A dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype
Through the dual microfluidic fluorescent PCR detection kit of avian influenza virus H3N2 subtype combined with real-time fluorescence quantitative PCR and MAOPA technology, the limitations of traditional detection technology on mixed infection AIV detection are solved, and efficient and sensitive H3 and N2 subtype AIV detection is achieved, which reduces false positive rates and human operation errors, and improves the accuracy and efficiency of the detection.
Patent Information
- Application Number
- CN202510602888.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2045-05-12
AI Technical Summary
Traditional detection technology has limitations in the detection of mixed-infectious AIV, and it is difficult to effectively distinguish and detect infection of H3N2 subtype avian influenza virus.
Using real-time fluorescence quantitative PCR technology and magnetic bead-mediated integrated polymerase amplification (MAOPA) technology, a dual microfluidic fluorescence PCR detection kit is developed for avian influenza virus H3N2 subtype, including sample lysis extract, washing liquid and reaction premix. Viral RNA is adsorbed through magnetic beads and fluorescence quantitative PCR reaction is carried out.
It has achieved efficient differential diagnosis of H3 and N2 subtype AIV, with high sensitivity and strong specificity, and can detect early trace viruses, reduce the risk of cross-contamination, and improve the accuracy and efficiency of detection results.
Smart Images

Figure CN120099234B_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the technical field of virus detection, and more specifically, to a dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype. Background Art
[0002] Influenza viruses belong to the Orthomyxoviridae family of RNA viruses and are divided into three types: A, B, and C. Type A influenza virus is most common in poultry, and avian influenza virus (AIV) is a type A influenza virus. Based on pathogenicity, avian influenza viruses are categorized as highly pathogenic (HPAI) (subtypes H5 and H7) and less pathogenic (LPAI) (subtype H9). HPAI is a rapidly spreading, highly lethal animal disease, designated a Category I disease by the World Health Organization (WOAH). LPAI is a Category III animal disease. The H3 subtype of AIV is a less pathogenic avian influenza virus. While its pathogenicity is low, its effects are persistent, allowing it to persist in poultry for extended periods and infect a wide range of animals. The N2 subtype of AIV is a common NA subtype that infects poultry (H9N2) and can cause disease. Genetic exchange often occurs between different AIV subtypes. Due to the rapid mutation rate of AIV, traditional detection techniques are limited in detecting mixed infections, significantly hindering the prevention and control of avian influenza.
[0003] Real-time fluorescence quantitative PCR (qPCR) is a technique developed from the polymerase chain reaction (PCR). It is rapid, sensitive, and highly specific, capable of real-time monitoring and reproducible, precise quantification. Magnetic bead-mediated integrated polymerase amplification (MAOPA) technology integrates nucleic acid extraction and amplification, offering features such as a fully closed process, high sensitivity, robust stability, intelligent result output, and remote visual monitoring. Combining real-time fluorescence quantitative PCR with MAOPA to develop a MAOPA-based microfluidic fluorescence PCR detection kit for avian influenza virus could provide a more efficient detection method for AIV prevention and control. Based on the above, this application proposes a dual microfluidic fluorescence PCR detection kit for the H3N2 subtype of avian influenza virus. Summary of the Invention
[0004] In order to solve the problem that traditional detection technology has limitations in detecting mixed-infection AIV, the present application provides a dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype.
[0005] In a first aspect, the present application provides a dual microfluidic fluorescence PCR detection kit for H3N2 subtype avian influenza virus, comprising a sample lysis extract, sample washing solution I, sample washing solution II, and a reaction premix for detecting H3N2 subtype avian influenza virus.
[0006] Preferably, the sample lysis extract has a volume of 1200 μL and includes the following components: guanidine hydrochloride, guanidine isothiocyanate, NaCl, isopropanol, Tween 20, Triton-X10, EDTA and Tris-HCl.
[0007] Preferably, the sample lysis extract comprises the following components: 2M guanidine hydrochloride, 1M guanidine isothiocyanate, 0.5M NaCl, 30% isopropanol, 2% Tween 20, 1% Triton-X10, 0.5mM EDTA, and 12mM Tris-HCl.
[0008] Preferably, the volume of the sample washing solution I is 150 μL, and includes the following components: guanidine hydrochloride, Tris-HCl, EDTA, NaCl, Tween 20 and ethanol.
[0009] Preferably, the sample washing solution I comprises the following components: 1 M guanidine hydrochloride, 10 mM Tris-HCl, 1 mM EDTA, 0.2 M NaCl, 3% Tween 20 and 50% ethanol.
[0010] Preferably, the volume of the sample washing solution II is 150 μL, and includes the following components: ethanol and Tween20.
[0011] Preferably, the sample washing solution II comprises the following components: 60% ethanol and 2% Tween20.
[0012] Preferably, the reaction premix volume is 40 μL, including H3 specific sequence combination, N2 specific sequence combination, internal standard gene specific sequence combination, RNA-direct realtime PCR master mix and Mn 2+ .
[0013] Preferably, the H3-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are:
[0014] H3-F: AAAGACCAGAAGGCAGCTAAG (SEQ ID NO. 1);
[0015] H3-R: TTGTTCAGTGCCTCATCTCG (SEQ ID NO.2);
[0016] H3-probe: TCCCGTTCCTAATTGATTCTATGCAGGC (SEQ ID NO. 3);
[0017] The fluorescence reporter group of the H3-probe is FAM, and the fluorescence quencher group of the H3-probe is BHQ1.
[0018] Preferably, the N2-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are:
[0019] N2-F: GGCTTCACGTTTGTGTTACTG (SEQ ID NO.4);
[0020] N2-R: GACGCATTCTGACTCCTGAG (SEQ ID NO.5);
[0021] N2-probe: ACCCCATTATAAATGAAACTGGCGGTCG (SEQ ID NO. 6);
[0022] The fluorescence reporter group of the N2-probe is VIC, and the fluorescence quencher group of the N2-probe is BHQ2.
[0023] Preferably, the internal standard gene-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are:
[0024] 18S-F: ACGGACAGGATTGACAGATTG (SEQ ID NO. 7);
[0025] 18S-R: ACCAACTAAGAACGGCCATG (SEQ ID NO. 8);
[0026] 18S-probe: CACCCACGGAATCGAGAAAGAGCTA (SEQ ID NO. 9);
[0027] The fluorescence reporter group of the 18S-probe is ROX, and the fluorescence quencher group of the 18S-probe is BHQ3.
[0028] Preferably, the reaction premix includes H3-F 0.3 μM, H3-R 0.3 μM, H3-probe 0.2 μM, N2-F 0.3 μM, N2-R 0.3 μM, N2-probe 0.2 μM, 18S-F 0.3 μM, 18S-R 0.3 μM, 18S-probe 0.2 μM, 1× RNA-directrealtime PCR master mix and 2.5 mM Mn 2+ .
[0029] In a second aspect, the present application provides an integrated detection method for a dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype, specifically comprising the following steps:
[0030] S1. Store the sample lysis extract in the first chamber of the integrated detection reagent card (from top to bottom); store the sample wash solution I in the second chamber of the integrated detection reagent card; store the sample wash solution II in the third chamber of the integrated detection reagent card; store the reaction premix in the fourth chamber of the integrated detection reagent card;
[0031] S2. Add 600 μL of the sample to be tested and 10 μL of magnetic beads to the integrated detection reagent card, seal the card, and perform the following reactions step by step inside the integrated detection reagent card:
[0032] (1) The sample to be tested is lysed, and the magnetic beads adsorb H3 subtype avian influenza virus RNA, N2 subtype avian influenza virus RNA, and internal standard gene RNA;
[0033] (2) The magnetic beads adsorb H3 subtype avian influenza virus RNA, N2 subtype avian influenza virus RNA, and internal standard gene RNA for directional movement, and then wash to remove impurities, proteins, and other non-nucleic acid samples on the magnetic beads;
[0034] (3) The magnetic beads enter the molecular amplification reaction area, the viral RNA dissociates from the magnetic beads, and the RNA is reverse transcribed into the corresponding cDNA under the action of reverse transcriptase, and a dual fluorescence quantitative PCR reaction is performed;
[0035] (4) Analyze whether the sample is infected with the H3N2 subtype avian influenza virus based on the fluorescence curve.
[0036] In summary, this application has the following beneficial effects:
[0037] 1. This application realizes the differential diagnosis of H3 subtype AIV and N2 subtype AIV in a single reaction, which can not only confirm whether the patient is infected with avian influenza virus, but also reveal whether it is a single or double infection. Compared with single gene detection, it is more efficient and time-saving. Through optimization and screening, the best designed specific primers and probes are designed, which have the advantages of high sensitivity, strong specificity and good repeatability.
[0038] 2. The dual microfluidic fluorescence PCR detection kit for the H3N2 subtype of avian influenza virus of the present application does not produce obvious amplification curves for other subtypes of avian influenza viruses and common poultry pathogens (H5N1 subtype AIV, H4N5 subtype AIV, infectious bronchitis virus, Marek's virus, new gosling plague virus, avian reovirus, duck parvovirus, duck astrovirus, avian adenovirus, goose parvovirus), indicating that the kit of the present application has strong specificity.
[0039] 3. The dual microfluidic fluorescent PCR detection kit for the H3N2 subtype of avian influenza virus of this application uses MAOPA integrated nucleic acid detection technology. After extraction, the entire viral sample nucleic acid is fully incorporated into the reaction solution. This significantly improves analytical sensitivity compared to conventional fluorescent PCR detection reagents. The detection limit for both H3 and N2 subtype AIVs is 10 copies / mL, enabling the detection of trace amounts of virus in the early stages of infection, enabling timely detection and control of epidemics.
[0040] 4. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype of the present application has good repeatability, with the coefficient of variation within and between groups being less than 5%.
[0041] 5. The dual microfluidic fluorescence PCR detection kit for the H3N2 subtype of avian influenza virus of the present application is used in combination with the MAOPA integrated detection technology to achieve a fully enclosed, pollution-free, integrated reaction, which minimizes the risk of cross-contamination of samples during the detection process, reduces the false positive rate, and greatly reduces labor costs, time costs, and the impact of human operational errors, effectively improving the accuracy of the test results. BRIEF DESCRIPTION OF THE DRAWINGS
[0042] Figure 1 The specific detection results of the dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype in Example 2. (1: H3 subtype AIV; 2: N2 subtype AIV; 3-12: other subtypes of AIV and common poultry pathogens; 13-24: internal standard genes).
[0043] Figure 2 The sensitivity test results of the dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype in Example 3 are shown. (1-5: 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 Copies / mL of H3 subtype AIV pseudovirus standard; 6-10: 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 Copies / mL of N2 subtype AIV pseudovirus standard; 11-15: 1×10 3 copies / mL of internal standard gene pseudovirus standard).
[0044] Figure 3The sensitivity test results of conventional RT-qPCR reagents for H3 and N2 subtype avian influenza viruses in Example 3 are shown. (Figure A: 1-5 are 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 Copies / mL of H3 subtype AIV pseudovirus standard; Figure B: 6-10 is 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 copies / mL of N2 subtype AIV pseudovirus standard). DETAILED DESCRIPTION
[0045] The present application is further described in detail below with reference to the embodiments.
[0046] Example 1
[0047] 1. Design of pathogen primers and probes
[0048] Published sequences of the HA gene of the H3 subtype avian influenza virus and the NA gene of the N2 subtype avian influenza virus were searched in Genbank. Conserved regions were identified through multiple sequence alignment. Based on the design principles of fluorescent quantitative PCR primers and probes, multiple pairs of primers and probes were designed. Through analysis and comparison, and after screening, the optimal primers and probes were identified, as shown in Table 1. The optimal primers were used to amplify nucleic acids from H3 and N2 subtype-positive samples. The amplified products were ligated into the pET-32a-MS2 plasmid to prepare H3 and N2 subtype AIV-positive pseudovirus standards.
[0049] Table 1
[0050]
[0051] 2. Design of internal standard primers and probes
[0052] 18S rRNA is a conserved sequence that is widely present in various species, distributed in different tissues and cells. It is highly conserved and stable, making it an ideal internal standard. Clinically, 18S rRNA can be detected even in trace tissue samples. Therefore, we searched GenBank for published full-length 18S rRNA sequences from mammals and birds. Through multiple sequence alignment analysis, we selected a conserved region for primer and probe design, identifying an optimal combination, as shown in Table 2. The optimal primers were used for amplification, and the amplified fragment was ligated into the pET-32a-MS2 plasmid to prepare a positive pseudovirus standard for the internal standard gene.
[0053] Table 2
[0054]
[0055] 3. Steps for using the test reagent card
[0056] Open the lid of the detection reagent card, then open the sealing film, and add 10μL of magnetic beads, 20μL of internal standard gene pseudovirus standard, and 600μL of the sample to be tested in this order, and beat with a pipette to mix, and finally close the lid tightly.
[0057] 4. Reaction system and reaction conditions
[0058] The optimal reaction system was: H3-F 0.3μM, H3-R 0.3μM, H3-probe 0.2μM, N2-F 0.3μM, N2-R 0.3μM, N2-probe 0.2μM, 18S-F 0.3μM, 18S-R 0.3μM, 18S-probe 0.2μM, 1× RNA-direct realtime PCR master mix and 2.5mM Mn 2+ .
[0059] The optimal reaction conditions were: 90℃ for 30s, 60℃ for 20min, 95℃ for 1min; 95℃ for 15s, 60℃ for 30s, 40 cycles.
[0060] 5. Result determination
[0061] After the detection program is completed, the applicable instrument automatically reports the detection results of H3 subtype AIV (FAM), N2 subtype AIV (VIC), and internal standard gene (ROX).
[0062] If the results for H3 subtype AIV (FAM) and N2 subtype AIV (VIC) show a clear S-shaped amplification curve (including an S-shaped curve with a clear exponential phase but not a plateau phase) and a Ct ≤ 38, the corresponding result is considered positive. The internal standard gene ROX fluorescence channel detection result should also show a clear S-shaped amplification curve (including an S-shaped curve with a clear exponential phase but not a plateau phase). If both fluorescence channels (FAM and VIC) are negative and the internal standard gene (ROX) Ct ≤ 38, the test result is valid. Otherwise, resampling and retesting are required.
[0063] Example 2
[0064] Specificity detection of avian influenza virus H3N2 subtype using a dual microfluidic fluorescence PCR detection kit.
[0065] Using H3 subtype AIV pseudovirus standard, N2 subtype AIV pseudovirus standard, H5N1 subtype AIV virus nucleic acid, H4N5 subtype AIV virus nucleic acid, infectious bronchitis virus nucleic acid, Marek's virus nucleic acid, new goose plague virus nucleic acid, avian reovirus nucleic acid, duck parvovirus nucleic acid, duck astrovirus nucleic acid, avian adenovirus nucleic acid, goose parvovirus nucleic acid (corresponding to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12, respectively) as templates, and internal standard gene pseudovirus standards (internal standard genes 13-24 correspond to positive pathogen nucleic acids 1-12, respectively) are added to each reagent card as internal quality control, and fluorescent quantitative PCR amplification reaction is performed according to the optimal reaction system and conditions described in Example 1.
[0066] Test results such as Figure 1 As shown, both the H3 and N2 subtype AIV pseudovirus standards exhibited distinct amplification curves, as did the internal standard gene pseudovirus standard, indicating good reaction quality control. However, nucleic acid standards for other subtypes of AIV and common poultry pathogens did not produce distinct amplification curves. This demonstrates the high specificity of the Dual Microfluidic Fluorescence PCR Detection Kit for the H3N2 Subtype of Avian Influenza Virus.
[0067] Example 3
[0068] Comparison of sensitivity between dual microfluidic fluorescence PCR detection kit and conventional RT-qPCR reagents for avian influenza virus H3N2 subtype.
[0069] The H3 subtype AIV pseudovirus standard was diluted in 10-fold gradient (concentration of 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6copies / mL, corresponding to 1-5, respectively), N2 subtype AIV pseudovirus standard diluted 10-fold (concentration of 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 copies / mL, corresponding to 6-10) and a concentration of 1×10 3 The internal standard gene pseudovirus standard (corresponding to 11-15 copies / mL) was used as a template, and fluorescence quantitative PCR detection was performed according to the optimal reaction system and conditions described in Example 1.
[0070] The test results of the dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype are as follows Figure 2 As shown in Figure 2, the detection sensitivity of H3 subtype AIV and N2 subtype AIV pseudovirus standards is 10 copies / mL; the detection results of conventional RT-qPCR reagents are shown in Figure 2. Figure 3 As shown, the detection sensitivity of H3 and N2 subtype AIV pseudovirus standards was 1×10 3 Copies / mL; This indicates that the test kit in this application has high sensitivity and can detect trace amounts of virus in the early stages of infection, allowing for timely discovery and control of epidemics.
[0071] Example 4
[0072] Repeatability testing of a dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype.
[0073] The concentration is 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 Intra-assay reproducibility experiments were conducted with H3 subtype AIV and N2 subtype AIV pseudovirus standards at 100 copies / mL. Each sample was replicated in triplicate and dual fluorescence quantitative PCR was performed according to the optimal reaction system and conditions described in Example 1. The mean Ct value, standard deviation, and coefficient of variation of the reaction results were calculated, and the results are shown in Table 3.
[0074] Table 3
[0075]
[0076] The concentration is 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4Inter-batch reproducibility experiments were conducted with H3 subtype AIV and N2 subtype AIV pseudovirus standards at 100 copies / mL. Each sample was tested in triplicate using the optimal reaction system and conditions described in Example 1. Dual fluorescence quantitative PCR was performed, with replicates performed at two different time points. The mean Ct value, standard deviation, and coefficient of variation of the reaction results were calculated. The results are shown in Table 4.
[0077] Table 4
[0078]
[0079] According to Tables 3 and 4, the coefficients of variation within and between groups were less than 5%, the coefficient of variation within the group ranged from 0.87% to 2.87%, and the coefficient of variation between the groups ranged from 1.24% to 3.33%, indicating good repeatability both within and between groups.
[0080] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.
[0081] <110> Taizhou Leiling Biotechnology Co., Ltd.
[0082] <120> Avian Influenza Virus H3N2 Subtype Dual Microfluidic Fluorescence PCR Detection Kit
[0083] <160> 9
[0084] <170> SIPO SequenceListing 1.0
[0085] <210> 1
[0086] <211> twenty one
[0087] <212> DNA
[0088] <213> Artificial Sequence
[0089] <400> 1
[0090] aaagaccaga aggcagctaa g 21
[0091] <210> 2
[0092] <211> 20
[0093] <212> DNA
[0094] <213> Artificial Sequence
[0095] <400> 2
[0096] ttgttcagtg cctcatctcg 20
[0097] <210> 3
[0098] <211> 28
[0099] <212> DNA
[0100] <213> Artificial Sequence
[0101] <400> 3
[0102] tcccgttcct aattgattct atgcaggc 28
[0103] <210> 4
[0104] <211> twenty one
[0105] <212> DNA
[0106] <213> Artificial Sequence
[0107] <400> 4
[0108] ggcttcacgt ttgtgttact g 21
[0109] <210> 5
[0110] <211> 20
[0111] <212> DNA
[0112] <213> Artificial Sequence
[0113] <400> 5
[0114] gacgcattct gactcctgag 20
[0115] <210> 6
[0116] <211> 28
[0117] <212> DNA
[0118] <213> Artificial Sequence
[0119] <400> 6
[0120] accccattat aaatgaaact ggcggtcg 28
[0121] <210> 7
[0122] <211> twenty one
[0123] <212> DNA
[0124] <213> Artificial Sequence
[0125] <400> 7
[0126] acggacagga ttgacagatt g 21
[0127] <210> 8
[0128] <211> 20
[0129] <212> DNA
[0130] <213> Artificial Sequence
[0131] <400> 8
[0132] accaactaag aacggccatg20
[0133] <210> 9
[0134] <211> 25
[0135] <212> DNA
[0136] <213> Artificial Sequence
[0137] <400> 9
[0138] cacccacgga atcgagaaag agcta 25.
Claims
1. A dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype, characterized in that: The method comprises a sample lysis extract, a sample washing solution I, a sample washing solution II, and a reaction premix for detecting H3N2 subtype avian influenza virus; The reaction premix includes an H3 specific sequence combination, an N2 specific sequence combination, an internal standard gene specific sequence combination, an RNA-direct realtime PCR master mix, and an Mn 2+ ; The H3-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: H3-F: AAAGACCAGAAGGCAGCTAAG (SEQ ID NO. 1); H3-R: TTGTTCAGTGCCTCATCTCG (SEQ ID NO.2); H3-probe: TCCCGTTCCTAATTGATTCTATGCAGGC (SEQ ID NO. 3); The fluorescence reporter group of the H3-probe is FAM, and the fluorescence quencher group of the H3-probe is BHQ1; The N2-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: N2-F: GGCTTCACGTTTGTGTTACTG (SEQ ID NO.4); N2-R: GACGCATTCTGACTCCTGAG (SEQ ID NO.5); N2-probe: ACCCCATTATAAATGAAACTGGCGGTCG (SEQ ID NO. 6); The fluorescence reporter group of the N2-probe is VIC, and the fluorescence quencher group of the N2-probe is BHQ2.
2. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype according to claim 1, characterized in that: The sample lysis extraction solution includes the following components: guanidine hydrochloride, guanidine isothiocyanate, NaCl, isopropanol, Tween 20, Triton-X10, EDTA and Tris-HCl.
3. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype according to claim 1, characterized in that: The sample washing solution I includes the following components: guanidine hydrochloride, Tris-HCl, EDTA, NaCl, Tween 20 and ethanol.
4. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype according to claim 1, characterized in that: The sample washing solution II includes the following components: ethanol and Tween20.
5. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype according to claim 1, characterized in that: The internal standard gene-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: 18S-F: ACGGACAGGATTGACAGATTG (SEQ ID NO. 7); 18S-R: ACCAACTAAGAACGGCCATG (SEQ ID NO. 8); 18S-probe: CACCCACGGAATCGAGAAAGAGCTA (SEQ ID NO. 9); The fluorescence reporter group of the 18S-probe is ROX, and the fluorescence quencher group of the 18S-probe is BHQ3.
Citation Information
Patent Citations
Primers, probes and kit for specifically detecting H3N2 swine influenza virus
CN107385113A
Nucleic acid composition for respiratory tract pathogen detection and application thereof
CN119913289A