SERS (Surface Enhanced Raman Scattering) magnetic nano biosensor based on assistance of catalytic hairpin assembly technology and application of SERS magnetic nano biosensor in circRNA (Ribonucleic Acid) detection

Through the SERS magnetic nanobiosensitive sensor assisted by catalytic hairpin assembly technology, the existing circRNA detection methods have solved the problems of low sensitivity and complex operation, and achieved the effect of high sensitivity and specific detection of circRNA in complex biological samples.

CN120102867APending Publication Date: 2025-06-06QUANZHOU NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510216594.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-26
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The existing circRNA detection methods are complex in operation, time-consuming, low sensitivity and high cost, making it difficult to achieve high sensitivity and specific detection in complex biological samples.

Method used

Using SERS magnetic nanobio-sensor assisted by catalytic hairpin assembly technology, the SERS magnetic nanobio-sensor is designed to match the sequence of the circRNA anti-shearing site, modify the surface of magnetic nanoparticles and silver-clad gold nanoparticles, and build a cyclic amplification system to realize quantitative detection of circRNA.

Benefits of technology

It realizes ultra-sensitive detection of trace circRNA in blood in complex biological samples, with high specificity and wide dynamic detection range, simplifying the detection process and reducing costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120102867A_ABST
    Figure CN120102867A_ABST
Patent Text Reader

Abstract

The invention discloses an SERS (Surface Enhanced Raman Scattering) magnetic nano biosensor based on assistance of a catalytic hairpin assembly technology and an application of the SERS magnetic nano biosensor in circRNA (Ribonucleic Acid) detection. According to the technical thought, magnetic nanoparticles Fe3O4 (at) Ag (at) DTBN MNPs with a self-calibration function are prepared, silver-coated gold nanoparticles with Raman signal molecules are prepared through a seed method, then corresponding hairpin DNA structures are designed according to an anti-shearing site sequence of circRNA, the hairpin DNA structures are modified on the surfaces of the silver-coated gold nanoparticles and the surfaces of Fe3O4 (at) Ag (at) DTBN MNPs respectively, and the magnetic nanoparticles Fe3O4 (at) Ag (at) DTBN MNPs with the self-calibration function are obtained. According to the method, hairpin DNA (deoxyribonucleic acid) HP1 chain functionalized coded magnetic nanoparticles Fe3O4 (at) Ag (at) DTBN-HP1 MNPs and hairpin DNA HP2 chain functionalized coded silver-coated gold nanoparticles Au (at) Reporter (at) Ag-HP2 NPs are respectively obtained, and a cyclic amplification system is constructed by utilizing enzyme-free isothermal amplification and nuclear satellite structure magnetic SERS (Surface Enhanced Raman Scattering) nanospheres, so that ultrasensitive quantitative detection of circRNA genes is realized. The SERS magnetic nano biosensor provided by the invention has the advantages of high sensitivity, high specificity, high flux, no need of enzyme participation and the like, and can realize rapid detection of one or more circRNAs in complex reaction systems such as serum and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of detection technology, and in particular relates to a SERS magnetic nanobiosensor assisted by catalytic hairpin assembly technology and an application thereof in circRNA detection. Background Art

[0002] In recent years, circular RNA (circRNA) has been widely explored as one of the important new biomarkers. CircRNA is a type of single-stranded closed-loop RNA molecule, which is a covalently closed circular molecule formed by reverse splicing and alternative splicing of precursor mRNA. At present, the main methods for detecting circRNA include Northern blotting, RT-qPCR (reverse transcription polymerase chain reaction), microarray analysis and fluorescence-based technology, but these methods are complicated to operate, time-consuming, low in sensitivity and high in cost. Therefore, it is urgent to develop a sensing platform with excellent performance, simple processing, ultra-high sensitivity, high selectivity, and a wide dynamic detection range, so as to achieve specific capture and identification of circRNA in blood.

[0003] Surface enhanced Raman spectroscopy (SERS) is an ultra-sensitive and highly specific optical detection technology that has been widely used in biomedical analysis. It is used to provide rich molecular fingerprint information and intrinsic chemical properties for single biological analytes (proteins, DNA and RNA). Therefore, SERS technology has important application potential in the field of biomedical detection. With the rapid development of portable Raman spectrometers, a large number of studies have designed various types of kits based on SERS biosensors and used portable Raman spectrometers for detection, overcoming the problems of high equipment requirements and operator requirements of the above methods. Summary of the invention

[0004] The purpose of the present invention is to provide a SERS magnetic nanobiosensor assisted by catalytic hairpin assembly technology and its application in circRNA detection, so as to achieve ultra-sensitive, accurate and short-time determination of circRNA quantitative detection in complex blood samples.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] A SERS magnetic nanobiosensor based on catalytic hairpin assembly technology, comprising a hairpin DNAHP1 chain functionalized coded magnetic nanoparticles Fe 3 O 4 @Ag@DTBN-HP1 MNPs and hairpin DNAHP2 chain functionalized encoded silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs, the hairpin DNAHP1 chain functionalized encoded magnetic nanoparticles Fe3 O 4 The preparation method of @Ag@DTBN-HP1 MNPs is as follows: firstly, Fe 3 O 4 @Ag@DTBNMNPs were then functionalized with the hairpin DNA HP1 structure as follows: (1) 0.2 g of Fe 3 O 4 MNPs were dispersed in PEI solution (1 mg / mL, 0.25 g) and sonicated for 2 h to synthesize Fe by the PEI self-assembly process. 3 O 4 @PEI MNPs, followed by the addition of 3 nm Au NPs (50 μL) and sonication for 1 h to form Fe 3 O 4 @PEI@Au-see MNPs, 10mg Fe 3 O 4 @PEI@Au-see MNPs were dispersed in 100 mL of 0.25 mM silver nitrate aqueous solution containing 0.2 wt % PVP, and then excess 37% formaldehyde (150 μL) and 25% ammonia water (300 μL) were added in sequence. After ultrasonic treatment at 30 °C for 15 min, Fe 3 O 4 @Ag MNPs; (2) 1 mg of Fe 3 O 4 @Ag MNPs were added with 100 μL of DTNB (1 mM) and then ultrasonicated for 1 hour and washed three times with PBST to prepare carboxylated Fe 3 O 4 @Ag@DTBN MNPs, then add a solution containing 50mM NHS and 200mM EDC to incubate for 30-40min to activate the carboxyl groups, and wash three times. 3 O 4 The hairpin DNA HP1 (10 μM) solution (5 μL), PBS (1x) solution (10 μL), 0.02 M sodium chloride solution (10 μL) and 0.1 M sodium chloride solution (10 μL) were added to the @Ag@DTNB MNPs in sequence, and the shaking was performed at 220-230 rpm for 1-1.5 h. The magnetic nanoparticles were washed with 0.1 mM PBS solution to obtain the encoded magnetic nanoparticles Fe functionalized with the hairpin DNA HP1 chain. 3 O 4 @Ag@DTBN-HP1 MNPs were placed at 4°C for use;

[0007] The preparation method of the hairpin DNA HP2 chain functionalized encoded silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs is as follows: 10 μL of 1 mM Raman labeling molecule (Reporter) is added to 10 mL of Au NPs (1.2 x 10 11 The mixture was stirred at room temperature for 2-2.5 hours, then centrifuged at 9000 rpm for 10 minutes and resuspended in ultrapure water, followed by the addition of 100 μL 1% sodium citrate solution, 200 μL 0.1 M sodium hydroxide solution, 1 mL 1 mM silver nitrate solution and 1 mL 10 mM ascorbic acid solution, stirred at room temperature for 0.5 hours, centrifuged at 8500 rpm for 8 minutes and resuspended in ultrapure water to obtain Au@Reporter@Ag NPs. Finally, 10 μL of 10 μM hairpin DNAHP2 solution, PBS (1x) solution, 0.02 M sodium chloride solution and 0.1 M sodium chloride solution were added in sequence at intervals of 20 minutes, and the mixture was allowed to stand at 4°C for 12-14 hours, centrifuged at 8000 rpm for 6 minutes and resuspended in 0.1 mM PBS to obtain Au@Reporter@Ag-HP2 NPs, which were stored at 4°C for use.

[0008] Furthermore, the Fe 3 O 4 The preparation method of MNPs is as follows: 1.35 g of ferric chloride was weighed and added to 20 mL of ethylene glycol, and dissolved by magnetic stirring at a speed of 1500 rpm for 10 min. Then 3.6 g of sodium acetate was added to the above solution, heated at 60 ° C and stirred for 30 min, and the resulting solution was transferred to a high-pressure reactor in a drying oven and placed at 200 ° C for 10 h. Finally, the black precipitate was washed with anhydrous ethanol and deionized water, and then magnetically separated and dried in a vacuum oven at 60 ° C for 6 h to obtain Fe 3 O 4 MNPs.

[0009] Furthermore, the hairpin DNA HP1 strand and the hairpin DNA HP2 strand were designed according to the circRNA anti-splicing site sequence.

[0010] Furthermore, the reporter can be any one of 4-mercaptobenzoic acid (MBA), 2-mercapto-4-methyl-5-thiazoleacetic acid (MMTAA), 4-mercaptophenylboronic acid (MPBA), 2,3,5,6-tetrafluoro-4-mercaptobenzoic acid (TFMBA), etc.

[0011] Furthermore, the hairpin DNA HP1 strand was annealed at 95°C for 5 min and then naturally cooled at room temperature before being modified on the Fe 3 O 4@Ag@DTBN MNPs surface.

[0012] Furthermore, the hairpin DNA HP2 strand was annealed at 95 °C for 5 min and then naturally cooled at room temperature before being encoded on the surface of Au@Reporter@Ag NPs.

[0013] Furthermore, Fe 3 O 4 @Ag@DTBN-HP1 MNPs were incubated with HS-PEG (10 μM) for 0.5 h to block the redundant sites and reduce nonspecific adsorption.

[0014] The present invention also provides the use of the SERS magnetic nanobiosensor assisted by catalytic hairpin assembly technology in circRNA detection, comprising the following steps:

[0015] S1: Standard solutions of different concentrations (0-10 nM), encoded magnetic nanoparticles functionalized with hairpin DNA HP1 chains, 3 O 4 The mixed silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs functionalized with hairpin DNA HP2 chains were incubated at 37°C for 0.5 to 3.5 h. After repeated washing with ultrapure water, the spectral information was collected by a portable Raman spectrometer. The Raman intensity of the characteristic peak of the Raman marker molecule was compared with that of the Fe@Reporter@Ag-HP2 NPs. 3 O 4 @Ag@DTBN-HP1 MNPs are located at 1335 cm -1 The standard working curve is constructed by the intensity ratio of the Raman characteristic peaks;

[0016] S2: Encoded magnetic nanoparticles Fe functionalized with the sample to be tested and the hairpin DNA HP1 chain 3 O 4 @Ag@DTBN-HP1MNPs and hairpin DNA HP2 chain functionalized encoded silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs were mixed and incubated at 37°C for 0.5 to 3.5 h. The Raman intensity of the characteristic peaks of the samples to be tested and the Fe 3 O 4 @Ag@DTBN-HP1 MNPs are located at 1335 cm -1 The concentration of the sample to be tested is calculated based on the Raman characteristic peak intensity ratio of the standard sample.

[0017] The present invention adopts the above technical scheme to prepare magnetic nanoparticles Fe with self-calibration function 3 O 4The silver-coated gold nanoparticles with Raman signal molecules were prepared by the seed method. Then, the corresponding hairpin DNA structure was designed according to the anti-splicing site sequence of circRNA and modified on the silver-coated gold nanoparticles Au@Reporter@Ag NPs and magnetic nanoparticles Fe 3 O 4 @Ag@DTBN MNPs surface, respectively, to obtain the encoded magnetic nanoparticles Fe 3 O 4 @Ag@DTBN-HP1 MNPs and hairpin DNAHP2 chain-functionalized encoded silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs were used to construct a circular amplification system to achieve quantitative detection of circRNA genes.

[0018] The working principle of the SERS magnetic nanobiosensor based on catalytic hairpin assembly technology of the present invention is as follows: Figure 1 As shown: When the target circRNA is present, the number of complementary bases between the circRNA anti-scission site and the hairpin DNA HP1 structure is greater than the stem-loop portion bound to the hairpin DNA HP1 structure itself, thereby opening the hairpin structure to form an RNA-DNA double-stranded structure. Since the hairpin DNA HP2 structure has more complementary bases than the hairpin DNA HP1 structure, it competitively binds to replace the binding site of the target circRNA and HP1, and the released target circRNA induces the next cycle, namely, catalyzing the enzyme-free isothermal cyclic amplification reaction (CHA) of hairpin assembly. Among them, the hairpin DNA HP1 and hairpin DNA HP2 structures form a stable double-stranded structure through complementary base pairing, thereby capturing the hairpin DNA HP2-functionalized encoded Au@Reporter@Ag NPs on the hairpin DNA HP1-functionalized Fe 3 O 4 @Ag@DTBN MNPs form a core-satellite structure on the surface, so the capture quantity of the encoded Au@Reporter@Ag NPs is positively correlated with the concentration of the target circRNA. 3 O 4 @Ag@DTBN MNPs at 1335cm -1 The peak intensity ratio at the 100 nm position is used to construct a standard working curve or calculate the concentration of the target chain. On the contrary, if the target circRNA is not present, the hairpin DNA HP1 structure cannot be opened, and the enzyme-free isothermal cyclic amplification reaction cannot be started. The magnetic nanosensor cannot detect the signal of Au@Reporter@Ag NPs by measuring with a portable Raman spectrometer.

[0019] The beneficial effects of the present invention are: 1) preparing Fe by solvothermal method 3 O 4 MNPs, and modifying SERS-active plasmonic particles by electrostatic adsorption, can provide "hot spots" to form a coupling effect with the encoded Au@Reporter@Ag NPs functionalized with hairpin DNA HP2, thereby improving the detection sensitivity. 3 O 4 @Ag@DTBN MNPs carry their own signal molecules at 1335cm- 1 The characteristic peak of the Raman signal is used as a calibration signal to correct the signal fluctuations caused by the instrument and other physical environments. 3 O 4 @Ag@DTBN MNPs can improve the accuracy of detection as a magnetic nanosensor. 3) The CHA reaction is used to further amplify the signal of the SERS enhancement model, which greatly improves the sensitivity of detection. In addition, based on the high specificity of the hairpin DNA structure, this model can be used to achieve ultra-sensitive detection of trace circRNA in blood in complex biological samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a schematic diagram of the working principle of the present invention.

[0021] Figure 2 Fe prepared in Example 1 3 O 4 @Ag MNPs magnetic nanoparticles SEM and elemental mapping.

[0022] Figure 3 To illustrate the characteristic peak intensity ratio of CHA reaction at different temperatures (Figure a) and times (Figure b) when detecting circVAPA in Example 2.

[0023] Figure 4 Fe prepared in Example 2 3 O 4 Stability of Raman intensity of @Ag@DTBN MNPs under different pH conditions.

[0024] Figure 5 The Raman spectral curve (a) and standard working curve (b) of circVAPA detected at different concentrations in Example 3.

[0025] Figure 6 It is the specific detection result of the present invention. DETAILED DESCRIPTION

[0026] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments. Obviously, the embodiments described below are only part of the implementation methods of the present invention, not all of the implementation methods.

[0027] The hairpin DNA structures in the embodiments of the present invention were all synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0028] MNPs: magnetic nanoparticles

[0029] NPs: nanoparticles

[0030] PEI solution: Polyethyleneimine solution

[0031] DTNB: 5,5'-dithiobis(2-nitrobenzoic acid)

[0032] PBST: Phosphate buffered saline with Tween-20

[0033] PBS: Phosphate buffered saline

[0034] HS-PEG: thiol polyethylene glycol propyne

[0035] NHS: N-hydroxysuccinimide

[0036] EDC: Carbodiimide

[0037] Example 1

[0038] Synthetic Fe 3 O 4 @Ag MNPs

[0039] (1) Weigh 1.35 g of ferric chloride, add it to 20 mL of ethylene glycol, and dissolve it by magnetic stirring at 1500 rpm for 10 min. Then add 3.6 g of sodium acetate to the above solution, heat at 60°C and stir for 30 min, transfer the resulting solution to a high-pressure reactor in a drying oven, and place it at 200°C for 10 h. Finally, wash the black precipitate with anhydrous ethanol and deionized water, then perform magnetic separation and dry it in a vacuum oven at 60°C for 6 h to obtain Fe 3 O 4 MNPs.

[0040] (2) 0.2 g of Fe 3 O 4 MNPs were dispersed in PEI solution (1 mg / mL, 0.25 g) and sonicated for 2 h to synthesize Fe by the PEI self-assembly process. 3 O 4 @PEI MNPs. Then, 3 nm Au NPs (50 μL) were added and ultrasonicated for 1 hour to form Fe3 O 4 @PEI@Au-see MNPs. Finally, 10 mg Fe 3 O 4 @PEI@Au-see MNPs were dispersed in 100 mL of 0.25 mM silver nitrate aqueous solution containing 0.2 wt % PVP, and then excess 37% formaldehyde (150 μL) and 25% ammonia water (300 μL) were added in sequence. After ultrasonic treatment at 30 °C for 15 min, Fe 3 O 4 @Ag MNPs core-shell microspheres.

[0041] The Fe synthesized in this example was imaged using SEM. 3 O 4 MNPs and Fe 3 O 4 The morphology of @Ag MNPs was characterized, such as Figure 2 a, The present invention successfully synthesized magnetic nanoparticles Fe with uniform size 3 O 4 MNPs, Figure 2 b shows Fe 3 O 4 A single layer of uniformly dispersed gold and silver nanoparticles was successfully in situ reduced on the surface of @Ag MNPs. 3 O 4 @Ag MNP nanoparticle element mapping is used for characterization, such as Figure 2 c and 2d, Fe 3 O 4 Transmission electron micrograph of EDS elemental analysis of @Ag MNPs particles shows the element distribution. The Fe element is mainly located in the core (blue), while the gold signal is found in the Fe due to the absorption of gold seeds. 3 O 4 @Ag MNPs between Fe and Ag (red). Ag is mainly distributed in the Fe 3 O 4 @Ag MNPs outermost layer (green), thus confirming that the Fe 3 O 4 The surface of MNPs was successfully coated with a uniform Au / Ag shell. These results indicate that Fe 3 O 4 @Ag MNPs have been successfully synthesized.

[0042] Example 2

[0043] Preparation of Encoded Magnetic Nanoparticles Functionalized with Hairpin DNA HP1 Strand 3 O 4@Ag@DTBN-HP1MNPs, hairpin DNAHP2 chain-functionalized encoded silver-coated gold nanoparticles Au@Reporter@Ag-HP2NPs, and quantitative detection of circVAPA.

[0044] MBA was selected as the reporter to synthesize Au@MBA@Ag-HP2 NPs. On this basis, circVAPA standard was used as the target ssDNA, and the hairpin DNA HP1 sequence (SEQ ID NO.1) was NH2 (CH 2 ) 6 -GAAAATGATAAATTGGATTGCAGATCCAATGAAGGGGCCAATTTATCATTTT CATTGG, the hairpin DNA HP2 sequence (SEQ ID NO.2) is SH-(CH 2 ) 6 -ATTGCAGATCCAATGAAAATGATAAATTGGCCCCTTCATTGGATCTGCAATA GCATC, to explore the optimal time for enzyme-free isothermal cyclic amplification reaction (CHA).

[0045] Before the experiment, the hairpin DNA HP1 and HP2 chains were annealed at 95°C for 5 min and naturally cooled at room temperature to form hairpin structures, and then modified with Fe 3 O 4 @Ag@DTBN MNPs and Au@Reporter@Ag NPs. (1) 1 mg of Fe 3 O 4 @Ag MNPs were added with 100 μL of DTNB (1 mM) and then ultrasonicated for 1 hour and washed three times with PBST to prepare carboxylated Fe 3 O 4 @Ag@DTBN MNPs. Then, a solution containing 50 mM NHS and 200 mM EDC was added to activate the carboxyl groups for 30 min and washed three times. Finally, 0.1 mg Fe 3 O 4 The hairpin DNA HP1 solution (5 μL), PBS (1x) solution (10 μL), 0.02 M sodium chloride solution (10 μL) and 0.1 M sodium chloride solution (10 μL) were added to the @Ag@DTBN MNPs in sequence, and the shaking was performed at 220 rpm for 1 h. The magnetic nanoparticles were washed with 0.1 mM PBS solution to obtain the encoded magnetic nanoparticles Fe functionalized with the hairpin DNA HP1 chain. 3 O 4 @Ag@DTBN-HP1MNPs.Fe 3 O 4@Ag@DTBN-HP1 MNPs were incubated with HS-PEG (10 μM) for 0.5 h to block excess sites and reduce nonspecific adsorption. They were then placed at 4 °C for later use.

[0046] (2) Add 10 μL of 1 mM MBA to 10 mL of Au NPs (1.2 x 10 11 The mixture was stirred at room temperature for 2 h, then centrifuged at 9000 rpm for 10 min and resuspended in ultrapure water, followed by the addition of 100 μL 1% sodium citrate solution, 200 μL 0.1 M sodium hydroxide solution, 1 mL 1 mM silver nitrate solution and 1 mL 10 mM ascorbic acid solution, stirred at room temperature for 0.5 h, centrifuged at 8500 rpm for 8 min and resuspended in ultrapure water to obtain Au@MBA@Ag NPs. Finally, 10 μL of 10 μM hairpin DNA HP2 solution, PBS (1x) solution, 0.02 M sodium chloride solution and 0.1 M sodium chloride solution were added in sequence at intervals of 20 min, allowed to stand at 4 ° C for 12 h, centrifuged at 8000 rpm for 6 min and resuspended in 0.1 mM PBS to obtain Au@MBA@Ag-HP2 NPs, which were stored at 4 ° C for use.

[0047] (3) To explore the optimal temperature and time of CHA reaction. 5 μL of 1 nM circVAPA solution was mixed with 100 μL of Au@MBA@Ag-HP2 NPs, 0.1 mg of Fe 3 O 4 @Ag@DTBN-HP1 MNPs were mixed, incubated at 25-50 °C for 0.5-3.5 h, and after repeated washing with ultrapure water, the spectral information was collected with the help of a portable Raman spectrometer.

[0048] The experimental results are as follows Figure 3 As shown in the figure, with the increase of incubation temperature and incubation time, the captured Au@MBA@Ag-HP2 NPs increased and the corresponding Raman signal was enhanced. The best signal was obtained when the incubation temperature was 37°C and the incubation time was 2 h. Then the intensity decreased slightly. The reason for this was that some circRNAs were degraded.

[0049] (4) Magnetic nanoparticles Fe 3 O 4 @Ag@DTBN MNPs stability study. 3 O 4 @Ag@DTBN MNPs were dispersed in buffer solutions of different pH values, and spectral information was collected using a portable Raman spectrometer. Figure 4 As shown, magnetic nanoparticles Fe 3 O4 @Ag@DTBN MNPs at 1335cm -1 The spectrum at remains relatively stable.

[0050] Example 3

[0051] Establishment of standard working curve of circRNA

[0052] Based on Example 2, the concentration of circVAPA standard was changed, and the prepared Au@MBA@Ag-HP2 NPs and Fe 3 O 4 @Ag@DTBN-HP1 MNPs were used to establish the standard working curve of circVAPA.

[0053] 5 μL of 0-10 nM circVAPA standard solution was mixed with Au@MBA@Ag-HP2 NPs and then Fe 3 O 4 @Ag@DTBN-HP1 MNPs were mixed together and incubated at 37°C for 2 h. The corresponding curves were collected using a portable Raman spectrometer. The characteristic peak intensity of Au@MBA@Ag-HP2 NPs was compared with that of Fe 3 O 4 @Ag@DTBN-HP1 MNPs are located at 1335 cm -1 The standard working curve of circVAPA standard solution was established by comparing the characteristic peak intensity ratios.

[0054] like Figure 5 As shown in A, as the concentration of circVAPA standard solution increases, the characteristic peaks of Au@MBA@Ag-HP2NPs increase accordingly, while Fe 3 O 4 @Ag@DTBN-HP1 MNPs at 1335 cm -1 The characteristic peak as a calibration peak has a small intensity fluctuation. -1 After the characteristic peak intensity was normalized, the concentration of circVAPA standard solution was 1583 / I 1335 There is a good linear relationship between them, the curve is y = 0.09215x + 1.75716, R 2 =0.98452.

[0055] Example 4

[0056] Anti-interference experiment:

[0057] On the basis of Example 2, the type of the object to be tested was changed.

[0058] 5 μL of each standard solution of circVAPA, cMARCA5, miRNA-21, circSATB2, the mixed solution of these four samples and Au@MBA@Ag-HP2 NPs were added to the Fe 3 O 4 @Ag@DTBN-HP1MNPs were mixed together, incubated at 37°C for 2 h, and the corresponding curves were collected using a portable Raman spectrometer.

[0059] like Figure 6 As shown, a is the Raman spectra of different standard solutions collected, and b is the Raman spectra of different standard solutions at I 1583 / I 1335 The experimental results show that the Raman characteristic peak I 1583 cm -1 The intensity at the position is only present when the target circVAPA is present. Therefore, the sensor system designed in the present invention can achieve high specificity detection in complex biological samples.

[0060] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent transformations made using the contents of the present invention's specification and drawings, or directly or indirectly applied in related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A SERS magnetic nanobiosensor based on catalytic hairpin assembly technology, characterized in that: The invention comprises hairpin DNA HP1 chain functionalized coded magnetic nanoparticles Fe3O4@Ag@DTBN-HP1 MNPs and hairpin DNA HP2 chain functionalized coded silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs. The preparation method of the hairpin DNA HP1 chain functionalized coded magnetic nanoparticles Fe3O4@Ag@DTBN-HP1 MNPs is as follows: (1) Fe3O4MNPs were dispersed in PEI solution and ultrasonicated to synthesize Fe3O4@PEI MNPs through PEI self-assembly process, and then Au NPs were added and ultrasonicated to form Fe3O4@PEI@Au-see MNPs. Fe3O4@PEI@Au-see MNPs were dispersed in 0.25 mM silver nitrate aqueous solution containing 0.2 wt % PVP, and then excess 37% formaldehyde and 25% ammonia were added in sequence and ultrasonicated to obtain Fe3O4@Ag MNPs. (2) Fe3O4@Ag MNPs were added to DTNB, and washed with PBST after sonication to prepare carboxylated Fe3O4@Ag@DTBN MNPs. A solution containing NHS and EDC was then added to activate the carboxyl group for 30-40 min. After washing, 10 μM hairpin DNA HP1 () solution, PBS (1x) solution, 0.02 M sodium chloride solution and 0.1 M sodium chloride solution were added in sequence. The shaker was rotated at 220-230 rpm for 1-1.5 h. The magnetic nanoparticles were washed with PBS solution to obtain hairpin DNA HP1 chain functionalized encoded magnetic nanoparticles Fe3O4@Ag@DTBN-HP1 MNPs, which were placed at 4°C for use. The preparation method of the hairpin DNA HP2 chain functionalized encoded silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs is as follows: a Raman labeling molecule is added to the Au NPs solution and stirred at room temperature for 2-2.5 h, centrifuged and resuspended with ultrapure water, then 1% sodium citrate solution, 0.1 M sodium hydroxide solution, 1 mM silver nitrate solution and 10 mM ascorbic acid solution are added in sequence, stirred for reaction at room temperature, centrifuged and resuspended with ultrapure water to obtain Au@Reporter@Ag NPs, and then 10 μM hairpin DNA HP2 solution, PBS solution, 0.02 M sodium chloride solution and 0.1 M sodium chloride solution are added in sequence at intervals of 20 min, and the solution is allowed to stand at room temperature for 12-14 h, centrifuged and resuspended with 0.1 mM PBS to obtain Au@Reporter@Ag-HP2 NPs, which are stored at 4°C for use.

2. The SERS magnetic nanobiosensor based on catalytic hairpin assembly technology as claimed in claim 1, characterized in that: The hairpin DNA HP1 strand and the hairpin DNA HP2 strand were designed according to the circRNA anti-splicing site sequence.

3. The SERS magnetic nanobiosensor based on catalytic hairpin assembly technology according to claim 1, characterized in that: The preparation method of the Fe3O4MNPs is as follows: 1.35 g of ferric chloride is weighed, added to 20 mL of ethylene glycol, and dissolved by magnetic stirring at a speed of 1500 rpm for 10 min, then 3.6 g of sodium acetate is added to the above solution, heated at 60 °C and stirred for 30 min, the resulting solution is transferred to a high-pressure reactor in a drying oven, placed at 200 °C for 10 h, the black precipitate is washed with anhydrous ethanol and deionized water, and then magnetically separated and dried to obtain Fe3O4MNPs.

4. The SERS magnetic nanobiosensor based on catalytic hairpin assembly technology as claimed in claim 1, characterized in that: During the preparation of encoded magnetic nanoparticles Fe3O4@Ag@DTBN-HP1 MNPs functionalized with hairpin DNA HP1 chains, the dosage ratio of Fe3O4@Ag@DTBN MNPs to hairpin DNA HP1 solution, PBS (1x) solution, 0.02 M sodium chloride solution, and 0.1 M sodium chloride solution was 0.1 mg: 5 μL: 10 μL: 10 μL: 10 μL.

5. The SERS magnetic nanobiosensor based on catalytic hairpin assembly technology as claimed in claim 1, characterized in that: During the preparation of hairpin DNA HP2 chain-functionalized encoded silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs, the volume ratios of Au NPs solution to 1% sodium citrate solution, 0.1 M sodium hydroxide solution, 1 mM silver nitrate solution, and 10 mM ascorbic acid solution were 100: 1, 50: 1, 10: 1, and 10: 1, respectively; the volume ratios of Au NPs solution to 10 μM hairpin DNAHP2 solution, PBS solution, 0.02 M sodium chloride solution, and 0.1 M sodium chloride solution were all 100:

1.

6. The SERS magnetic nanobiosensor based on catalytic hairpin assembly technology as claimed in claim 1, characterized in that: The Raman labeling molecule is 4-mercaptobenzoic acid, 2-mercapto-4-methyl-5-thiazoleacetic acid, 4-mercaptophenylboric acid or 2,3,5,6-tetrafluoro-4-mercaptobenzoic acid.

7. The SERS magnetic nanobiosensor based on catalytic hairpin assembly technology as claimed in claim 1, characterized in that: The hairpin DNA HP1 chain was annealed at 95 °C for 5 min and cooled naturally at room temperature before being modified on the Fe3O4@Ag@DTBN MNPs surface. The hairpin DNA HP2 chain was annealed at 95 °C for 5 min and cooled naturally at room temperature before being encoded on the Au@Reporter@Ag NPs surface.

8. The SERS magnetic nanobiosensor based on catalytic hairpin assembly technology as claimed in claim 1, characterized in that: Fe3O4@Ag@DTBN MNPsFe3O4@Ag@DTBN-HP1 MNPs were incubated with HS-PEG (10 μM) for 0.5 h to block the redundant sites and reduce nonspecific adsorption.

9. Use of a SERS magnetic nanobiosensor assisted by catalytic hairpin assembly technology in circRNA detection according to any one of claims 1 to 8.

10. The use according to claim 9, characterized in that: The following steps are involved: S1: Standard solutions of different concentrations (0-10 nM), encoded magnetic nanoparticles Fe3O4@Ag@DTBN-HP1 MNPs functionalized with hairpin DNA HP1 chains, and encoded silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs functionalized with hairpin DNA HP2 chains were mixed and incubated at 37 °C for 0.5-3.5 h. After repeated washing with ultrapure water, the spectral information was collected by a portable Raman spectrometer. The Raman intensity of the characteristic peak of the Raman labeling molecule was compared with the peak of the Fe3O4@Ag@DTBN-HP1 MNPs at 1335 cm -1 The standard working curve is constructed by the intensity ratio of the Raman characteristic peaks; S2: Mix the sample to be tested, encoded magnetic nanoparticles Fe3O4@Ag@DTBN-HP1 MNPs functionalized with hairpin DNA HP1 chain, and encoded silver-coated gold nanoparticles Au@Reporter@Ag-HP2 NPs functionalized with hairpin DNA HP2 chain, incubate at 37°C for 0.5 to 3.5 h, collect the Raman intensity ratio of the characteristic peak of the sample to be tested and the Raman characteristic peak intensity of Fe3O4@Ag@DTBN-HP1 MNPs at 1335 cm-1, and calculate the corresponding concentration of the sample to be tested according to the standard working curve.