A ssr molecular marker related to rice fertility, a primer pair and application thereof

Abstract

The present application relates to the rice breeding technical field, particularly to a kind of SSR molecular marker related to rice fertility, primer pair and its application.The present application constructs near-isogenic line (NIL-S68) with hybrid sterile gene S68, using Indian indica rice variety Swarna as donor parent, indica rice IR64 as receptor parent, the F1 generation plants are obtained by hybridizing recurrent parent IR64 and NIL-S68, it is found that the pollen fertility of both recurrent parent IR64 and NIL-S68 is normal, while the F1 generation plants of the hybridization of the two exhibit pollen semi-sterile.After screening the SSR molecular marker related to rice fertility and primer pair, it can be used to detect whether the hybrid sterile gene exists in indica-indica subspecies.Therefore, the present application has important guiding and practical significance for parent selection and matching of hybrid advantage utilization in indica rice subspecies.

Description

Technical Field

[0001] The present invention relates to the technical field of rice breeding, and in particular to an SSR molecular marker related to rice fertility, a primer pair and applications thereof. Background Art

[0002] In recent years, due to breeders' preference for parental selection, the genetic basis between rice varieties has become increasingly narrow, leading to stagnant rice yields. Asian cultivated rice, due to its widespread geographical distribution and the influence of long-term artificial selection, has developed rich genetic diversity and population differentiation. Indica rice is the most important subspecies of Asian cultivated rice and has played a crucial role in advancing rice breeding. In the 1950s and 1960s, the discovery and breeding of semi-dwarf genes in indica rice increased rice yield by approximately 20%. In the 1970s, the utilization of intra-subspecific heterosis within indica-indica rice increased rice yield by approximately 20%. Therefore, fully tapping the potential of intra-subspecific heterosis within indica-indica rice is an effective way to overcome the current bottleneck in rice yield. However, the widespread distribution of indica rice and the varying directions and pressures of artificial selection have resulted in rich genetic diversity within indica rice subspecies. This has also led to hybrid sterility between different indica rice varieties, limiting the further utilization of intra-subspecific heterosis. Therefore, identifying hybrid sterility genes within indica-indica subspecies of rice has practical significance for guiding the utilization of hybrid advantages within indica subspecies. Summary of the Invention

[0003] The present invention aims to provide a rice fertility-related SSR molecular marker, primer pair, and application thereof to address the above-mentioned problems in the prior art. The SSR molecular marker and primer pair provided by the present invention can be used to detect the presence of the hybrid sterility gene in the indica-indica subspecies. The present invention has important guiding and practical significance for parent selection for the utilization of heterosis within the indica subspecies of rice.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides an SSR molecular marker related to rice fertility. The SSR molecular marker is obtained by amplifying a forward primer having a nucleotide sequence as shown in SEQ ID NO.11 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.12.

[0006] Preferably, the rice is an indica-indica intra-subspecific hybrid, i.e., a hybrid of an indica rice variety and an indica rice variety.

[0007] The present invention provides a primer pair for amplifying the above-mentioned SSR molecular marker, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.11 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.12.

[0008] The present invention provides the use of the primer pair in preparing a product for identifying rice fertility.

[0009] Preferably, the rice is an indica-indica intra-subspecific hybrid.

[0010] Preferably, the product comprises a reagent, a kit or a chip.

[0011] The present invention provides a product for identifying rice fertility, which comprises the above primer pair.

[0012] Further preferably, the rice is an indica-indica intra-subspecific hybrid.

[0013] Further preferably, the product includes a reagent, a kit or a chip.

[0014] The present invention provides the use of the above-mentioned SSR molecular marker, the above-mentioned primer pair or the above-mentioned product in identifying rice fertility.

[0015] The present invention provides a method for identifying rice fertility, comprising taking DNA of the rice to be tested as a template, adopting the above primer pair to perform amplification, and determining the rice fertility according to the band pattern of the amplified product.

[0016] Preferably, if a single band appears at either 195-205 bp or 180-190 bp, the two tested rice hybrids are normally fertile rice; if a single band appears at both 195-205 bp and 180-190 bp, the two tested rice hybrids are semi-sterile rice. That is, if the bands of the two tested rice varieties are identical in size, there is no hybrid fertility disorder between the tested rice varieties; if the bands of the two tested rice varieties are inconsistent in size, there is hybrid fertility disorder between the tested rice varieties.

[0017] The present invention discloses the following technical effects:

[0018] The present invention constructs a near-isogenic line (NIL-S68) containing the hybrid sterility gene S68, using the Indian indica rice variety Swarna as the donor and the indica rice IR64 as the recipient and recurrent parent. The line then hybridizes the recurrent parent IR64 with NIL-S68 to produce F1 plants. It was found that both the recurrent parents IR64 and NIL-S68 exhibited normal pollen fertility, while the F1 hybrids exhibited semi-sterile pollen. Furthermore, a high-generation segregating population was generated by hybridizing IR64 and NIL-S68, and the hybrid sterility gene was located within 190 kb of the terminal short arm of chromosome 3. Molecular markers and primer pairs closely linked to the S68 gene were screened for the presence of the hybrid sterility gene in indica-indica subspecies. The present invention provides important guidance and practical significance for parent selection for utilizing heterosis within indica rice subspecies. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 Figure 1 is a pollen fertility identification diagram of the recurrent parents IR64, NIL-S68, and the F1 hybrid of the two in Example 1; wherein A is the plant phenotype of the recipient parent IR64; B is the plant phenotype of the hybrid F1 generation; C is the plant phenotype of NIL-S68; the scale bars in AC are 10 cm; D is the pollen fertility of the recipient parent IR64; E is the pollen fertility of the hybrid F1 generation, with green arrows indicating normal pollen grains and red arrows indicating aborted pollen grains; F is the pollen fertility of NIL-S68; the scale bars in DF are 100 μm; G is the quantitative analysis results of pollen fertility and spikelet fertility; H is the pollen germination rate analysis result;

[0021] Figure 2 Figure 1 is a pollen cytological observation diagram in Example 1; wherein, A is the anther morphology of the recurrent parent IR64; B is the anther morphology of the hybrid F1 generation; C is the anther morphology of NIL-S68; the scale bars of AC are both 200 μm; D is the pollen grain morphology of the recurrent parent IR64; E is the pollen grain morphology of the hybrid F1 generation, the green arrow indicates the normal pollen grain, and the red arrow indicates the aborted pollen grain; F is the pollen grain morphology of NIL-S68; the scale bars of DF are both 20 μm; G is an enlarged view of the pollen grain of the recurrent parent IR64; H is an enlarged view of the pollen grain of the hybrid F1 generation; I is an enlarged view of the pollen grain of NIL-S68; the ratio of GI The scale bars are all 5 μm; J is the cross section of the pollen grain of the recurrent parent IR64; K is the cross section of the pollen grain of the hybrid F1 generation; L is the cross section of the pollen grain of NIL-S68; the scale bars in J and L are all 5 μm; M is the pollen wall structure of the recurrent parent IR64; N is the pollen wall structure of the hybrid F1 generation; O is the pollen wall structure of NIL-S68; the scale bars in MO are all 500 nm; Ex is the pollen exine; In is the pollen intine; Te is the pollen tectum; Ne is the inner layer of the pollen exine; Ba is the pollen bacula;

[0022] Figure 3 This is the pollen fertility distribution diagram of the IR64 / Swarna BC6F2 population in Example 1;

[0023] Figure 4The background and introgression status of the near-isogenic lines detected by rice 1K liquid phase microarray; green represents the homozygous recurrent parent IR64 genotype, blue represents the homozygous donor parent Swarna genotype, red represents heterozygous genotype, and gray represents missing data; PS represents pollen semi-sterile; PF represents pollen fertile;

[0024] Figure 5 This is the correlation analysis between SSR markers and pollen fertility;

[0025] Figure 6 This is the linkage map of the S68 locus in Example 1;

[0026] Figure 7 This is the electrophoresis pattern of the indica-indica hybrid fertility detected by marker S347 in Example 2; among them, 1 is the banding pattern of the IR64 parent; 2 is the banding pattern of the Swarna parent; 4 is the heterozygous banding pattern; the sample in the first lane is IR64, the sample in the second lane is Swarna, and the remaining lanes are the hybrid offspring populations of IR64 and NIL-S68. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] Hybrid sterility is a complex quantitative trait controlled by multiple genes. To eliminate interference from other hybrid sterility loci or genetic backgrounds, the present invention constructed a high-generation segregating population using the Indian indica rice variety Swarna as the donor parent and IR64 bred by the International Rice Research Institute as the recipient and recurrent parent. The hybrid sterility gene S68, which acts within the indica-indica subspecies, was identified and molecular markers for identifying the hybrid sterility gene S68 were screened to guide the utilization of hybrid vigor within the indica-indica subspecies of rice.

[0033] Example 1

[0034] 1. Construction of near-isogenic lines containing the S68 gene

[0035] The inventors used the indica rice variety IR64 cultivated by the International Rice Research Institute as the female parent and the Indian indica rice variety Swarna as the male parent to cross and obtain F1 generation plants. Then, the F1 was used as the female parent, IR64 as the male parent and the recurrent parent for backcrossing to obtain a BC1F1 population. The inventors used the I2-KI staining method to detect the pollen fertility of each plant. The method is as follows: from the branches and stalks in the middle and upper part of the main panicle of the single plant, 5-10 spikelets that were to bloom on the same day were collected before flowering and fixed in 70% ethanol. Stained with 1% I2-KI solution, the pollen fertility was divided into four categories under a 160× ordinary optical microscope: empty abortion (typical abortion and round abortion), dyed abortion, small black and fertile, and the number of pollen of each category was recorded. Three fields of view were observed on each piece, and the percentage of each pollen type was calculated for each plant. Starting from the BC1F1 generation, pollen semi-sterile plants were selected for backcrossing until the BC5F1 generation. Then, pollen semi-sterile plants were selected for self-pollination to form BC5F2. The genotype of each plant in the BC5F2 population was detected using rice 1k liquid phase array (Huazhi Biotechnology Co., Ltd.), and the plant with normal pollen fertility and homozygous introgression of the Swarna genomic fragment was selected as NIL-S68.

[0036] 2. Phenotypic identification of F1 hybrids between recurrent parents IR64 and NIL-S68

[0037] There were no significant differences in plant height, tiller number, heading date, effective panicle and spikelet fertility between the parents IR64 and NIL-S68 and their hybrid F1 ( Figure 1 AC in ). Figure 1 As can be seen from the DF in the figure, both parental pollen showed normal fertility, while in the pollen of the hybrid F1, 53.43% of the pollen grains were stained normally but had diameters significantly smaller than normal pollen grains, belonging to the small black type.

[0038] In order to investigate whether the pollen and spikelets of the parents IR64 and NIL-S68 and their hybrid F1 generation are fertile, the inventors conducted a quantitative analysis of the pollen fertility and spikelet fertility of the parents and the hybrid F1. Figure 1 The results show that the pollen fertility of the parents is normal, while the hybrid F1 is semi-sterile. The spikelet fertility of both parents and the hybrid F1 is normal.

[0039] To investigate whether these small pollen grains have the ability to germinate, the inventors conducted a pollen germination experiment. The pollen germination medium consisted of 10% sucrose, 100 μL of 1% H₃BO₃, and 100 μL of 1% Ca(NO₃)₂, diluted to 10 mL with sterile water. The specific method involved selecting small flowers with newly opened husks, shaking the pollen onto the medium, and incubating them in the dark at 28°C for 10 minutes. The pollen germination was then observed and recorded under a microscope. The results are shown in Figure 2. Figure 1 The results showed that the germination rates of the parental pollen were 98.0% and 75.2%, respectively, while the germination rate of the hybrid F1 pollen was only 51.6%. Pollen grains with small diameters did not have the ability to germinate, indicating that this type of pollen was aborted.

[0040] In order to study the cause of pollen abortion, the inventors used scanning electron microscopy and transmission electron microscopy to analyze the ultrastructure of anthers and pollen.

[0041] The scanning electron microscopy experimental method is as follows:

[0042] (1) Pre-fixation: Take the florets that are about to open on the next day and fix them in 2.5% glutaraldehyde for 2 hours to 4 hours.

[0043] (2) Post-fixation: The fixed samples were rinsed three times with 0.1 M phosphate buffer (PB) (pH 7.4), each time for 15 min. Fixation was performed with 1% osmium phosphate at room temperature in the dark for 1-2 h. Rinse three times with 0.1 M phosphate buffer (PB) (pH 7.4), each time for 15 min.

[0044] (3) Dehydration: Dehydration was carried out in a gradient of ethanol from 30% to 50% to 70% to 85% to 95% to 100% (twice), with each step lasting 15 minutes.

[0045] (4) Replacement: Soak in a mixture of isoamyl acetate and ethanol (the volume ratio of isoamyl acetate to ethanol in the mixture is 1:1) for 10 minutes. Then soak in isoamyl acetate for 10 minutes.

[0046] (5) Critical point drying: The replaced sample is transferred into a sample basket and placed into the pre-cooled critical point drying chamber. Liquid carbon dioxide is injected and heated to 15°C for 10 minutes, then heated to 35°C to allow it to vaporize. After venting, the lid is opened and the sample is taken.

[0047] (6) Pasting: Use double-sided tape or conductive adhesive to stick the sample to the sample stage.

[0048] (7) Coating: Coating is done by ion sputtering and stored in a dry place at room temperature.

[0049] (8) Observation and photography: Observe and collect images under a scanning electron microscope.

[0050] Scanning electron microscopy of anthers and pollen revealed no significant differences in anther morphology between the two parents and the F1 hybrid ( Figure 2 AC in the hybrid. However, half of the pollen grains in the F1 hybrid are smaller and have wrinkled surfaces compared to the normal pollen grains in the parents ( Figure 2 DI in ).

[0051] The structure of the pollen grains was then analyzed using transmission electron microscopy experiments.

[0052] The transmission electron microscopy experimental method is as follows:

[0053] (1) Sample collection and fixation: Take the florets that are about to open on the next day and fix them in 2.5% glutaraldehyde at 4°C for 2-4 hours.

[0054] (2) Post-fixation: Rinse the tissue blocks with 0.1 M phosphoric acid solution three times for 15 min each time, and then place the samples in 1% osmium phosphate in a 4°C refrigerator for fixation for 4 h or overnight.

[0055] (3) Sample dehydration: Samples were dehydrated in 30%-50%-70%-80%-95%-100%-100% alcohol in a gradient oscillation manner for 40 min each time, and then in 100% propylene oxide three times for 30 min each time.

[0056] (4) Infiltration and embedding: propylene oxide + embedding solution (volume ratio of 3:1), shake and infiltrate at room temperature for 4 hours, propylene oxide + embedding solution (volume ratio of 1:3), shake and infiltrate at room temperature overnight, shake and infiltrate pure embedding solution at room temperature overnight, replace pure embedding solution, shake and infiltrate at room temperature for 3-4 hours. Then, pick out the sample with a toothpick and embed on the embedding plate.

[0057] (5) Polymerization: Place the embedding plate in a 60°C oven for 48 hours. After the resin is completely polymerized, remove the embedding block and set aside.

[0058] (6) Semi-thin positioning and ultra-thin sectioning: After rough trimming, the resin block is positioned for semi-thin sectioning on an ultra-thin sectioning machine. After trimming according to the positioning, ultra-thin sectioning is performed at the desired position with a section thickness of 70 nm. The section is picked up using a copper mesh.

[0059] (7) Staining: Stain with 3% uranyl acetate saturated alcohol solution for 8 min; wash with 70% alcohol 3 times, and wash with ultrapure water 3 times; stain with 2.7% lead citrate solution for 8 min; wash with ultrapure water 3 times, and dry with filter paper.

[0060] (8) Observation and photography: Observe under a transmission electron microscope and collect images for analysis.

[0061] Further observation using transmission electron microscopy revealed that aborted pollen grains had fewer starch granules ( Figure 2 JL in the figure), and the pollen wall is significantly thicker than that of normal pollen grains ( Figure 2 These results indicate that starch granule formation and pollen wall development in aborted pollen grains are abnormal.

[0062] 3. Genetic analysis of the S68 gene

[0063] To investigate whether the semi-sterile phenotype of hybrid pollen is controlled by a single gene, the inventors investigated the hybridization of NIL-S68 as the female parent and IR64 as the male parent, obtained F1 plants, and then self-pollinated them to form the IR64 / Swarna BC6F2 genetic population. Figure 3 The results showed that the pollen fertility in the population showed a bimodal distribution, and the ratio of pollen fertile plants to semi-sterile plants was consistent with a 1:1 ratio (χ 2 (1:1) =5.83, P-value=0.015). This indicates that the S68 gene is a single Mendelian genetic factor.

[0064] 4. Analysis of NIL-S68 incorporation fragments

[0065] To investigate the background substitution rate and introgression fragments of NIL-S68, the inventors randomly scanned three pollen-fertile plants and three pollen-sterile plants using a rice 1K liquid phase array (Huazhi Biotechnology Co., Ltd.). Figure 4 As shown. The 1K chip results showed that the background reversion rate of NIL-S68 was 92.5% compared with the recurrent parent IR64. Further analysis found that all pollen semi-sterile plants had heterozygous introgression at the end of the short arm of the third chromosome, while all pollen fertile plants had the recurrent parent genotype at this position, which indicates that the S68 gene controlling pollen semi-sterility may be located at the end of the short arm of the third chromosome. Next, the inventors analyzed the correlation coefficient between the SNP markers in the chip and pollen fertility, and the results are shown in Figure 2. Figure 5 The results showed that the correlation coefficient between SNP markers in the chip and pollen fertility was significantly negatively correlated (r 2 =-0.813).

[0066] 5. Localization of the S68 gene

[0067] In order to locate the S68 gene, the inventors selected 41 SSR markers in the introgression fragment region and screened them between IR64 and NIL-S68, and screened out a total of 15 pairs of polymorphic markers. The 15 pairs of markers were used to detect the genotypes of each individual plant in the population. Combined with the phenotypes of each individual plant, the gene S68 was located within the range of 0.4 cM between markers S157 and S347, with a physical distance of approximately 190 kb. In this section, no hybrid sterility genes have been reported. Therefore, the S68 gene is a gene that controls the semi-sterility of hybrid pollen within the indica-indica subspecies ( Figure 6 ).

[0068] Table 1 Primer sequences used for gene S68 localization

[0069]

[0070]

[0071] Example 2 Application of the S347 marker in detecting the fertility of indica-indica hybrids

[0072] The S347 primer pair of the present invention can be used to detect whether hybrid fertility disorder exists between two indica rice varieties. The specific method is as follows:

[0073] 1. Simple method for extracting genomic DNA

[0074] (1) Dissolve 12.1 g of tris (hydroxymethyl)aminomethane (Tris base) in 1000 mL of water and adjust the pH to 8.7 with concentrated hydrochloric acid to prepare a 100 mmol / L Tris-HCl solution.

[0075] (2) Dissolve 74.5 g of sodium chloride (KCl) in 1000 mL of water to prepare a 1 mol / L KCl solution.

[0076] (3) Dissolve 3.73 g of EDTA in 1000 mL of water to prepare a 10 mmol / L EDTA solution.

[0077] (4) Mix Tris-HCl solution, KCl solution, and EDTA solution in a volume ratio of 1:1:1 to prepare a rapid extraction solution.

[0078] (5) Cut 7-8 sections of leaves of about 0.5 cm from each individual plant of the IR64, Swarna, and IR64 / Swarna hybrid population (BC6F2, hybridized with NIL-S68 as the female parent and IR64 as the male parent, resulting in the IR64 / Swarna BC6F2 population) into a deep-well plate. Add 100 μL of nucleic acid rapid extraction solution to each well of each sample and boil in an autoclave at 105°C for 10 min.

[0079] 2. Detect the purity and concentration of DNA in the sample

[0080] The present invention takes 1 μL of DNA crude extract and detects OD on Nanodrop. 260 / 280 , check whether the ratio is between 1.8-2.0. Also test the concentration of the crude DNA extract and dilute it with sterile water to between 20-100 ng / μL.

[0081] 3. Construction of PCR System and PCR Reaction Conditions

[0082] The PCR reaction system of the present invention is 10 μL, including 25-50 ng DNA template, 5 μL 2×Taq PCR StarMix, 0.3 μM upstream primer (TTAGAGGAGATGATGGTGCAACG, SEQ ID NO.11) and downstream primer (AGCAGCCATTGAATGTGTTTGG, SEQ ID NO.12); the reaction program used is: pre-denaturation at 94°C for 5 minutes, 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, 30 cycles, and finally extension at 72°C for 5 minutes.

[0083] 4. Polyacrylamide electrophoresis detection

[0084] (1) Acrylamide and methylenebisacrylamide were mixed in a volume ratio of 38:2 to prepare a 40% polyacrylamide solution, which was stored at 4°C for later use;

[0085] (2) During electrophoresis, ddH2O, 10×TBE, and 40% polyacrylamide solution were mixed in a volume ratio of 7:1:2, and the 40% polyacrylamide solution was diluted to an 8% working solution. The 8% working solution, TEMED, and 10% APS were then mixed in a volume ratio of 5:2:50 to prepare an 8% polyacrylamide gel;

[0086] (3) Perform electrophoresis at a constant voltage of 160 V and a 0.5×TBE buffer solution. The specific amplification time depends on the molecular weight of the amplified product.

[0087] Detection by silver staining after electrophoresis:

[0088] (1) Place the electrophoresis gel in a fixative (10% alcohol and 0.5% glacial acetic acid) for 10 minutes.

[0089] (2) Silver staining with 0.15% silver nitrate solution for 15 minutes.

[0090] (3) Color development in 1.5% sodium hydroxide, sodium tetraborate (4 g / L), and 0.4% formaldehyde solution.

[0091] (4) Rinse with deionized water for 1-2 minutes.

[0092] (5) Cover the gel with plastic wrap.

[0093] (6) The gel staining results were scanned and saved as images using an EPSON (GT10000) scanner.

[0094] The present invention uses S347 primer to amplify the genome fragments of each single group of IR64 and Swarna and IR64 / Swarna hybrid populations. The results are as follows Figure 7 As shown. Figure 7 As can be seen, both the IR64 and Swarna parental banding patterns are homozygous, but the molecular weights of the PCR products differ. The IR64 banding pattern is designated as 1 (homozygous IR64 genotype, i.e., one band appears at 195-205 bp), the Swarna banding pattern is designated as 2 (homozygous Swarna genotype, i.e., one band appears at 180-190 bp), and the heterozygous banding pattern is designated as 3 (heterozygous, i.e., one band each appears at 195-205 bp and 180-190 bp). The fertility of these plants was subsequently investigated, and the results are shown in Table 2. The results showed that in the offspring population of IR64 and Swarna hybrids, pollen fertility in plants with heterozygous banding patterns was semi-sterile, while pollen in plants with homozygous banding patterns was normal and fertile (Table 2).

[0095] Table 2 Pollen fertility corresponding to S347 marker genotypes

[0096]

[0097]

[0098] Note: II, IS and SS represent homozygous IR64 genotype, heterozygous genotype and homozygous Swarna genotype, respectively.

[0099] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of a primer pair in preparing a product for identifying pollen fertility of indica-indica subspecies hybrid rice, characterized in that: The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO. 11 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO. 12; the female parent of the indica-indica intrasubspecific hybrid rice is IR64, and the male parent is Swarna; the pollen fertility includes normal fertility and semi-sterility.

2. The use according to claim 1, characterized in that The product includes a kit or a chip.

3. Use of a primer pair in identifying pollen fertility of indica-indica subspecific hybrid rice, characterized in that: The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO. 11 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO. 12; the female parent of the indica-indica intrasubspecific hybrid rice is IR64, and the male parent is Swarna; the pollen fertility includes normal fertility and semi-sterile; When the amplified product shows a single band at 195-205 bp or 180-190 bp, the tested indica-indica subspecies intrahybrid rice is normally fertile; When the band pattern of the amplified product shows one band at 195-205 bp and one band at 180-190 bp, the indica-indica subspecies hybrid rice to be tested is semi-sterile.

4. A method for identifying pollen fertility of Indica-Indica intra-subspecies hybrid rice, characterized in that: The method comprises using DNA of an indica-indica subspecies intrahybrid rice to be tested as a template, amplifying with the primer pair described in claim 3, and determining the pollen fertility of the indica-indica subspecies intrahybrid rice according to the band pattern of the amplified product; when a band appears at 195-205 bp or 180-190 bp, the indica-indica subspecies intrahybrid rice to be tested is normally fertile; When one band appears at 195-205 bp and one band appears at 180-190 bp, the tested indica-indica intra-subspecific hybrid rice is semi-sterile; the female parent of the indica-indica intra-subspecific hybrid rice is IR64, and the male parent is Swarna.

Images