Monooxygenase and application thereof in synthesis of (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone

Abstract

The invention relates to a monooxygenase and an application of the monooxygenase in synthesis of (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone. Specifically, the invention provides monooxygenase derived from rhizobium sp. 200, a mutant of the monooxygenase, a gene of the monooxygenase, a recombinant expression vector containing the gene, a recombinant expression transformant containing the gene, and a method for catalyzing 5-chloro-1-oxo-2, 3, 4-triazole-1-carboxylic acid by using the monooxygenase or the mutant of the monooxygenase or the recombinant expression transformant as a catalyst. The invention relates to application of (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone as an active intermediate of indoxacarb to preparation of (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone through asymmetric hydroxylation reaction of 2, 3-dihydro-1H-indene-2-carboxylic acid methyl ester and 2, 3-dihydro-1H-indene-2-carboxylic acid methyl ester. Based on the scheme of the invention, the process for preparing the indoxacarb active intermediate (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone is simple and convenient, the reaction conditions are mild, the conversion rate is high, and the optical purity and enantioselectivity of the product are remarkably improved. The environment burden is remarkably reduced based on an enzyme catalysis-based green synthesis path, and the method has excellent industrial application potential.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering technology, and in particular relates to a monooxygenase derived from Bradyrhizobium sp. 200, a mutant thereof, a gene thereof, a recombinant expression vector containing the gene and a recombinant expression transformant, and an application of the monooxygenase or its mutant or recombinant expression transformant as a catalyst to catalyze the asymmetric hydroxylation reaction of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester, thereby preparing an indoxacarb active intermediate (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone. Background Art

[0002] Indoxacarb is a new type of oxadiazine insecticide developed by DuPont in the United States. It is a representative compound among sodium channel inhibitors. It has a broad-spectrum and highly effective insecticidal effect, especially showing excellent activity against lepidopteran pests. The outstanding advantages of indoxacarb include: highly effective insecticidal activity, excellent environmental compatibility, extremely low toxicity to mammals, and safety to birds, fish and beneficial organisms. Therefore, it is regarded as an ideal choice to replace highly toxic organophosphorus insecticides. It is worth emphasizing that the insecticidal activity of indoxacarb is only provided by its (S)-isomer, while the (R)-isomer has no biological activity. Therefore, the preparation of indoxacarb through the active intermediate of indoxacarb (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone is a reasonable way to obtain indoxacarb.

[0003] Chinese patents CN102924278B and CN115896188B both disclose methods for chemically synthesizing the active intermediate of indoxacarb (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone. However, the chemical synthesis method requires the use of organic reagents, the reaction conditions are relatively harsh, and there are also problems such as low product selectivity and insufficient stereoselectivity.

[0004] As an efficient biocatalyst, enzymes can significantly accelerate biological and chemical reactions in industrial production. Their catalytic process has significant advantages such as mild reaction conditions, less pollution, high safety, and low energy consumption. Therefore, they show broad application prospects in the preparation of active intermediates of indoxacarb.

[0005] Therefore, the development of efficient bioenzymes to catalyze the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester has important practical significance and application value for improving the green level of industrial production and the stereoselectivity of the reaction. Summary of the invention

[0006] The purpose of the present invention is to develop a suitable enzyme for preparing an active intermediate of indoxacarb by a biological enzyme. Based on this, the present invention provides a monooxygenase derived from Bradyrhizobium sp. 200, a mutant thereof, a gene thereof, a recombinant expression vector containing the gene and a recombinant expression transformant, and the use of the monooxygenase mutant or the recombinant expression transformant as a catalyst to catalyze the asymmetric hydroxylation reaction of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester, thereby preparing an active intermediate of indoxacarb (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone.

[0007] The present invention has discovered a monooxygenase with high catalytic activity and strong selectivity from rhizobium (Bradyrhizobium sp. 200) through gene mining. The present invention further provides a recombinant expression vector and a recombinant expression transformant comprising the monooxygenase or a mutant gene thereof, and the use of the monooxygenase mutant or the recombinant expression transformant as a catalyst to catalyze the asymmetric hydroxylation reaction of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester, thereby preparing the active intermediate of indoxacarb (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone.

[0008] The purpose of the present invention can be achieved by the following technical solutions:

[0009] One of the technical solutions of the present invention is to provide a monooxygenase, which is a protein as follows (a) or (b):

[0010] Protein (a): a protein consisting of the amino acid sequence shown in SEQ ID No. 2;

[0011] Protein (b): a protein derived from (a) in which several amino acids are substituted, deleted or added in the amino acid sequence shown in SEQ ID No. 2, and which can catalyze the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester to prepare the indoxacarb active intermediate (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone, and has a higher catalytic activity than (a).

[0012] Furthermore, the monooxygenase of the present invention is derived from a rhizobium (Bradyrhizobium sp. 200), and the sequence information is from GenBank WP_247832616.

[0013] The present invention also provides a method for obtaining the monooxygenase:

[0014] Through large-scale sequence comparison and screening of natural microorganisms and laboratory preserved microbial strains, it was found that Bradyrhizobium sp.200 contains a monooxygenase sequence. The monooxygenase catalyzing the corresponding reaction in Bradyrhizobium sp.200 was obtained by gene synthesis and named monooxygenase BjHAPMO. The amino acid sequence of the monooxygenase is shown in SEQ ID No.2.

[0015] The gene synthesis mentioned in the present invention can be achieved by using conventional biotechnology means in the art.

[0016] The monooxygenase of the invention has the following properties: it can catalyze the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester to prepare the indoxacarb active intermediate (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone.

[0017] The second technical solution of the present invention is to provide an isolated nucleic acid encoding the monooxygenase.

[0018] In one embodiment of the present invention, a monooxygenase gene BjHAPMO is provided, the nucleotide sequence of which is shown in SEQ ID No. 1, and the total length is 1965 nucleotide bases. The coding sequence (CDS) thereof starts from the first base to the 1965th base, the start codon is ATG, the stop codon is TAA, and there is no intron. The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 2.

[0019] The present invention also provides that the source of the DNA encoding the monooxygenase BjHAPMO includes: obtaining the DNA encoding the monooxygenase BjHAPMO by gene cloning technology, or obtaining the DNA encoding the monooxygenase BjHAPMO by artificial full sequence synthesis.

[0020] In one embodiment of the present invention, the monooxygenase BjHAPMO gene of the present invention is derived from rhizobium. The specific preparation method of its encoding DNA includes: using the genomic DNA of rhizobium as a template, synthesizing the complete DNA sequence of monooxygenase BjHAPMO, and using conventional technical methods in the art (such as polymerase chain reaction, PCR) to obtain the complete DNA sequence encoding the monooxygenase BjHAPMO.

[0021] The synthetic primers involved are preferably shown as SEQ ID No.3 (upstream primer) and SEQ ID No.4 (downstream primer):

[0022] Upstream primer: 5'-GGGAATTC CATATG ACCGTTCAAGAACTCA-3', the underlined sequence is the restriction endonuclease Nde I cleavage site;

[0023] Downstream primer: 5'-CCG CTCGAG ACGTTCGGTCGCGGTAGAAAC-3', the underlined sequence is the restriction endonuclease Xho I cleavage site.

[0024] The third technical solution of the present invention is to provide a recombinant expression vector comprising the monooxygenase gene nucleic acid.

[0025] The recombinant expression vector can be constructed by cloning the monooxygenase (preferably BjHAPMO) gene into various expression vectors using conventional methods in the art.

[0026] The expression vector preferably includes various conventional plasmid vectors in the art, and preferably is pET28a plasmid.

[0027] Preferably, the recombinant expression vector of the present invention can be prepared by the following method: the gene sequence DNA fragment of the monooxygenase BjHAPMO obtained by PCR amplification is double-digested with restriction endonucleases Nde I and Xho I, and the empty plasmid pET28a is double-digested with restriction endonucleases Nde I and Xho I, the gene DNA fragment of the monooxygenase BjHAPMO and the pET28a plasmid after the above enzyme digestion are recovered, and they are connected by T4 DNA ligase to construct a recombinant expression vector pET28a-BjHAPMO containing the monooxygenase BjHAPMO gene.

[0028] The fourth technical solution of the present invention is to provide a recombinant expression transformant comprising the recombinant expression vector.

[0029] The recombinant expression transformant can be prepared by transforming the above recombinant expression vector into a host cell.

[0030] In some embodiments of the present invention, the host cell is a conventional host cell in the art, as long as the recombinant expression vector can stably replicate itself and the gene of the monooxygenase BjHAPMO carried by it can be effectively expressed.

[0031] In some embodiments of the present invention, the host cell is preferably Escherichia coli, and more preferably is Escherichia coli BL21 (DE3) or Escherichia coli DH5α.

[0032] The recombinant expression vector is transformed into E. coli BL21 (DE3) to obtain the preferred genetically engineered strain of the present invention. For example, the recombinant expression vector pET28a-BjHAPMO is transformed into E. coli BL21 (DE3) to obtain recombinant E. coli BL21 (DE3) / pET28a-BjHAPMO.

[0033] Technical solution 5 of the present invention: Provide a monooxygenase catalyst selected from any one of the following forms:

[0034] (1) culturing the recombinant expression transformant and isolating transformant cells containing the monooxygenase;

[0035] (2) culturing the recombinant expression transformant, isolating transformant cells containing the monooxygenase, and disrupting the transformant cells containing the monooxygenase to obtain a cell disrupted liquid;

[0036] (3) culturing the recombinant expression transformant, isolating transformant cells containing the monooxygenase, disrupting the transformant cells containing the monooxygenase, obtaining a cell disrupted liquid, and freeze-drying the cell disrupted liquid of the monooxygenase to obtain a freeze-dried enzyme powder;

[0037] (4) The monooxygenase BjHAPMO or a mutant of the monooxygenase BjHAPMO, wherein the mutant of the monooxygenase BjHAPMO refers to a protein in which several amino acids are substituted, deleted or added in the amino acid sequence shown in SEQ ID No. 2 and which can catalyze the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester to prepare the indoxacarb active intermediate (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone and has improved catalytic activity.

[0038] The invention also provides a method for preparing the monooxygenase catalyst.

[0039] The preparation method of the recombinant monooxygenase BjHAPMO of the present invention is preferably: culturing the recombinant expression transformant as described above, and isolating and obtaining the recombinant expressed monooxygenase BjHAPMO. The culture medium used for culturing the recombinant expression transformant is any culture medium in the art that can grow the transformant and produce the recombinant monooxygenase of the present invention. The culture medium is preferably LB culture medium, and its formula is: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, pH 7.0. There are no special restrictions on the culture method and culture conditions. According to different factors such as host cell type and culture method, appropriate selection can be made according to the conventional knowledge in the art, as long as the transformant can grow and produce the monooxygenase BjHAPMO. The specific operation of culturing the recombinant expression transformant can be carried out according to conventional operations in the art. Preferably, the recombinant Escherichia coli described in the present invention, such as E. coli BL21 (DE3) / pET28a-BjHAPMO, is inoculated into LB culture medium containing kanamycin and cultured at 37°C. When the optical density OD 600 When the concentration reaches 0.5-1.0 (preferably 0.6), add isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.1-1.0 mmol / L (preferably 0.5 mmol / L) to induce enzyme production, and continue to culture at 16°C for 24 hours to efficiently express the monooxygenase BjHAPMO of the present invention. After the culture is completed, the precipitated bacterial cells are collected by centrifugation, which are the resting cells of the recombinant expression transformant; the harvested cells are suspended in PBS buffer (100 mM, pH 6.0), ultrasonically disrupted, the disrupted liquid is centrifuged, and the supernatant is collected to obtain the crude enzyme solution of the recombinant monooxygenase BjHAPMO; the cell precipitate harvested by centrifugation is freeze-dried to obtain freeze-dried cells, which is conducive to long-term storage and convenient for future use.

[0040] Activity determination of monooxygenase BjHAPMO: Preheat 1 ml reaction system (50 mmol / L sodium phosphate buffer, pH 8.0) containing 2 mmol / L p-methylacetophenone and 0.2 mmol / L NADPH to 30°C, then add an appropriate amount of crude monooxygenase BjHAPMO enzyme solution, mix well, and keep the reaction at 30°C. Detect the absorbance change of NADPH at 340 nm on a spectrophotometer, and record the change in absorbance within a certain period of time.

[0041] The enzyme activity was calculated according to the following formula:

[0042] Enzyme activity (U) = EW × V × 10 3 / (6220×l)

[0043] Where, EW is the change in absorbance at 340 nm within 1 minute; V is the volume of the reaction solution, in ml; 6220 is the molar extinction coefficient of NADPH, in L / (mol·cm); l is the optical path distance, in cm. One enzyme activity unit (U) corresponds to the amount of enzyme required to oxidize 1 μmol NADPH per minute under the above conditions.

[0044] Technical solution six of the present invention: providing the use of the monooxygenase in the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester.

[0045] The chemical structure of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester is shown below:

[0046]

[0047] Furthermore, the monooxygenase catalyst is provided to catalyze the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid, thereby preparing the indoxacarb active intermediate (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone.

[0048] In one embodiment of the present invention, the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid can be carried out according to the following exemplary method: in a phosphate buffer at pH 7-8, in the presence of glucose dehydrogenase, glucose and NADP + In the presence of, under the action of the monooxygenase catalyst, the asymmetric hydroxylation reaction of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid is catalyzed to obtain the indoxacarb active intermediate (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone.

[0049] In the application, the concentration of the substrate in the reaction solution can be 0.1 to 20 mmol / L. According to the reaction system used, the amount of the monooxygenase can be 1 to 200 U / L. When the enzymatic asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid is performed, the coenzyme NADPH is oxidized to generate NADP + In order to recycle the coenzyme NADPH, glucose and glucose dehydrogenase from Bacillus megaterium are additionally added to the reaction system (JInd Microb Biotechnol, 2011, 38: 633-641). Depending on the reaction system, the activity unit loading of glucose dehydrogenase can be equal to that of the monooxygenase. The molar ratio of glucose to substrate can be 1.0 to 1.5, and the additional NADP +The dosage can be 0-1.0 mmol / L. The buffer is a sodium phosphate buffer, preferably with a pH range of 6.5-8.5, more preferably pH 8.0. The concentration of the phosphate buffer can be 0.05-0.2 mol / L. The temperature of the enzymatic asymmetric reduction reaction can be 25-40°C, preferably 30°C. During the reaction, intermittent sampling is performed to determine the reaction conversion rate. The reaction time is based on the time when the substrate is completely converted or the reaction conversion rate stops increasing, which is generally 1-24 hours.

[0050] The reaction conversion rate can be analyzed by liquid chromatography. Preferably, a chromatographic column ZORBAX RR EclipseXDB-C18 (4.6 mm×250 mm×5 μm) is used for conversion rate analysis. The column temperature is constant at 30° C. and the detection wavelength is 210 nm. Mobile phase: 0.1% trifluoroacetic acid (A), 0.1% trifluoroacetic acid (acetonitrile) (B); gradient elution: 10% B (0.01 min), 100% B (12.5 min), 100% B (14 min), 10% B (15 min), stop (20 min); flow rate: 0.8 ml / min.

[0051] The reaction product can be analyzed by liquid chromatography, preferably, using a chromatographic column Chiralpak AD-H (25 cm×4.6 mm×5 μm) for enantiomeric excess (ee) analysis, with a detection wavelength of 210 nm, a mobile phase of n-hexane / ethanol = 90:10, and a flow rate of 0.8 ml / min.

[0052] Compared with the prior art, the positive and progressive effects of the present invention are:

[0053] The monooxygenase BjHAPMO provided by the present invention can stereoselectively catalyze the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid to prepare the indoxacarb active intermediate (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone, has mild reaction conditions, high conversion rate, good product optical purity, and an ee value higher than 90%, and has good industrial application prospects. DETAILED DESCRIPTION

[0054] Each reaction or detection condition described in the summary of the invention can be combined or changed according to common knowledge in the art, and can be verified by experiments. The present invention is further described below by way of examples. It should be understood that although the examples listed list preferred embodiments of the present invention, the specific examples listed are only given to better illustrate the present invention, and the present invention is not therefore limited to the scope of the examples.

[0055] The sources of materials in the following examples are:

[0056] Bradyrhizobium sp. 200, the sequence information of Bradyrhizobium sp. 200 comes from GenBank WP_247832616.

[0057] The expression plasmid pET28a was purchased from Novagen.

[0058] E. coli DH5α and E. coli BL21 (DE3) competent cells, 2× Taq PCR MasterMix, and agarose gel DNA recovery kit were purchased from Beijing Tiangen Biochemical Technology Co., Ltd.

[0059] Restriction endonucleases Nde I and Xho I are both commercially available products from New England Biolabs (NEB).

[0060] Unless otherwise stated, the specific experiments in the following examples were performed according to conventional methods and conditions in the art, or in accordance with the commercial instructions of the kits.

[0061] Example 1 Gene cloning of monooxygenase BjHAPMO

[0062] The genomic DNA of rhizobium (Bradyrhizobium sp. 200) was used as a template, the monooxygenase sequence was determined by sequence comparison, and codon optimization was performed to synthesize the complete DNA sequence of the monooxygenase BjHAPMO. Conventional technical methods in the art (such as polymerase chain reaction, PCR) were used to obtain the complete DNA sequence encoding the monooxygenase BjHAPMO.

[0063] The synthetic primers involved are preferably shown as SEQ ID No.3 (upstream primer) and SEQ ID No.4 (downstream primer):

[0064] Upstream primer: 5'-GGGAATTC CATATG ACCGTTCAAGAACTCA-3'

[0065] Downstream primer: 5'-CCG CTCGAG ACGTTCGGTCGCGGTAGAAAC-3'

[0066] Among them, the underlined part of the upstream primer is the restriction endonuclease Nde I restriction endonuclease cleavage site, the underlined part of the downstream primer is the restriction endonuclease Xho I restriction endonuclease cleavage site.

[0067] The PCR system was as follows: 2× Taq PCR Master Mix 25 μl, upstream primer and downstream primer (10 ng / μl) 2.5 μl each, 1 μl genomic DNA of monooxygenase BjHAPMO (100 ng / μl), and 19 μl ddHO. 2 O. The PCR amplification procedure was: 95°C pre-denaturation for 5 minutes followed by 32 cycles of: 94°C denaturation for 30 seconds, 50°C annealing for 30 seconds, and 72°C extension for 5 minutes; after the cycle was completed, a final extension at 72°C for 10 minutes. The PCR amplification product was purified by gel electrophoresis, and the target fragment was recovered using a DNA recovery kit. After DNA sequencing, the open reading frame encoded by the sequence was 1965 bp in length, and its base sequence is shown in SEQ ID No. 1.

[0068] Example 2 Preparation of monooxygenase BjHAPMO expression plasmid and recombinant expression transformant

[0069] The monooxygenase target DNA fragment obtained by PCR amplification in Example 1 and the pET28a empty plasmid were double-digested with restriction endonucleases Nde I and Xho I overnight, and then purified by agarose gel electrophoresis and recovered by a DNA kit. The recovered enzyme-digested target fragment and the empty vector were separated and plated on a T 4 Under the action of DNA ligase, the two strands were connected at 4°C for 12 hours to obtain the recombinant plasmid pET28a-BjHAPMO.

[0070] The obtained recombinant plasmid was transformed into E.coli DH5α, spread on LB medium plates containing 50μg / ml kanamycin, and cultured at 37°C for 8 hours. The grown colonies were verified by colony PCR, and positive clones that successfully amplified the target band were picked. After sequencing verification, the corresponding plasmid was extracted and further transformed into E.coli BL21(DE3), and positive clones were picked to obtain the recombinant expression transformant E.coli BL21(DE3) / pET28a-BjHAPMO.

[0071] Example 3 Inducible expression of monooxygenase BjHAPMO

[0072] The recombinant expression transformant E. coli BL21 (DE3) / pET28a-BjHAPMO obtained in Example 2 was inoculated into LB medium containing 50 μg / ml kanamycin and cultured in a shaking incubator at 37 ° C for 12 hours. Then, the inoculum was inoculated into a 500 ml conical flask containing 100 ml LB medium (containing 50 μg / ml kanamycin) at a rate of 1% (v / v), and the inoculum was placed in a shaking incubator at 37 ° C and 180 rpm. When the OD of the culture solution reached 600When it reached 0.6, IPTG was added to a final concentration of 0.2 mmol / L for induction. After induction at 16°C for 24 hours, the culture medium was centrifuged at 12000 rpm, the cell precipitate was collected and washed with physiological saline to obtain resting cells, which were freeze-dried to obtain lyophilized cells.

[0073] 5g of resting cells obtained by the above method were suspended in 100ml of sodium phosphate buffer (100mM, pH 6.0), ultrasonically disrupted in an ice-water bath, and the supernatant was collected by centrifugation to obtain the crude enzyme solution of the recombinant monooxygenase BjHAPMO. The obtained crude enzyme solution was analyzed by polyacrylamide gel electrophoresis, and the recombinant monooxygenase BjHAPMO existed in a soluble form. The obtained crude enzyme solution of the recombinant monooxygenase BjHAPMO was freeze-dried to obtain the crude enzyme powder of the recombinant monooxygenase BjHAPMO.

[0074] Example 4 Effect of pH on the catalytic activity of monooxygenase BjHAPMO

[0075] The effect of pH on the activity of the recombinant monooxygenase BjHAPMO was determined by standard methods in the range of pH 6 to 9. The buffers were citric acid-sodium citrate buffer (5.0 to 6.0), sodium phosphate buffer (6.0 to 8.0), Tris-HCl buffer (7.0 to 9.0), and glycine-NaOH buffer (8.0 to 11).

[0076] In 1 ml of the above buffer system, p-nitroacetophenone and NADPH were added to final concentrations of 2 mmol / L and 0.2 mmol / L, respectively, preheated to 30°C, and then an appropriate amount of monooxygenase was added, mixed evenly, and kept at 30°C for reaction. The absorbance change of NADPH at 340 nm was detected on a spectrophotometer, and the activity difference of monooxygenase BjHAPMO in buffer solutions of different pH was determined. The results are shown in Table 1. The preferred pH range of the enzymatic reaction is 7.5 to 8.5, and more preferably pH 8.0.

[0077] Table 1 Effect of pH on the asymmetric catalytic hydroxylation activity of BjHAPMO

[0078]

[0079]

[0080] Example 5 Effect of temperature on the catalytic activity of monooxygenase BjHAPMO

[0081] In a 1 ml sodium phosphate buffer (50 mM, pH 8.0) system, p-nitroacetophenone and NADPH were added to a final concentration of 2 mmol / L and 0.2 mmol / L, respectively, and preheated for 2 min in a 25-45°C environment, and then an appropriate amount of monooxygenase was added, mixed evenly, and kept in a temperature environment at the same preheating temperature for reaction, and the absorbance change of NADPH at 340 nm was detected on a spectrophotometer, and the activity difference of monooxygenase BjHAPMO under different temperature conditions was determined, and the results are shown in Table 2. The preferred temperature range of the enzymatic reaction is 30-40°C.

[0082] Table 2 Effect of temperature on the asymmetric catalytic hydroxylation activity of BjHAPMO

[0083]

[0084]

[0085] Example 6 Recombinant monooxygenase BjHAPMO catalyzes the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid to synthesize (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone

[0086] 5 g of BjHAPMO crude enzyme powder as described in Example 3 and 3 U of glucose dehydrogenase freeze-dried enzyme powder were added to 1 ml of sodium phosphate buffer (50 mmol / L, pH 8.0), and 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid, glucose and NADP+ were added to the final concentrations of 2 mmol / L, 3 mmol / L and 0.2 mmol / L, respectively. The reaction was carried out at 30°C and the reaction was shaken at 1000 rpm. The reaction was carried out for 12 hours, and the substrate conversion rate was measured by liquid chromatography to be >99%.

[0087] After the reaction was completed, 2 volumes of ethyl acetate were used for extraction, and the extracted organic phase was air-dried in a fume hood. After the sample was dried, the ee value of the product was measured by liquid chromatography and was higher than 90%.

[0088] The sequence information involved in the present invention is as follows:

[0089] SEQ ID No.1 Nucleotide sequence of monooxygenase gene BjHAPMO

[0090]

[0091] Amino acid sequence of monooxygenase BjHAPMO of SEQ ID No.2

[0092] MTVQELKTLQASGPQRGTSHGAELQHHIQCGADLPTLLMTTAHTTGDLSVLRNGWRPVDVLGVAQCNVSDEEKALIREECYRRLADHSKRGGQPPVRPTYDLLRGIGEWFLGSSIEPLIPLLAEELIFDGHDLRQPQWNKETIAPDRPFHVAIIGAGESGIIAAVRFKQAGIPFTIYEKNGDVGGTWLENHYPGCRVDINSFVYSYASAPRVWHDYFGLRNETLSYLQKVARDNGLYEHTKFGAEIAEAVWSDTEQVWRLTINSAGKTETVSPNMIVFAVGQLNRPKLPEIAGIDRFKGESFHSAQWNHNVTFEGKRIGVIGTGASACQFIPQIANVAAKVTVFARTATWLLPTPNLHERVEGSERWLFENLPGYAQWYRGSLLMLQTPGILEYVIVDPNYAASEQAVSESNNFVRQELQQWIEAQIAERPDLRDALIPNSPVGSKRILRDNGTWAKTLKRDNVAVVREKISEIITDGIRCADGNSHEFDVIVYGTGFHASKFLFPIKVRGANGCSLQDAWKDGARAYLGMTIPQFPNMFCMYGPNTNLVVHGASIVMFSELTAKYIVDAVRVMLEKGAATMDVREEVFSGYDRRVDEANRARAWGYSKVNSWYKDANGRVGQNYPFTATEFYQRTNAVVAADYRFGPVSTATER

[0093] Upstream primer of SEQ ID No.3

[0094] gggaattc catatg accgttcaagaactca 30

[0095] Downstream primer of SEQ ID No.4

[0096] ccg ctcgag acgttcggtcgcggtagaaac 30

[0097] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A monooxygenase, characterized in that It is a protein of (a) or (b): Protein (a): a protein consisting of the amino acid sequence shown in SEQ ID No. 2; Protein (b): a protein derived from (a) in which several amino acids are substituted, deleted or added in the amino acid sequence shown in SEQ ID No. 2, and which can catalyze the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester to prepare the indoxacarb active intermediate (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone, and has a higher catalytic activity than (a).

2. An isolated nucleic acid, characterized in that The nucleic acid encodes the monooxygenase of claim 1.

3. An isolated nucleic acid according to claim 2, characterized in that The nucleotide sequence of the monooxygenase gene is shown in SEQ ID No.

1.

4. A recombinant expression vector, characterized in that: It comprises the nucleic acid according to claim 2.

5. A recombinant expression transformant, characterized in that: It comprises the recombinant expression vector as claimed in claim 4.

6. A monooxygenase catalyst, characterized in that Choose from any of the following: (1) culturing the recombinant expression transformant according to claim 5, and isolating transformant cells containing the monooxygenase according to claim 1; (2) culturing the recombinant expression transformant according to claim 5, isolating transformant cells containing the monooxygenase according to claim 1, and disrupting the transformant cells containing the monooxygenase to obtain a cell disrupted liquid; (3) culturing the recombinant expression transformant according to claim 5, isolating transformant cells containing the monooxygenase according to claim 1, disrupting the transformant cells containing the monooxygenase, obtaining a cell disrupted liquid, and freeze-drying the cell disrupted liquid of the monooxygenase to obtain a lyophilized enzyme powder; (4) The monooxygenase according to claim 1.

7. The use of the monooxygenase catalyst according to claim 6, characterized in that: The monooxygenase catalyst is used in catalyzing the asymmetric hydroxylation of 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester to prepare optically active (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone.

8. The use according to claim 7, characterized in that: In glucose dehydrogenase, glucose and NADP + In the presence of and under the action of the monooxygenase catalyst, 5-chloro-1-oxo-2,3-dihydro-1H-indene-2-carboxylic acid methyl ester is catalyzed to asymmetric hydroxylate to prepare optically active (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone.

9. The use according to claim 8, characterized in that: The concentration of the substrate in the reaction solution is 0.1-20 mmol / L, the amount of monooxygenase in the monooxygenase catalyst is 0.1-200 U / L, the molar ratio of glucose to substrate is 1.0-1.5, and the additional NADP + The dosage is 0-1.0 mmol / L; the pH range of the reaction system is 6.0-10.0, and the temperature of the asymmetric reduction reaction is 25-40°C.

10. The use according to claim 7, characterized in that: After the asymmetric hydroxylation reaction is completed, (S)-5-chloro-2-methoxycarbonyl-2-hydroxy-1-indanone is converted by chemical method to prepare indoxacarb.

Images