Construction of gene-driven model aiming at Seh1 and application of gene-driven model in pest control

Abstract

The invention discloses construction of a gene-driven model aiming at Seh1 and application of the gene-driven model in pest control. A construction method comprises the following steps: (1) constructing an expression vector of gRNA; (2) constructing a gRNA upstream and downstream homologous arm vector; (3) constructing a nos-cas9 carrier; (4) combining the sequences of the three vectors in the steps (1)-(3) into the same vector to obtain a homologous recombination repair donor vector co-expressed by gRNA and cas9; and (5) introducing the donor vector, the gRNA and the cas9 protein into a w1118 fruit fly embryo, culturing an adult from the embryo, hybridizing the adult with a fruit fly with a balanced chromosome, and identifying the screened heterozygote fruit fly, namely the seh1 gene driven mutant fruit fly. Seh1 gene mutation is spread in a wild population through gene driving, so that the female fertility of the population is greatly reduced, the overall fertility of the population is reduced, population inhibition is realized, and a new thought is provided for research in the fields of disease prevention and control, agricultural pest prevention and control, ecological protection and the like.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the construction of a gene drive model for Seh1 and its application in pest control. Background Art

[0002] Insects belong to arthropods among invertebrates and are the most numerous animal group on Earth. At present, there are more than 1 million known species of insects, with various shapes and huge numbers, which are closely related to agricultural production and human health. Research on insects can not only enrich human understanding of nature, but also help solve major problems faced in actual production and human disease prevention and control. In particular, basic research and applied research on insect immunity has always been a hot topic. Experimental research on mechanisms, signals and other issues related to insect immunity has very important practical significance for pest control, beneficial insect disease prevention, drug development, and research on human immune mechanisms.

[0003] As a model insect, fruit flies have the advantages of being easy to culture in the laboratory and convenient for genetic manipulation, and can provide a good reference for research on killing pests.

[0004] Gene Drive technology is a biotechnology that uses genetic engineering to rapidly spread specific genes in a population. Its core goal is to break the traditional Mendel's law of inheritance and make the probability of inheritance of the target gene in the offspring exceed 50%. This technology has potential application value in the fields of disease prevention and control, agricultural pest control and ecological protection. The breakthrough of CRISPR gene editing technology in 2012 provided an efficient tool for gene drive.

[0005] Currently, the commonly used CRISPR gene editing technology is used to produce deletion mutations or point mutations in the coding region of the target gene, which can make the target gene lose its function and be used for scientific research related to gene function. Without external intervention and artificial selection, the mutant will disappear in the wild population as the generations grow. The gene drive technology inserts the elements that can cause the target gene mutation into the target gene region, and introduces mutations at new homologous sites while causing the target gene mutation, thereby achieving the effect of increasing mutations. Selecting genes that target reproduction for gene drive can achieve the purpose of population control. However, since gene drive mutants need to introduce more and more complex elements into the genome and have low efficiency, there is currently a lack of gene drive models related to fruit flies. Summary of the invention

[0006] In response to the above-mentioned problem of the lack of gene drive models related to fruit flies, the present invention provides a construction of a gene drive model for Seh1 and its application in pest control. Through gene drive, the Seh1 gene mutation can be spread in the wild-type population, resulting in a significant decrease in the female fertility of the population, thereby reducing the overall fertility of the population and achieving population suppression, providing a new idea for research in the fields of disease prevention and control, agricultural pest control and ecological protection.

[0007] The Seh1 (SEC13 homolog 1) gene encodes the Seh1 protein in Drosophila, which is a component of the GATOR2 complex (GAPActivity Towards Rags 2). It is mainly involved in regulating the mTOR signaling pathway (mammalian target of rapamycin pathway), affecting protein synthesis, autophagy and cell proliferation. Mutation defects in the Seh1 gene can cause abnormal ovarian development in female Drosophila, and the inability to produce normal eggs for reproduction, leading to female infertility. However, mutations in the Seh1 gene do not affect Drosophila survival and male reproductive capacity, making it a good candidate target.

[0008] In order to achieve the above objectives, the present invention provides, on the one hand, a gRNA for driving Seh1 gene mutation, which includes sg1 as shown in SEQ ID NO.1 and sg2 as shown in SEQ ID NO.2.

[0009] gRNA sequence design and sample preparation methods are as follows:

[0010] The S1.1 target site was selected in the first 1 / 2 of the gene CDS and the CDS part after ATG to ensure that all isoforms and most amino acid sequences of seh1 could be destroyed;

[0011] S1.2 Perform PCR and sequencing on Drosophila genomic DNA to ensure that the gRNA sequence is consistent with the actual Drosophila target site sequence. After sequencing confirmation, the gRNA sequence to be prepared is obtained as follows (PAM is in brackets and is not included in the actual gRNA sequence):

[0012] seh1-MCR sg1 (SEQ ID NO.1): GGTGCGATCAAATGAGCATG (TGG)

[0013] seh1-MCR sg2(SEQ ID NO.2):GCATTATGAACCTCTCGCAG(TGG)

[0014] S1.3 Prepare gRNA by in vitro transcription: First, use the pBSK-gRNA-scaffold plasmid as a PCR template to obtain the purified DNA fragment as a template for gRNA in vitro transcription, then obtain gRNA through in vitro transcription of the T7 promoter, and finally purify the final gRNA product.

[0015] The second aspect of the present invention provides a method for constructing a gene drive model for Seh1. The gene drive mutant designed and constructed by the present invention is to insert the cas9 and gRNA co-expression elements into the 5' end position of the CDS of the chromosome seh1 gene (such as Figure 1 As shown in the figure). This mutant fruit fly can express cas9 and seh1-gRNA in vivo while destroying the seh1 gene, which can edit the wild-type seh1 gene on the homologous chromosome. And because the homologous chromosomes are close in space, the sister chromatid carrying the driver element can act as a donor, inserting the driver element into the sister chromatid of the wild-type seh1 gene through HR homologous recombination, realizing the automatic and efficient transfer of the driver element.

[0016] Among them, the driving elements of cas9 selected by the present invention are nos promoter and 3UTR, which can allow the gene drive to occur specifically in germ cells, so as to improve the effectiveness, targeting and efficiency of gene drive. The gRNA uses the same sequence as the plasmid pCFD5, U6 is used as the promoter, and transcription is performed by tRNA tandem. This method has a higher gRNA transcription efficiency.

[0017] The construction method includes the following steps:

[0018] (1) constructing the expression vector of the above-mentioned gRNA;

[0019] (2) Construction of gRNA upstream and downstream homology arm vectors;

[0020] (3) Construction of nos-cas9 vector;

[0021] (4) merging the sequences of the three vectors in steps (1)-(3) into the same vector to obtain a homologous recombination repair donor vector in which gRNA and cas9 are co-expressed;

[0022] (5) The donor vector, gRNA and cas9 protein are introduced into w1118 fruit fly embryos. After the embryos are cultured into adults, they are hybridized with fruit flies carrying balanced chromosomes. The heterozygous fruit flies selected are identified and identified as seh1 gene-driven mutant fruit flies.

[0023] Specifically, in step (1), the expression vector of the gRNA is a U6-tRNA-seh1-gRNA plasmid vector, and its construction method includes:

[0024] (1.1) PCR amplification of pBSK plasmid was performed using primers pBSK-F and pBSK-R to obtain fragment 1;

[0025] (1.2) Using primers pBSK-pCFD5-F and seh1-sg1-R, PCR amplification was performed on the pCFD5 plasmid to obtain fragment 2;

[0026] (1.3) Using primers seh1-sg1-F and seh1-sg2-R, PCR amplification was performed on the pCFD5 plasmid to obtain fragment 3;

[0027] (1.4) Using primers seh1-sg2-F and pBSK-pCFD5-R, PCR amplification was performed on the pCFD5 plasmid to obtain fragment 4;

[0028] (1.5) The above four DNA fragments were subjected to electrophoresis, gel excision and recovery, connected by seamless cloning and connection method, transformed into competent T1, and plasmid extraction was performed after correct sequencing to obtain U6-tRNA-seh1-gRNA plasmid vector.

[0029] In step (2), the gRNA upstream and downstream homology arm vector is a pBSK-seh1-arm plasmid vector, and its construction method includes:

[0030] (2.1) PCR amplification of pBSK plasmid was performed using primers pBSK-F and pBSK-R to obtain fragment 1;

[0031] (2.2) Using primers pBSK-seh1-5arm-F and seh1-5arm-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 2: a seh1 5' homology arm DNA fragment of about 1500 bp;

[0032] (2.3) Using primers seh1-3arm-F and pBSK-seh1-3arm-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 3: a seh1 3' homology arm DNA fragment of about 1500 bp;

[0033] (2.4) The three DNA fragments were subjected to electrophoresis, gel excision and recovery, connected by seamless cloning and connection method, transformed into competent T1, and plasmid extraction was performed after correct sequencing to obtain the pBSK-seh1-arm plasmid vector.

[0034] In step (3), the nos-cas9 vector is a pBSK-nos5UTR-cas9-nos3UTR plasmid vector, and its construction method includes:

[0035] (3.1) Using primers pBSK-F and pBSK-R, PCR amplification was performed on the pBSK plasmid to obtain fragment 1;

[0036] (3.2) Using primers nos-promoter-F and nos-promoter-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 2;

[0037] (3.3) Using primers nos-3UTR-F and nos-3UTR-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 3;

[0038] (3.4) Using primers cas9-F and cas9-R, PCR amplification was performed on the BDSC54595 Drosophila genomic DNA to obtain fragment 4: a Drosophila melanogaster codon-optimized cas9 CDS full sequence DNA fragment;

[0039] (3.5) The above four DNA fragments were subjected to electrophoresis, gel excision and recovery, connected by seamless cloning and connection method, transformed into competent T1, and plasmid extraction was performed after correct sequencing to obtain the pBSK-nos5UTR-cas9-nos3UTR plasmid vector.

[0040] In step (4), the method for constructing the donor vector includes:

[0041] (4.1) pBSK-seh1-arm was digested with endonucleases HindIII and AscI to obtain fragment 1;

[0042] (4.2) Using primers seh1-5arm-cas9-F and gRNA-cas9-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 2: seh1 5' homology arm DNA fragment;

[0043] (4.3) Using primers gRNA-cas9-F and seh1-3arm-gRNA-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 3: seh1 3' homology arm DNA fragment;

[0044] (4.4) The three DNA fragments were subjected to electrophoresis, gel-cutting and recovery, connected by seamless cloning and connection method, transformed into competent T1, and plasmids were extracted after correct sequencing to obtain the final donor vector seh1-MCR.

[0045] In step (5), the fruit fly carrying the balance chromosome is a fruit fly with chromosome 2 carrying the cyO balance chromosome.

[0046] Drosophila embryos were microinjected as follows:

[0047] (5.1) Preparation and administration of injection samples:

[0048] The seh1-MCR donor vector contains gRNA and cas9 endogenous expression elements. In theory, even if only the plasmid is injected into the fruit fly embryo without adding any other components, gRNA and cas9 can be expressed in the fruit fly, producing positive results of gene editing. However, considering that the sequence of the inserted element is long and complex, the editing efficiency is reduced. The present invention also adds in vitro expressed gRNA and cas9 proteins to the injection sample, mixes with the donor vector, and performs microinjection into the fruit fly embryo, which significantly improves the efficiency and success rate of obtaining positive gene-driven mutants.

[0049] (5.2) Rearing, embryo preparation and microinjection of injected fruit flies:

[0050] The injected fruit flies were fresh w1118 embryos to ensure that positive gene drive mutants could be obtained successfully.

[0051] (5.3) Identification of mutant fruit flies and establishment of strains:

[0052] The G0 adult is hybridized with the balancer fruit fly, and the positive is identified after the hybridization is successful, and the positive hybridization tube is picked. After the G0 positive tube offspring G1 generation produces an adult, a single hybrid balancer fruit fly is hybridized, and the G1 generation is identified as positive after the hybridization is successful, and the positive tube is picked. After the G1 positive tube offspring G2 generation produces an adult, the fruit fly with the correct genotype and phenotype is self-pollinated to make a stable strain. Since the mutant female is homozygous and sterile, the present invention does not make it into a homozygous system for preservation. After making it into a G2 stable strain, the gene-driven mutant fruit fly is successfully constructed.

[0053] The third aspect of the present invention provides the application of the driving model obtained by the above-mentioned construction method in inhibiting the reproduction of fruit fly populations.

[0054] Through the above technical solution, the present invention achieves the following beneficial effects:

[0055] The present invention conducted a preliminary study on the role of the Seh1 gene-driven mutant constructed by the above-mentioned construction method in population size suppression, and found that the Seh1 mutant can significantly inhibit the reproduction of fruit fly populations and control population size, providing tools and ideas for research in the fields of pest control and ecological protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1It is the mutant design strategy of the present invention, the description of each insertion element and the molecular identification strategy;

[0057] Figure 2 This is a positive identification result of the gene-driven mutant of seh1;

[0058] Figure 3 It is a hybrid construction strategy for offspring;

[0059] Figure 4 is the population suppressive effect of the seh1 driver mutant. DETAILED DESCRIPTION

[0060] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0061] Example 1: gRNA sequence design and sample preparation

[0062] 1. Implementation of gRNA Design

[0063] Search the gene name in flybase (http: / / flybase.org / ) and download the gene sequence with 5UTR, CDS, intron, and 3UTR annotations.

[0064] 2. Implementation of gRNA target sequencing

[0065] For Drosophila genomic DNA extraction, GeneStar D101-01 kit was used, and for PCR identification, Vazyme P505-d1 reagent (the same below) was used. The amplification primer sequences are as follows:

[0066]

[0067] 3. Implementation of gRNA preparation by in vitro transcription

[0068] The method of in vitro transcription using the T7 promoter can achieve efficient transcription of a short linear DNA sequence of about 100 bp and synthesize functional gRNA in vitro. The T7 promoter is relatively short, only about 20 bp, and the core key binding site sequence (-17 to -1) is: TAATACGACTCACTATA, followed by the transcription start site "G".

[0069] The full sequence of gRNA includes 20bp gene target sequence + gRNA sacffold. The DNA template required for transcription should be: TAATACGACTCACTATAG (T7 promoter) + 20bp target sequence + gRNA sacffold full sequence, so the forward transcription template PCR primer gRNA-F needs to consist of three parts:

[0070] a: T7 promoter: TAATACGACTCACTATAG;

[0071] b: gRNA target sequence 20 bp;

[0072] c: gRNA scaffold 5' end: GTTTTAGAGCTAGAAATAGC

[0073] The reverse transcription template PCR primer is the universal gRNA scaffold 3' end reverse complementary sequence: AAAAAAAAGCACCGACTCGGTGCCACTT.

[0074] So the specific transcription template PCR primers are as follows:

[0075]

[0076] After the transcription template PCR is completed, it needs to be purified: add 100μL PCR product and 100μL 5M ammonium acetate, mix by pipetting, add 2 times the volume of 400μL anhydrous ethanol, mix by inversion, place in a -20℃ refrigerator for 20min, centrifuge at 4℃, 14000rpm for 15min, carefully remove the supernatant, dry the precipitate in a 37℃ oven for 10-15min, and dissolve it in 10μL Nuclease-free Water (Quanshijin GI101-02).

[0077] The purified template was used for gRNA in vitro transcription using Promega P1320 reagent.

[0078] After in vitro transcription, the transcription product was purified: the transcription reaction system was about 21 μL, supplemented with Nuclease-free Water (Full Gold GI101-02) to 60 μL, added an equal volume of 60 μL of water-saturated phenol / chloroform, centrifuged at 4°C, 14000rpm for 10 min, aspirated 45 μL of supernatant into a 1.5mL RNase-removed EP tube, added 5 μL of 1 / 10 volume of sodium acetate, mixed thoroughly, added 2.5 times the volume of 125 μL of anhydrous ethanol, mixed thoroughly, placed at -20°C for 20 to 30 min, centrifuged at 4°C, 14000rpm for 15 min, carefully aspirated the supernatant, washed the precipitate once with 200 μL of 70% ethanol, centrifuged at 4°C, 14000rpm for 5 min, carefully aspirated the supernatant, dried the precipitate in a 37°C oven for 10 to 15 min, 10 μL Nuclease-free Dissolve in water (Full Gold GI101-02), take 1 μL for electrophoresis identification, the band length is about 100 bp, slightly diffuse, and the gRNA concentration is estimated by comparing with the brightness of the marker.

[0079] Example 2: Construction of homologous recombination repair donor vector co-expressing gRNA and cas9

[0080] 1. The vector construction primer sequences used in the present invention are as follows:

[0081]

[0082]

[0083] 2. The vector sequencing identification primer sequences used in the present invention are as follows:

[0084]

[0085]

[0086] 3. The cloning PCR was performed using Vazyme P505-d1 reagent, and the enzyme digestion was performed using NEB Hind III and Asc I reagents. After obtaining the fragments, agarose gel electrophoresis was performed, and the gel blocks were recovered using the Vazyme DC301-01 kit. The corresponding fragments were connected using the full-form gold CU101-01 seamless ligase. The connection system was 10 μL. After incubation at 50°C for 30 minutes, 50 μL of TransT1 competent cells (full-form gold CU101-01) were transformed. The monoclonal colonies were picked up the next day and Sanger sequencing was performed using the corresponding primers.

[0087] 4. Pick up the cloned colony with correct sequencing, add 50mL LB liquid culture medium containing Amp resistance, shake and culture overnight at 37℃, 220rpm. The next day, pour the culture solution into a 50mL centrifuge tube, centrifuge at 4℃, 8000rpm for 5min, and then use QIAGEN 12143 kit to extract the endotoxin-free plasmid. Dissolve in 50μL Nuclease-free Water (Full Gold GI101-02). Electrophoresis confirms that the band position is correct and there is no impurity band, and the nanodrop instrument determines the plasmid concentration.

[0088] Example 3: Drosophila embryo microinjection

[0089] 1. Sample preparation components and concentrations are as follows:

[0090] Cas9 protein (NEB M0646T): 500 ng / μL;

[0091] gRNA (two gRNAs mixed in equal proportions): 150 ng / μL;

[0092] seh1-MCR donor plasmid: 500ng / μL.

[0093] Before preparing for injection, mix the components of the sample. First, mix the gRNA and cas9 protein in the corresponding proportions, incubate at room temperature for 10 minutes to ensure that the gRNA and cas9 protein bind in vitro, then mix in the donor plasmid, and make up to 30μL with Nuclease-free Water (Quanshijin GI101-02). Centrifuge the prepared sample at 4°C, 14000rpm for 30min. After centrifugation, use a capillary pipette tip (Eppendorf Microloader 20μL) on the clean bench to absorb the supernatant, and blow the sample into the needle from the back of the injection needle for the next injection.

[0094] 2. Specific implementation methods of feeding, embryo preparation and microinjection of injected fruit flies:

[0095] Two weeks before the injection, 50 male and female w1118 fruit flies were placed in a large food tube and cultured in an artificial climate box at 25°C, 60% RH, and 12h / 12h of light for 3 days. After the fruit flies laid enough offspring on the food surface, the adults in the food tube were cleaned and the food tube was cultured for 10 days. After most of the adults in the fruit fly tube emerged, about 400 to 500 fruit flies that emerged within 3 days were collected to ensure that the number of males and females was basically equal. They were placed in a homemade embryo collector, and the agar plate for collecting embryos was buckled and fixed at the bottom. In the evening, it was pretreated in a dark environment at 25°C and 60% RH for 12 hours to stimulate the fruit flies to lay eggs. The next morning, a new agar plate was replaced and cultured for 30 minutes. After that, the embryos collected within 30 minutes were washed with ddH2O. 2 O rinse down into the embryo collector for microinjection.

[0096] Place the coverslip on the slide, use a brush to gently pick the embryos from the embryo collector onto the coverslip, pick out the embryos that are obviously incomplete or overdeveloped, and then arrange the embryos vertically on the coverslip in a row from head to right to tail to left. Each coverslip can hold about 100 embryos. Add some water during placement to keep the embryos moist. After drying, cover all embryos with drops of oil (Sigma H8898) and wait for subsequent microinjection.

[0097] The microinjection needle loaded with the sample was shaken vigorously a few times to expel excess bubbles, and the injection needle was installed on the injection instrument (Eppendorf FemtoJet 4i). It was observed under an inverted microscope (OLYMPUS CKX3), and the needle tip and the embryo were adjusted to the same focal plane. The instrument parameters were adjusted so that the sample was ejected from the needle tip at an appropriate speed. The needle and the embryo formed an angle of 20 to 30 degrees, and the needle tip was inserted into the middle and upper part of the embryo's tail. After staying for a while, when the sample was seen to be obviously diffused in the embryo's tail, the needle was removed from the embryo's tail and the next embryo was injected. The sample was injected into 400 embryos.

[0098] After injection, loosen and stir the food surface with an injection needle, insert the injected embryo together with the glass slide into the large food tube, spray water on the food surface to keep it moist, and culture the food tube in an artificial climate box at 25°C, 60% RH, and 12h / 12h of light for one week. One week after injection, when most of the larvae have pupated on the wall of the food tube, the glass slide can be pulled out and a layer of breathable mesh can be covered on the surface of the food to prevent the adults from being stuck to the wet food after they emerge. 12 days after injection, all the injected fruit flies (G0 generation) in the food tube have emerged, and all the adults are transferred to new food tubes for subsequent hybridization and passaging.

[0099] Example 4: Identification of Drosophila mutants and establishment of strains

[0100] 1. Strategy for identification of mutant Drosophila Figure 1 ):

[0101] Use primers Seh1-5F and nos-p-5R on both sides of homology arm 5arm to perform PCR on the genomic DNA of the fruit fly to be tested, and a PCR product of 1934 bp should be obtained for mutant-positive fruit flies;

[0102] Use primers U6-3F+Seh1-3R on both sides of homology arm 3arm to perform PCR on the genomic DNA of the fruit fly to be tested. The mutant positive fruit fly should obtain a PCR product of 2120bp ( Figure 2 );

[0103] The PCR identification primer sequences are as follows:

[0104]

[0105] 2. Hybridization and identification of G0 generation fruit flies ( Figure 3 ):

[0106] G0 generation male flies and virgin flies were collected, 3-4 G0 generation fruit flies of a single sex were mixed with about 15 Bc / CyO fruit flies of different sexes in a small food tube for hybridization, and the hybridization tubes were numbered accordingly. After 7 days of constant temperature and humidity culture at 25°C and 60% RH, when there were obvious larval offspring (G1 generation) in the hybridization food tube, the G0 generation adults were picked into a 1.5mL EP tube for genome extraction and PCR identification, and two tubes were obtained, numbered: G0-m3 and G0-m4. The hybridization tube corresponding to the correctly numbered genomic DNA was picked and continued to be cultured until the G1 generation adults emerged.

[0107] 3. Identification and hybridization of G1 generation fruit flies:

[0108] In order to ensure that the adult does not die and does not lose its reproductive ability, the specific genotype information of the adult is obtained before mating, the present invention adopts a scheme of extracting the wing genome and performing PCR identification. Knowing that the efficiency and positive rate of constructing mutants in this work are low, this scheme can greatly reduce the workload of hybridization and the cost of reagents and consumables by first screening positives in large quantities and then performing hybridization and passage strategies, so that the success rate of obtaining positive fruit flies is improved and the difficulty of obtaining is greatly reduced. The specific method is:

[0109] Prepare lysis buffer: 10mM Tris-Cl (pH 8.2), 1mM EDTA, 25mM NaCl. Add 2μL proteinase K (Full Gold GE201-01) to every 100μL lysis buffer, pipette and mix well, and use as the final wing DNA lysis buffer.

[0110] Place the fruit fly wings in 10 μL of lysis solution, incubate at 55°C for 30 minutes, and then incubate at 90°C for 2 minutes to inactivate proteinase K, and obtain the wing genomic DNA after lysis. Then perform PCR identification and sequencing to confirm that the sequence is correct. Pick a single fruit fly corresponding to the wing genomic DNA with the correct number, and mix it with 5 balanced sub-strain fruit flies Bc / CyO of different sexes into a small food tube for hybridization. G1 hybridization tubes continue to be cultured at 25°C and 60% RH. After 7 days, when there are many larvae and offspring in the tube, the parents can be cleared and cultured until the G2 generation adults emerge.

[0111] 4. G2 generation fruit fly hybridization and final strain construction:

[0112] G2 generation male flies and virgin flies were collected, and heterozygous male and female flies of the same balancer CyO non-Bc phenotype of G2 generation were mixed into a small food tube for hybridization to obtain a stable genetic strain.

[0113] After the G3 generation emerged, we tried to collect homozygous male and female flies without balancers and mixed them into a small food tube for hybridization, but failed to successfully obtain offspring, proving that the strain was homozygous sterile. Therefore, the CyO heterozygous stable strain was used as the final established strain of the gene drive mutant constructed by the present invention. It can be used for subsequent research.

[0114] Example 5: Preliminary study on the impact of seh1 gene-driven mutants on wild-type populations

[0115] The experimental groups used seh1 gene-driven mutant (seh1-mcr) male flies with the following genotypes: seh1-mcr / CyO;

[0116] As a control group, male homozygous Drosophila of the seh1 common mutant (seh1-KO) were used, and the genotypes were: seh1-KO / CyO;

[0117] Five male flies of each type were crossed with 50 wild-type virgin fruit flies and placed in a large tube for breeding in an artificial climate box at 25°C, 60% RH, and 12h / 12h light intensity.

[0118] After the offspring G1 eclosion, 60 male and female fruit flies of the genotypes of the experimental group seh1-mcr / + and the control group seh1-KO / + were transferred to new tubes for passage and raised under the same conditions for 14 days until all the offspring G2 emerged, and the raising conditions were the same as above;

[0119] During the reproductive process of the G1 generation, the experimental group of fruit flies will produce a gene drive effect, resulting in a substantial increase in the proportion of the seh1-mcr genotype in the G2 generation. To confirm this inference, the present invention performed a one-to-one mating of adult males and females of the G2 generation, and counted the number of tubes with successful hybridization. The results are as follows:

[0120] Total number of hybridization tubes Number of successful hybridization tubes The control group, seh1-KO G2 generation, was self-fertilized 100 68 Experimental group seh1-MCR G2 generation self-fertilization 100 17

[0121] This result shows that most of the fruit flies in the G2 generation of the experimental group lacked reproductive ability, instead of following the first and second laws of genetics like the control group, where only a certain proportion of fruit flies lacked reproductive ability.

[0122] Furthermore, 16 tubes were randomly selected from the experimental group of hybridization failure tubes, and the female fruit flies in them were subjected to molecular identification to determine the specific number and proportion of seh1-mcr gene-driven individuals. Gene-driven positive fruit flies should obtain a PCR product of 337 bp ( Figure 4 ).

[0123] The PCR identification primer sequences are as follows:

[0124]

[0125] The results showed that all the female fruit flies in the hybrid failure tube were gene drive mutants, which was contrary to the proportion of the first and second laws of genetics, proving that this mutant strain had a better gene drive effect.

[0126] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0127] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0128] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A gRNA for driving Seh1 gene mutation, characterized in that: It includes sg1 shown in SEQ ID NO.1 and sg2 shown in SEQ ID NO.

2.

2. A method for constructing a gene drive model for Seh1, characterized in that: The steps include: (1) constructing an expression vector for the gRNA according to claim 1; (2) Construction of gRNA upstream and downstream homology arm vectors; (3) Construction of nos-cas9 vector; (4) merging the sequences of the three vectors in steps (1)-(3) into the same vector to obtain a homologous recombination repair donor vector in which gRNA and cas9 are co-expressed; (5) The donor vector, gRNA and cas9 protein are introduced into w1118 fruit fly embryos. After the embryos are cultured into adults, they are hybridized with fruit flies carrying balanced chromosomes. The heterozygous fruit flies selected are identified and identified as seh1 gene-driven mutant fruit flies.

3. The construction method according to claim 2, characterized in that: In step (1), the expression vector of the gRNA is a U6-tRNA-seh1-gRNA plasmid vector, and its construction method includes: (1.1) PCR amplification of pBSK plasmid was performed using primers pBSK-F and pBSK-R to obtain fragment 1; (1.2) Using primers pBSK-pCFD5-F and seh1-sg1-R, PCR amplification was performed on the pCFD5 plasmid to obtain fragment 2; (1.3) Using primers seh1-sg1-F and seh1-sg2-R, PCR amplification was performed on the pCFD5 plasmid to obtain fragment 3; (1.4) Using primers seh1-sg2-F and pBSK-pCFD5-R, PCR amplification was performed on the pCFD5 plasmid to obtain fragment 4; (1.5) The above four DNA fragments were subjected to electrophoresis, gel excision and recovery, connected by seamless cloning and connection method, transformed into competent T1, and plasmid extraction was performed after correct sequencing to obtain U6-tRNA-seh1-gRNA plasmid vector.

4. The construction method according to claim 2, characterized in that: In step (2), the gRNA upstream and downstream homology arm vector is a pBSK-seh1-arm plasmid vector, and its construction method includes: (2.1) PCR amplification of pBSK plasmid was performed using primers pBSK-F and pBSK-R to obtain fragment 1; (2.2) Using primers pBSK-seh1-5arm-F and seh1-5arm-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 2; (2.3) Using primers seh1-3arm-F and pBSK-seh1-3arm-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 3; (2.4) The three DNA fragments were subjected to electrophoresis, gel excision and recovery, connected by seamless cloning and connection method, transformed into competent T1, and plasmid extraction was performed after correct sequencing to obtain the pBSK-seh1-arm plasmid vector.

5. The construction method according to claim 2, characterized in that: In step (3), the nos-cas9 vector is a pBSK-nos5UTR-cas9-nos3UTR plasmid vector, and its construction method includes: (3.1) Using primers pBSK-F and pBSK-R, PCR amplification was performed on the pBSK plasmid to obtain fragment 1; (3.2) Using primers nos-promoter-F and nos-promoter-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 2; (3.3) Using primers nos-3UTR-F and nos-3UTR-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 3; (3.4) Using primers cas9-F and cas9-R, PCR amplification was performed on the BDSC54595 Drosophila genomic DNA to obtain fragment 4; (3.5) The above four DNA fragments were subjected to electrophoresis, gel excision and recovery, connected by seamless cloning and connection method, transformed into competent T1, and plasmid extraction was performed after correct sequencing to obtain the pBSK-nos5UTR-cas9-nos3UTR plasmid vector.

6. The construction method according to claim 2, characterized in that: In step (4), the method for constructing the donor vector comprises: (4.1) pBSK-seh1-arm was digested with endonucleases HindIII and AscI to obtain fragment 1; (4.2) Using primers seh1-5arm-cas9-F and gRNA-cas9-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 2; (4.3) Using primers gRNA-cas9-F and seh1-3arm-gRNA-R, PCR amplification was performed on w1118 Drosophila genomic DNA to obtain fragment 3; (4.4) The three DNA fragments were subjected to electrophoresis, gel-cutting and recovery, connected by seamless cloning and connection method, transformed into competent T1, and plasmids were extracted after correct sequencing to obtain the final donor vector seh1-MCR.

7. The construction method according to claim 2, characterized in that: In step (5), the fruit fly carrying the balance chromosome is a fruit fly with chromosome 2 carrying the cyO balance chromosome.

8. Use of the driving model obtained by the construction method according to any one of claims 2 to 7 in inhibiting the reproduction of fruit fly populations.

Images