) to stain effector cells (TCR-T cells / peripheral blood lymphocytes) at 37°C for 15 minutes to ensure that the effector cells are fully labeled with CFSE; after staining, wash the cells with PBS (phosphate buffered saline) to remove unbound CFSE dye. After washing, use a cell counter to accurately count the cells and determine the cell concentration;

[0092] (4) T2 cells presenting antigen peptides are treated according to 1 10 5 100 cells / well were plated into a new 96-well plate as target cells, and TCR-T cells or peripheral blood lymphocytes (T cells) were added as effector cells at an E:T ratio of 3:1. Three groups were set up: T2mock group (blank control), T2+T cell group, and T2+HCC3 TCR-T group;

[0093] (5) Place the 96-well plate in a 37°C, 5% CO 2 Incubate in an incubator for 4 hours to allow the effector cells and target cells to fully contact and interact. After the co-incubation, add PI (propidium iodide) 1 mg / ml for 10 minutes at 37°C for staining. Then use flow cytometry to detect the percentage of T2 cell lysis. Flow cytometry can distinguish between live cells and dead cells based on the intensity of the cell's fluorescent signal, thereby accurately calculating the percentage of target cell lysis. The results are as follows: Figure 5 shown.

[0094] Figure 5 The percentage of T2 cells that are positive (PI+) after PI staining is displayed, that is, the percentage of T2 target cells presenting HCC3 antigen peptides that are lysed. Figure 5 In the T2 mock group (blank control) in Figure (a), the percentage of T2 cells that were positive (PI+) after PI staining was 1.49%, indicating that under normal culture conditions, the T2 cells spontaneously died or the cell membrane was damaged due to nonspecific factors. Figure 5 Figure (b) shows the T2+T cell group, where T2 cells were co-cultured with normal peripheral blood lymphocytes (T cells). The results showed that the percentage of T2 cell lysis was higher than that of the T2 mock group, reaching 15.7%. However, this killing effect was relatively limited, suggesting that normal peripheral blood lymphocytes are not very capable of recognizing and attacking T2 cells presenting specific antigenic peptides. Figure 5In the (c) figure, in the T2+HCC3 TCR-T group, T2 cells were co-cultured with the constructed HCC3-specific TCR-T cells. Figure 5 It can be clearly seen that the percentage of T2 cell lysis was significantly higher than that of the first two groups, and the proportion of PI+ T2 cells was as high as 31.9%, which effectively proved that HCC3-specific TCR-T cells can specifically recognize and efficiently kill T2 cells presenting HCC3 antigen peptides, showing good cytotoxic effects, providing a strong experimental basis for its application in immunotherapy of hepatocellular carcinoma.

[0095] In summary, the present invention provides a CDR3 sequence targeting FAM114A1 mutant HCC tumor neoantigen, and successfully constructs a CDR3 sequence that can specifically recognize and efficiently kill HLA-A 02:01 positive and FAM114A1 mutation expressing TCR-T cells of tumor cells, which are used to prepare drugs for the treatment of hepatocellular carcinoma. Providing a new solution for related hepatocellular carcinoma patients is expected to significantly improve the treatment effect and improve the prognosis of patients, filling the gap in TCR-T therapy for this target, and has important application value and broad development prospects in the field of immunotherapy for hepatocellular carcinoma.

[0096] The above embodiments are only preferred embodiments of the present invention and cannot be considered to limit the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the present invention.

Claims

1. A CDR3 sequence targeting a FAM114A1 mutant HCC tumor neoantigen, characterized in that include: The Alpha chain CDR3 amino acid sequence as shown in SEQ ID NO: 1 in the sequence listing, the Beta chain CDR3 amino acid sequence as shown in SEQ ID NO: 2 in the sequence listing, the Alpha chain CDR3 nucleotide sequence as shown in SEQ ID NO: 3 in the sequence listing, and the Beta chain CDR3 nucleotide sequence as shown in SEQ ID NO: 4 in the sequence listing.

2. A CDR3 sequence targeting a FAM114A1 mutant HCC tumor neoantigen as claimed in claim 1, characterized in that The CDR3 sequence is used to specifically recognize HLA-A 02:01 Presented FAM114A1 mutant antigen peptide HCC3.

3. A CDR3 sequence targeting a FAM114A1 mutant HCC tumor neoantigen as claimed in claim 2, characterized in that The amino acid sequence of the antigen peptide HCC3 is shown in the sequence listing as SEQ ID NO: 5, and the nucleotide sequence is shown in the sequence listing as SEQ ID NO:

6.

4. Use of a CDR3 sequence targeting a FAM114A1 mutant HCC tumor neoantigen as claimed in claim 1 in the preparation of TCR-T cells for immunotherapy of hepatocellular carcinoma.

5. A method for obtaining a CDR3 sequence targeting a FAM114A1 mutant HCC tumor neoantigen HCC3, characterized in that The following steps are involved: (1) Synthesize the FAM114A1 mutated HCC neoantigen HCC3; (2) HLA-A After the mononuclear cells were isolated from the peripheral blood of volunteers at 02:01, they were stimulated with HCC3 antigen peptide in vitro, and the targeted HLA was sorted by pMHC tetramer staining flow cytometry. 02:01 Restricted FAM114A1 mutant neoantigen-specific T cells; (3) Extract total RNA of HCC-specific T cells, obtain cDNA by reverse transcription polymerase chain reaction, and obtain TCR immune repertoire by NSG sequencing after multiplex PCR; (4) Analyze the immune repertoire bioinformatics to obtain the CDR3 sequence as described in claim 1.

6. A method for obtaining a CDR3 sequence targeting a FAM114A1 mutant HCC tumor neoantigen as claimed in claim 5, characterized in that In step (1), the specific steps of synthesizing the FAM114A1 mutated HCC tumor neoantigen HCC3 include the following steps: (1) The whole exome sequencing data of liver cancer and adjacent tissues of HCC patients were obtained from public databases for comparison with the SNP database, and mutant genes with a p-value < 0.05 were screened, which were defined as those that were not expressed in normal tissues but were highly expressed in HCC. (2) Calculate peptides and HLA-A using MHC pan4.0 online software 02:01 (pMHC) affinity, screening high-affinity antigen peptides with a Rank value <0.2; (3) Perform overlap analysis on the high-affinity antigen peptides and liquid chromatography-mass spectrometry data, and select the top 20 overlapping genes; (4) Five new antigens with the highest frequency that have not been reported for HCC TCR-T immunotherapy were screened out from the above 20 genes and named HCC1, HCC2, HCC3, HCC4, and HCC5; (5) T2 cell peptide binding assay was used to further verify whether it could be bound by HLA-A Presented at 02:01, the new tumor antigen HCC3 derived from the FAM114A1 mutation was finally screened out.

7. A method for preparing TCR-T cells targeting FAM114A1 mutant tumor neoantigen HCC3, characterized in that: The following steps are involved: (1) The TCR Alpha chain CDR3 and Beta chain CDR3 nucleotide sequences described in claim 1 are connected by P2A and cloned into a lentiviral vector to construct a recombinant plasmid; (2) Co-transfecting the recombinant plasmid and the packaging plasmid into 293T cells to package lentiviral particles; (3) Infection of HLA-A with lentivirus 02:01 PBMCs from healthy volunteers were screened to obtain TCR-T cells that stably expressed TCR.

8. A method for preparing a TCR-T cell targeting a FAM114A1 mutant tumor neoantigen HCC3 as claimed in claim 7, characterized in that: In step (1), the lentiviral vector comprises an EF1α promoter, a TCR α / β-P2A fusion gene, a CopGFP reporter gene and an MSCV retroviral element.

9. Use of the TCR-T cells prepared by the preparation method according to claim 7 in preparing drugs for treating hepatocellular carcinoma.

10. Use of the TCR-T cells prepared by the preparation method according to claim 7 in preparing a reagent for detecting the killing function of T2 cells presenting the FAM114A1 mutant antigen peptide HCC3.