Tissue-specific promoter screening vector and application thereof

Abstract

The invention discloses a tissue-specific promoter screening vector and application thereof, and relates to the technical field of plant genetic engineering. The screening vector comprises an expression vector and a modified GUS (glucuronidase) reporter gene connected to the expression vector, the modified GUS reporter gene is Cat1muGUS, and the sequence of the Cat1muGUS is shown as SEQ ID NO. 3. According to the present invention, the Cat1muGUS variant is developed based on the Cat1GUS, the Cat1muGUS sensitivity is high, the problem of low dyeing screening efficiency caused by the fact that the Cat1GUS is not sheared in the dicotyledonous plant and the monocotyledonous special tissue can be overcome, in addition, the tissue-specific promoter screening vector is constructed based on the Cat1muGUS variant, and the screening efficiency is high; the method can be well applied to screening of all plant and all tissue specific promoters, and the screening efficiency is improved.

Description

Technical Field

[0001] The invention relates to the technical field of plant gene engineering, and in particular to a tissue-specific promoter screening vector and application thereof. Background Art

[0002] Tissue-specific promoters are of great significance to biological breeding. They can accurately express target genes, improve the targeting of gene expression, enhance the improvement effect of target traits, reduce adverse effects on organisms, avoid interfering with non-target physiological processes, and improve biological safety. At the same time, these specific promoters can also provide powerful tools for basic research in biological breeding.

[0003] The use of GUS staining binary vector is the main means of screening and verifying tissue-specific promoters. The Nakamura laboratory added the Cat1 (castor bean catalase1) intron to the GUS expression frame. This intron can increase the expression efficiency of GUS, thereby increasing the sensitivity of GUS staining to screen tissue-specific promoters. However, according to the article "Tanaka, A et al. "Enhancement of foreign gene expression by a dicot intron in rice but not intobacco is correlated with an increased level of mRNA and an efficientsplicing of the intron." Nucleic acids research vol. 18, 23 (1990): 6767-70. doi: 10.1093 / nar / 18.23.6767", the splicing efficiency of this intron is not high in some special tissues of dicots and monocots. If the intron is not spliced, it will lead to premature termination of GUS translation and produce truncated proteins without GUS activity, which greatly affects the efficiency of GUS staining, which significantly restricts the screening of promoters. Summary of the invention

[0004] The purpose of the present invention is to solve the problem that the current GUS promoter screening system is inefficient and cannot be widely applied.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] The first object of the present invention is to provide a tissue-specific promoter screening vector, the screening vector comprising an expression vector and a modified GUS reporter gene connected to the expression vector, wherein the modified GUS reporter gene is Cat1 mu_GUS, Cat1 mu The sequence of _GUS is shown in SEQ ID NO.3.

[0007] The second object of the present invention is to provide a use of the tissue-specific promoter screening vector as described above in improving the activity of GUS protein.

[0008] The third object of the present invention is to provide an application of the tissue-specific promoter screening vector as described above in screening plant tissue-specific promoters.

[0009] As a further optimized solution of the present invention, the plant is a dicotyledonous plant or a monocotyledonous plant.

[0010] A fourth object of the present invention is to provide a method for screening tissue-specific promoters, characterized in that it comprises the following steps:

[0011] (1) constructing the screening vector as described above;

[0012] (2) First, the promoter to be screened is cloned and constructed onto a screening vector. Then, the screening vector fused with the promoter to be screened is transformed into different tissues of the plant. The GUS activity of different tissues of the transformed plant is qualitatively and quantitatively detected by fluorescence. Finally, the expression specificity of the promoter to be screened in different tissues of the plant is determined based on the test results.

[0013] The present invention has the following beneficial effects:

[0014] The present invention develops Cat1 based on Cat1_GUS mu _GUS variant, Cat1 mu _GUS has a higher sensitivity, which can overcome the problem that Cat1_GUS is not sheared in dicotyledonous plants and monocotyledonous special tissues, resulting in low screening efficiency. In addition, the present invention is based on Cat1 mu _GUS variants were used to construct tissue-specific promoter screening vectors, which can be well applied to the screening of all plant and all tissue-specific promoters, thus improving the screening efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 GUS, Cat1_GUS and Cat1 provided by the present invention mu _Schematic diagram of the GUS sequence;

[0016] Figure 2 GUS, Cat1_GUS and Cat1 provided by the present invention mu _GUS protein activity verification results;

[0017] Figure 3A is the use of the pCAMBIA1300 vector containing the UBI promoter to construct pCAMBIA1300-UBI-Cat1_GUS, pCAMBIA1300-UBI-Cat1 mu _Schematic diagram of GUS;

[0018] Figure 3 B is Cat1_GUS and Cat1 provided by the present invention mu _GUS comparison of tobacco GUS staining efficiency.

[0019] Figure 3 C is Cat1_GUS and Cat1 provided by the present invention mu _GUS specific activity determination of GUS. DETAILED DESCRIPTION

[0020] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0021] 1. Materials and reagents

[0022] Unless otherwise specified, the materials and reagents used in this example can be obtained through commercial channels.

[0023] 2. Methods

[0024] No specific experimental method is specified in this example, and all experimental methods can be performed according to conventional methods.

[0025] 2.1 Point synthesis and Cat1 mu _GUS enzyme activity verification

[0026] 2.1.1GUS, Cat1_GUS, Cat1 mu Synthesis of _GUS sequence

[0027] According to the GUS sequence shown in SEQ ID NO.1 and the Cat1_GUS sequence shown in SEQ ID NO.2, a spike design is performed on the Cat1_GUS sequence, and the designed spike sequence is recorded as Cat1 mu _GUS sequence, together with GUS and Cat1_GUS sequence, was directly synthesized by the company. mu _GUS sequence is shown as SEQ ID NO.3.

[0028] GUS, Cat1_GUS and Cat1 mu _GUS sequence diagram is as follows Figure 1 shown.

[0029] 2.1.2pGEX6P-1-Cat1 mu Construction of pGEX6P-1-Cat1_GUS, pGEX6P-1-GUS

[0030] (1) Primer design and PCR amplification

[0031] According to GUS, Cat1_GUS and Cat1 mu _GUS sequence, and the amplification primers containing homology arms were designed using Primer Premier 5.0 software. The synthetic GUS, Cat1_GUS and Cat1 mu _GUS was used as a template for PCR amplification, and the PCR product was recovered by gel recovery to obtain the PCR purified product.

[0032] The sequence information of the extended primers is as follows:

[0033] Upstream primer F1: GGGCCCCTGGGATCCCCGGAATTCATGGTCGATCTGAGGGTAA ATTTC (SEQ ID NO. 4);

[0034] Downstream primer R1: TCAGTCACGATGCGGCCGCTCGAGTTGTTTGCCTCCCTGCTGCG (SEQ ID NO. 5);

[0035] Note: GUS, Cat1_GUS and Cat1 mu The sequences at both ends of the _GUS sequence are identical, and a set of primer pairs can be used to amplify the corresponding sequences using different templates.

[0036] (2) Linearized vector

[0037] Using pGEX6P-1 as a vector, EcoRI and XhoI as restriction sites for linearization and gel electrophoresis to recover large fragments. Obtain vector restriction products, and the restriction reaction system is shown in Table 1.

[0038] Table 1. Enzyme digestion reaction system

[0039]

[0040] (3) Homologous recombination and transformation

[0041] The three PCR purified products obtained above were homologously recombined with the vector enzyme digestion products to obtain recombinant products. The recombinant products were transformed into Escherichia coli DH5α competent cells and cultured at 37°C overnight.

[0042] (4) Identification and detection of positive colonies

[0043] Single clones were selected for PCR verification, and the positive bacterial solution was expanded and cultured to extract the plasmid, which was then sent to the company for sequencing. The sequencing results were compared with the expected vector map through SnapGene, and the single clones before sequencing were shaken to extract the plasmid to obtain pGEX6P-1-Cat1 mu _GUS, pGEX6P-1-Cat1_GUS and pGEX6P-1-GUS.

[0044] 2.1.3 Prokaryotic expression and GUS activity staining

[0045] (1) BL21 transformation

[0046] pGEX6P-1-Cat1 mu The three plasmids, pGEX6P-1-Cat1_GUS, pGEX6P-1-GUS, were respectively transferred into BL21 competent cells and cultured at 37°C overnight.

[0047] (2) Inducible expression of proteins

[0048] Pick a single clone from the plate and place it in 20 mL of liquid LB medium containing Amp, shake it at 37°C, 200 r / min overnight, then transfer it to a new 20 mL of liquid LB medium containing the corresponding antibiotics, shake it at 37°C, 200 r / min until OD 600 At about 0.5, keep 1mL of bacterial solution in a 1.5mL EP tube, add 10uL 1MIPTG to the remaining bacterial solution, and culture it overnight in a shaker at 16℃ and 200r / min; aspirate 1mL of the induced bacterial solution into a clean 1.5mL EP tube, and detect the induction result by SDS-PAGE.

[0049] (3) GUS staining of bacteria

[0050] The induced bacterial liquid was centrifuged and collected, then resuspended in 200uL 1M PBS, and 1mL coolaber GUS staining solution was added. The culture was placed in a 37°C incubator for 2h and the color change was observed.

[0051] The results are as follows Figure 2 As shown in the figure, the intensity of the color reflects the activity of the protein. From the results in the figure, we can see that Cat1 mu The activity of _GUS was not significantly different from that of normal GUS, indicating that the additional amino acid sequence after the intron point did not affect Cat1 muGUS activity of _GUS protein. Since there is no mRNA splicing in bacteria, the translation of Cat1_GUS without puncta is terminated prematurely and no active full-length GUS protein can be produced. Therefore, the resuspended bacterial solution does not appear blue, which is consistent with expectations.

[0052] 2.2 Tobacco transient transformation and Cat1 mu _GUS staining efficiency verification

[0053] 2.1.1 Construction of binary vector

[0054] (1) Primer design

[0055] Primer Premier 5.0 software was used to design amplification primers containing homology arms. mu _GUS primer sequences are as follows:

[0056] Upstream primer F2: TGGTGTTACTTCTGCAGGGTACCATGGTCGATCTGAGGGTAAAT TT (SEQ IDNO.6);

[0057] Downstream primer R2: GACTCTAGAGGATCCCCGTTGTTTGCCTCCCTGCT (SEQ ID NO. 7).

[0058] Note: Cat1_GUS and Cat1 mu The sequences at both ends of the _GUS sequence are identical, and a set of primer pairs can be used to amplify the corresponding sequences using different templates.

[0059] (2) PCR amplification

[0060] Using the primer sequences described above, the synthetic Cat1_GUS, Cat1 mu _GUS sequence was used as a template, and a high-fidelity DNA polymerase was used to amplify the target fragment to obtain a PCR product, which was then recovered by gel recovery to obtain a PCR purified product.

[0061] The reaction system is shown in Table 2, and the reaction procedure is shown in Table 3.

[0062] Table 2. High-fidelity DNA polymerase PCR reaction system

[0063]

[0064] Table 3. High-fidelity DNA polymerase PCR reaction program

[0065]

[0066] (3) Linearized vector

[0067] The pCAMBIA1300 vector containing the UBI promoter was constructed and named as the pCAMBIA1300-UBI vector. The vector was digested with the endonuclease kpnI and linearized in a water bath at 37°C for 2 h. The large fragment was recovered by gel electrophoresis to obtain the vector digestion product. The digestion reaction system is shown in Table 4.

[0068] Table 4. Enzyme digestion reaction system

[0069]

[0070] (5) Homologous recombination and transformation

[0071] The two PCR purified products obtained above were homologously recombined with the vector restriction products, and the recombinant products were transformed into E. coli DH5α competent cells and cultured at 37°C overnight.

[0072] (7) Identification and detection of positive colonies

[0073] Monoclonal colonies were selected for PCR verification, and the positive bacterial solution was expanded and cultured to extract plasmids, which were then sent to the company for sequencing. The sequencing results were compared by SnapGene, and plasmids were extracted from the monoclonal strains with correct sequencing to obtain pCAMBIA1300-UBI-Cat1_GUS, pCAMBIA1300-UBI-Cat1 mu _GUS( Figure 3 A).

[0074] 2.1.1 Transient transfection and GUS staining of tobacco

[0075] (1) Agrobacterium transformation

[0076] Take out the GV3101 competent cells stored at -80℃ and put them on ice until they melt. Add 1μg of the constructed plasmid to the competent cells, gently stir to mix, and place on ice for 5min; put it in liquid nitrogen for quick freezing for 5min; place it in a 37℃ water bath for 5min, and immediately put it on ice for 5min. Add 500μl of LB without antibiotics, gently invert and mix several times, and shake at 28℃, 180rpm for 3h. Centrifuge at 3000rpm for 1min. Discard the supernatant, leaving about 200μl, gently blow and resuspend the cells, spread them on a resistance plate containing rifampicin, kanamycin and gentamicin, and culture at 28℃ until a single colony is formed.

[0077] (2) Tobacco transient transformation

[0078] ① Pick a single clone from the plate and place it in 20 mL of liquid LB medium containing rifampicin, kanamycin and gentamicin, and culture it overnight in a shaker at 28°C and 180 r / min.

[0079] ② Use a desktop high-speed refrigerated centrifuge, 3000r / min, centrifuge at room temperature for 15min, and discard the supernatant.

[0080] ③ Add 20 mL of infection washing solution, use a plastic dropper to aspirate and resuspend, then invert to mix, and centrifuge at 3000 r / min in a desktop high-speed refrigerated centrifuge for 10 min.

[0081] ④Discard the supernatant and repeat the previous step twice.

[0082] ⑤ Use infection injection solution to adjust the OD of bacterial solution 600 to an appropriate value and let stand at room temperature for 1 hour to activate Agrobacterium.

[0083] ⑥ Use a small syringe to draw up the bacterial solution and inject it into the back of the tobacco leaves.

[0084] ⑦ Place the infected tobacco in an incubator and culture under weak light for 36-48 hours before proceeding with subsequent experiments.

[0085] (3) GUS staining

[0086] ① Soak the prepared materials in GUS staining solution and keep warm at 25-37℃ for 1 hour to overnight (depending on the strength of the transformed gene promoter, the tenderness of the material and the thickness of the cuticle).

[0087] ② Transfer green materials such as leaves into 70% ethanol for decolorization 2-3 times until the negative control material turns white.

[0088] ③Observe with the naked eye or under a microscope. The blue area on the white background is the GUS expression area.

[0089] The results are as follows Figure 3 B, Cat1 mu _GUS staining solution has turned blue after 20 minutes, while Cat1_GUS has not turned blue significantly. mu _GUS is clearly colored, but Cat1_GUS has only sporadic blue spots, and Cat1 mu _GUS can be used to overcome the problem that Cat1_GUS is not cleaved in dicotyledonous plants or special tissues of monocotyledons, resulting in low screening efficiency.

[0090] (3) GUS specific activity identification

[0091] The transiently transformed tobacco leaves were sampled and ground with liquid nitrogen. Half of the powder was resuspended in PBS buffer containing 5 μM DTT and fully shaken. The crude enzyme protein extract was obtained by centrifugation. The GUS activity of the crude extract was determined according to a commercial kit (Yaji Biotechnology, YS07104B).

[0092] The other half was ground and RNA was extracted using Trizol. After inversion, GUS activity was calibrated with the expression level of the vector resistance gene Hyg. The sequence information of the Hyg fluorescence quantitative primer is as follows:

[0093] Upstream primer F3: GAAGTGCTTGACATTGGGGAGTTTAG (SEQ ID NO. 8);

[0094] Downstream primer R3: TACTTCTACACAGCCATCGGTCCAG (SEQ ID NO. 9).

[0095] Consistent with the above GUS staining results, Cat1 mu The GUS specific activity of _GUS leaves was significantly higher than that of Cat1_GUS leaves ( Figure 3 C).

[0096] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A tissue-specific promoter screening vector, characterized in that: The screening vector comprises an expression vector and a modified GUS reporter gene connected to the expression vector, wherein the modified GUS reporter gene is Cat1 mu _GUS, Cat1 mu The sequence of _GUS is shown in SEQ ID NO.

3.

2. Use of the tissue-specific promoter screening vector as claimed in claim 1 in improving the activity of GUS protein.

3. Use of the tissue-specific promoter screening vector as claimed in claim 1 in screening plant tissue-specific promoters.

4. The use according to claim 3, characterized in that: The plant is a dicotyledonous plant or a monocotyledonous plant.

5. A method for screening tissue-specific promoters, characterized in that: The following steps are involved: (1) constructing the screening vector as described in claim 1; (2) First, clone the promoter to be screened and construct it onto a screening vector. Then, transform the screening vector fused with the promoter to be screened into different tissues of the plant. Perform qualitative and fluorescence quantitative detection of GUS activity in different tissues of the transformed plant. Finally, determine the expression specificity of the promoter to be screened in different tissues of the plant based on the detection results.

Images