A PHS gene for improving the edible quality of fruits and its application

By overexpressing the PHS gene in kiwi fruit and tomatoes, the problem of insufficient ready-to-eat fruit is solved, the full degradation of fruit starch and the increase of soluble sugars are achieved, and the ready-to-eat and ripening of the fruit is improved.

CN120099047BActive Publication Date: 2025-08-12INST OF BIOLOGICAL RESOURCES JIANGXI ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510580179.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-07
Publication Date
2025-08-12
Estimated Expiration
2045-05-07

AI Technical Summary

Technical Problem

In the prior art, there is a lack of effective means to improve the ready-to-eat properties of kiwi fruits, especially in the softening process of low-temperature pretreatment, which affects the accumulation of soluble sugars in the fruit.

Method used

By cloning and expressing the kiwi fruit α-glucan phosphorylase (PHS) gene, a stable transformation overexpression vector was constructed and plants were transformed using Agrobacterium-mediated methods to achieve overexpression of PHS genes in kiwi fruit and tomatoes, and promote the degradation of fruit starch.

Benefits of technology

It significantly improves the ready-to-eat nature of the fruit, promotes starch degradation during fruit ripening, increases the content of soluble solids, reduces the content of titable acids, and provides germplasm resources for ready-to-eat fruits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099047B_ABST
    Figure CN120099047B_ABST
Patent Text Reader

Abstract

The present invention relates to a PHS gene for improving the edibility of fruit and its application, and relates to the field of biotechnology. The nucleotide sequence of the PHS gene is shown in SEQ ID NO: 1, and the gene is used in the cultivation of transgenic plants with improved edibility of fruit. The present invention discloses a PHS gene for improving the edibility of fruit and its application in regulating the edibility of fruit. The gene can be overexpressed through stable transformation to improve the edibility of fruit, providing a reference for the cultivation of edible plant germplasm resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a PHS gene for improving the edible quality of fruits and its application. Background Art

[0002] Alpha-glucan phosphorylase (PHS) catalyzes the reversible phosphorylation of starch to glucose-1-phosphate in plant tissues. PHS is structurally and functionally similar to glycogen phosphorylase and is found in plants, animals, and bacteria, suggesting that PHS plays an important role in carbohydrate metabolism across diverse life forms. Studies have shown that PHS, lacking the L78 insertion, effectively degrades branched glucans and may act directly on starch granules and participate in the degradation of stored starch in plant organs.

[0003] There have been numerous reports on the cloning and expression analysis of two PHS enzyme subtypes in horticultural plants such as pumpkin, cassava, banana, corn, and mango. Kiwifruit accumulates sugars in a typical starch conversion-type manner, with the soluble sugar content largely dependent on the starch conversion rate during the ripening process. However, there are currently few reports on kiwifruit PHS enzyme genes and their role in promoting kiwifruit fruit softening in response to low-temperature pretreatment. In view of this, the present invention provides a PHS gene and its application for improving the fruit's ready-to-eatness. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a PHS gene and its application for improving the edible quality of fruits. The purpose is to study the PHS gene and apply it to the cultivation of transgenic plants such as kiwifruit and tomatoes that improve the edible quality of fruits.

[0005] The technical solution of the present invention to solve the above technical problems is as follows:

[0006] In a first aspect, a PHS gene for improving the edible quality of fruit is provided. The nucleotide sequence of the PHS gene is shown in SEQ ID NO: 1.

[0007] In a second aspect, an expression vector of a PHS gene for improving the ready-to-eat quality of fruits is provided, wherein the expression vector comprises an initial expression vector and the PHS gene for improving the ready-to-eat quality of fruits.

[0008] Furthermore, the initial expression vector comprises at least one of pBWA(V)HS-GLosgfp, pEarleyGate101, and pCAMBIA1300. The initial expression vector can stably transform and overexpress the PHS gene.

[0009] In a third aspect, a recombinant expression strain of a PHS gene for improving the ready-to-eat quality of fruits is provided, wherein the recombinant expression strain is obtained by transforming an expression vector of a PHS gene for improving the ready-to-eat quality of fruits into Agrobacterium.

[0010] Furthermore, the Agrobacterium includes at least one of Agrobacterium GV3101 and EHA105.

[0011] In a fourth aspect, the PHS gene for improving the edible nature of fruits, or the expression vector of the PHS gene for improving the edible nature of fruits, or the recombinant expression strain of the PHS gene for improving the edible nature of fruits are used in the cultivation of transgenic plants for improving the edible nature of fruits.

[0012] In a fifth aspect, a method for cultivating transgenic plants with improved fruit edibility comprises the following steps:

[0013] (1) using the PHS gene for improving the instant eating quality of fruits to construct an expression vector for the PHS gene for improving the instant eating quality of fruits, and transferring the vector into Agrobacterium to obtain a recombinant expression strain;

[0014] (2) Transforming the recombinant expression strain into the plant to be cultivated, and screening to obtain a transgenic strain with stable inheritance of the PHS gene sequence.

[0015] Furthermore, the PHS gene in step (1) is obtained by the following method: using the cDNA of Actinidia chinensis fruit as a template, PCR amplification of the full-length coding region of the PHS gene is performed.

[0016] Furthermore, the nucleotide sequence of the primer pair for PCR amplification of the full-length coding region of the PHS gene is shown in SEQ ID NO: 2-3.

[0017] Among them, PHS-F1: ATGGCTACTACAGCAGATGCCAA (SED ID NO: 2); PHS-R1: TTATGGTACACAGCACTCCTCTATTTTCCA (SED ID NO: 3).

[0018] Furthermore, the plant to be cultivated includes any one of kiwi fruit and tomato.

[0019] The beneficial effects of the present invention are as follows: the present invention discloses a PHS gene for improving the edibleness of fruits, and its application in regulating the edibleness of fruits. The edibleness of fruits can be improved by stably transforming and overexpressing the gene. The starch degradation of fruits of the overexpressing PHS strain is more complete during the ripening period, the soluble solids content is significantly increased, and the titratable acidity is significantly reduced, providing a reference for cultivating kiwifruit germplasm resources that are ready to eat. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The amino acid sequence encoded by the PHS gene;

[0021] Figure 2 This is the map of the PHS gene overexpression vector;

[0022] Figure 3 Figure 1 is the expression pattern of the PHS gene and the diagram of different developmental stages of the fruit; A is the expression pattern of the PHS gene, and B is the diagram of different developmental stages of the fruit;

[0023] Figure 4 The phenotypes and physical and chemical indicators of the fruits of tomato PHS overexpression lines; A is a complete picture of wild-type and overexpression tomato fruits, B is the expression analysis of PHS genes in wild-type and overexpression tomatoes at 35DPA, C is the expression analysis of PHS genes in wild-type and overexpression tomatoes at 47DPA, D is a cross-section picture of wild-type and overexpression tomato fruits, E is the expression analysis of PHS genes in wild-type and overexpression tomatoes at 41DPA, F is the starch content analysis of wild-type and overexpression tomatoes, G is the ripening time analysis of wild-type and overexpression tomatoes, H is the soluble solids content analysis of wild-type and overexpression tomatoes, and I is the titratable acid content analysis of wild-type and overexpression tomatoes;

[0024] Figure 5 is an indicator of the organic acid content in the fruit of the tomato PHS overexpression line; A is malic acid, B is citric acid, C is quinic acid, and D is oxalic acid;

[0025] Figure 6 The figure shows the sequencing results. DETAILED DESCRIPTION

[0026] The principles and features of the present invention are described below. The examples are only used to explain the present invention and are not intended to limit the scope of the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in this field or the product instructions are used. Where the manufacturers of the reagents or instruments used are not specified, they are all conventional products that can be purchased through regular channels.

[0027] Sources of materials and reagents:

[0028] RNA Kit MagZol TM Reagent (Cat. No.: R4801-02); Agilent 2100 Bioanalyzer (Shanghai Yajing Biotechnology Co., Ltd.); Reverse Transcription Kit PrimeScript 1 stStrand cDNA Synthesis Kit (Takara); pBWA(V)HS-GLosgfp (NTCC Type Culture Collection); DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.); Escherichia coli DH5α (Shanghai Weidi Biotechnology Co., Ltd.); Agrobacterium tumefaciens GV3101 (Shanghai Weidi Biotechnology Co., Ltd.); wild-type MT tomato seeds were provided by Wuhan Boyuan Biotechnology Co., Ltd.; MS medium, screening medium, differentiation medium, and rooting medium were all purchased from Qingdao Haibo Biotechnology Co., Ltd.

[0029] Example

[0030] 1. Obtain the PHS gene.

[0031] Using the RNA kit MagZol TM RNA was extracted from Actinidia chinensis fruit (collected from Fengxin County, Yichun City, Jiangxi Province) using Reagent (Cat. No. R4801-02); the integrity of total RNA was detected using an Agilent 2100 Bioanalyzer. st cDNA was synthesized using the Strand cDNA Synthesis Kit. Full-length primers PHS-F1 (ATGGCTACTACAGCAGATGCCAA, SED ID NO: 2) and PHS-R1 (TTATGGTACACAGCACTCCTCTATTTTCCA, SED ID NO: 3) were designed using Primer Premier 5.1 software. PCR amplification was performed using the cDNA as a template.

[0032] Specifically, the cDNA of Actinidia chinensis fruit was used as a template, and the above primers were used to amplify the full-length coding region of the PHS gene by PCR. The PCR product was purified by a DNA purification kit; the PCR product was subjected to Sanger sequencing ( Figure 6 ), which clarifies the sequence nucleotide arrangement information.

[0033] Figure 1 The predicted phosphorylation sites in the sequence are shown (NetPhos 3.1a: predicted phosphorylation sites in Seguence). Figure 1 The horizontal axis represents sequence position and phosphorylation potential, and the icons represent serine, threonine, tyrosine, and threshold. The protein encoded by the PHS gene is α-glucan phosphorylase, which consists of 850 amino acids.

[0034] 2. Cultivation of transgenic plants with improved edible fruits.

[0035] A method for cultivating transgenic plants with improved fruit edibility comprises the following steps:

[0036] (1) Construction of an expression vector for the PHS gene that improves the edible quality of fruits ( Figure 2 ), transformed into Agrobacterium to obtain a recombinant expression strain;

[0037] (2) Transforming the recombinant expression strain into the plant to be cultivated, and screening to obtain a transgenic strain with stable inheritance of the PHS gene sequence.

[0038] Specifically, in this embodiment, (1) the purified PHS gene was connected to the pBWA(V)HS-GLosgfp overexpression vector by homologous recombination, and transformed into Escherichia coli by heat shock method. After plate screening, the resistance was kanamycin, and after positive identification, PHS-positive Agrobacterium genetic engineering bacteria were constructed;

[0039] (2) Transforming the PHS-positive Agrobacterium into the plant to be cultivated, for example, by using the Agrobacterium-mediated leaf disc transformation method, and cultivating and screening transgenic strains that stably inherit the target gene sequence. The plants to be cultivated include kiwifruit and tomato.

[0040] 3. Application of transgenic tomato cultivation to improve the edible quality of fruits.

[0041] A method for cultivating transgenic tomatoes with improved fruit edibility comprises the following steps:

[0042] (1) After the PCR product was purified with a DNA purification kit, it was connected to the pBWA(V)HS-GLosgfp vector by homologous recombination method, and transformed into Escherichia coli DH5α by heat shock method. The plate was screened and the resistance was kanamycin. Single clones were selected and sequenced for identification ( Figure 6) and then extracted the plasmid. The plasmid was introduced into Agrobacterium tumefaciens GV3101 using the heat shock method. After culturing at 28°C for 48 hours, plaques were picked and PCR was performed to verify the culture solution, thereby obtaining an Agrobacterium strain suitable for genetic transformation. The forward and reverse primers used for PCR verification of the culture solution are as follows:

[0043] Forward primer: ttcatttggagagaacacgggggac (SED ID NO: 4),

[0044] Reverse primer: ttgccaaaacgctgcttg (SED ID NO: 5).

[0045] (2) The positive Agrobacterium strain was transformed into the cotyledons of wild-type tomato MicroTom (Wildtype, WT) using the Agrobacterium-mediated leaf disc transformation method. The conventional process of the leaf disc transformation method included: pre-culture (using MS culture medium), transformation (the Agrobacterium concentration OD value was about 0.1, and the tomato explants that had been pre-cultured for 2-3 days were placed in the Agrobacterium suspension and infected for about 10 minutes, and then co-cultured.), callus induction and screening (the explants after 2 days of co-culture were transferred to the screening culture medium), differentiation and rooting (using differentiation culture medium), rooting (using rooting culture medium), detection (PCR amplification, and agarose gel electrophoresis to determine the positive seedlings and the positive rate). The wild-type tomato was used as a control, and the totipotency of plant cells was used to obtain T0 generation overexpression tomatoes; the genomic DNA of the T0 generation plants was extracted using the CTAB method and used as a template. After PCR amplification, sequencing was performed to identify and screen positive plants. Self-pollination was performed to obtain T0 generation seeds;

[0046] (3) Sowing T0 generation seeds, cultivating in a greenhouse, and obtaining T1 generation plants. The same method is used to identify and screen positive plants, self-pollinate and multiply to obtain T1 generation seeds;

[0047] (4) T1 seeds were sown to obtain T2 plants. The ripening time of the fruits of the T2 plants (i.e., MT-35S:AcPHS transgenic tomatoes) and the wild-type fruits was tracked and counted. The starch content, soluble solids content, and titratable acid content of the fruits were determined. Starch was determined using a starch content test kit from Solebo; soluble solids were determined using a digital handheld refractometer (Atago, Tokyo, Japan); and titratable acid was determined using a handheld refractometer (ATAGO PAL-BXIACID8).

[0048] Depend on Figure 3 From AB, we can see that the expression pattern of PHS gene is consistent with the fruit ripening process. The higher the fruit maturity, the higher the expression level of PHS gene. Figure 4 From AI, we can see that PHS is a positive regulatory factor for fruit ripening, promoting fruit ripening; Figure 5As shown in AD, PHS overexpression affected the acid content of the fruit, and the titratable acid was significantly lower than that of the wild-type MT.

[0049] In summary, compared with the wild type, the MT-35S:AcPHS transgenic tomato fruit matured six days earlier. Starch content rapidly decreased from 35 to 38 days post-production (DPA), three days earlier than the control, ultimately leading to more complete starch degradation. At fruit maturity (43 days post-production), the MT-35S:AcPHS transgenic tomato fruit had significantly higher soluble solids content and significantly lower titratable acidity than the wild type MT. These results suggest that the PHS gene positively regulates fruit ripening.

[0050] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. An application of the PHS gene for improving the edible quality of fruits, characterized in that: The PHS gene is used in the cultivation of transgenic plants with improved fruit edibility, and the nucleotide sequence of the PHS gene is shown in SEQ ID NO: 1; The improvement of the instant eating quality of the fruit is to make the starch degradation more complete during the fruit ripening period, significantly increase the soluble solid content and significantly reduce the titratable acid; The plant includes any one of kiwi fruit and tomato.

2. A method for cultivating transgenic plants with improved fruit edibility, characterized in that: The steps include: (1) Using the PHS gene for improving the ready-to-eat quality of fruits as described in claim 1 to construct an expression vector for the PHS gene for improving the ready-to-eat quality of fruits, the vector is transformed into Agrobacterium to obtain a recombinant expression strain; (2) transforming the recombinant expression strain into the plant to be cultivated, and screening to obtain a transgenic strain with stable inheritance of the PHS gene sequence; The improvement of the instant eating quality of the fruit is to make the starch degradation more complete during the fruit ripening period, significantly increase the soluble solid content and significantly reduce the titratable acid; The plant includes any one of kiwi fruit and tomato.

3. The method for cultivating transgenic plants with improved fruit edibility according to claim 2, characterized in that: The PHS gene in step (1) is obtained by the following method: using the cDNA of Actinidia chinensis fruit as a template, PCR amplification of the full-length coding region of the PHS gene is performed.

4. The method for cultivating transgenic plants with improved fruit edibility according to claim 2, wherein: The nucleotide sequences of the primer pair for PCR amplification of the full-length coding region of the PHS gene are shown in SEQ ID NOs: 2-3.