CTnI protein detection kit and detection method based on aptamer coupled hybridization chain reaction
Through the cTnI protein detection kit based on nucleic acid aptamer-coupled hybrid chain reaction, the problems of insufficient sensitivity and low specificity of traditional protein detection methods are solved, and high sensitivity and specificity detection of cTnI protein is achieved, with the advantages of anti-interference ability and simplicity of operation.
Patent Information
- Application Number
- CN202510109382.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-23
- Publication Date
- 2025-06-06
AI Technical Summary
Traditional protein marker detection methods have problems such as insufficient sensitivity, low specificity, complex operation, long time and high cost, which are difficult to meet the needs of early diagnosis of acute myocardial infarction.
The cTnI protein detection kit based on nucleic acid aptamer coupled hybrid chain reaction is used to specifically bind to cTnI protein, and signal amplification is achieved through hybrid chain reaction technology to improve the sensitivity and specificity of the detection.
It realizes high sensitivity and specificity detection of cTnI protein concentration in the blood, overcomes the limitations of traditional methods, has anti-interference ability, is easy to operate, and is cost-effective.
Smart Images

Figure CN120102897A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and relates to a new detection technology for cTnI concentration in blood, in particular to a cTnI protein detection kit based on aptamer-coupled hybridization chain reaction. Background Art
[0002] Acute myocardial infarction (AMI) is a serious heart disease with high mortality and poor prognosis, which seriously affects the life and health of patients. Early diagnosis and treatment of acute myocardial infarction are crucial to reduce myocardial damage, reduce mortality, prevent malignant consequences such as disability and death to the greatest extent, and improve the prognosis of cardiovascular patients. At present, the main indicators for the detection and diagnosis of acute myocardial infarction include myoglobin (MYO), creatine kinase-MB (CK-MB), lactate dehydrogenase (LDH), and cardiac troponin (cTn). Cardiac troponin mainly includes cTnI protein, cTnT protein and cTnC protein. Among them, cTnI protein is a protein in myocardial tissue. Its expression level will increase significantly after myocardial infarction. The main reason is that myocardial infarction causes damage to myocardial cells and releases intracellular troponin into the blood. When myocardial tissue is affected by ischemia and hypoxia, myocardial cells will also be damaged and release cTnI protein. Therefore, by monitoring the level of cTnI protein marker in the blood, the occurrence of myocardial infarction can be detected in time, and the severity of myocardial infarction can be assessed based on its level. Therefore, as an important myocardial marker, it is particularly important to develop a protein marker detection method with high sensitivity and specificity for cTnI protein.
[0003] Traditional protein marker detection methods mainly include enzyme-linked immunosorbent assay (ELISA), Western blot, and mass spectrometry using mass spectrometers to determine the quality and structural information of proteins. These methods still have their own problems in practical applications. The ELISA method requires a long experimental time, is easily affected by interfering substances, and some proteins may not be detected by the ELISA method. The operation of Western blot is very complicated and time-consuming. Because it involves multiple steps, the entire process of Western blot usually takes several hours or even a whole day. In addition, the operation of Western blot requires high technical requirements, and the experimental results are easily affected by the operating technology and experimental conditions. In order to ensure the accuracy and specificity of the results, high-quality specific antibodies need to be used, and specific antibodies are not easy to obtain. The instrument purchase and maintenance costs of mass spectrometry are very high, and some laboratories and medical institutions find it difficult to bear the high costs. In addition, when the sample complexity is high, the sensitivity of the mass spectrometry method may be affected. Based on the shortcomings of these traditional protein detection methods, it is particularly important to develop new highly sensitive and highly specific protein detection methods.
[0004] Aptamer is an oligonucleotide sequence, which is usually obtained through in vitro screening technology (such as SELEX) and has the ability to bind to specific molecules with high specificity. Aptamers can be used for protein detection and analysis by binding to target proteins to form specific complexes. There are many advantages in using aptamers for protein detection. First, aptamers can recognize target proteins with high specificity, thereby achieving selective capture of target proteins in complex biological samples, improving the specificity and accuracy of detection. Secondly, these aptamers usually have high affinity and can effectively bind to target proteins, making the detection method more sensitive. In addition, aptamers have better stability than other recognition molecules such as antibodies, and can maintain their structural and functional integrity under different conditions, so they are more reliable in laboratory and clinical applications. Finally, by engineering aptamers, their specificity and affinity can be adjusted, and even additional functions can be given to them to meet different protein detection needs. As a tool for protein detection, aptamers have the advantages of high specificity, high affinity, stability and engineering plasticity, providing important technical support for protein research and biomedical diagnosis. For example, nucleic acid aptamers can be used in combination with catalytic hairpin assembly technology, gene editing technology, DNAzyme, etc.
[0005] Antibodies, also known as immunoglobulins, are protein molecules produced by the immune system and are usually used to identify and neutralize pathogens or foreign substances. They play a key role in the immune system and can recognize and bind to specific sites on the surface of pathogens to assist the immune system in identifying and eliminating these pathogens. The high specificity of antibodies makes them an ideal tool for detecting protein markers. By using specific antibodies, the presence and level changes of specific protein markers can be accurately identified and detected. At present, researchers have applied antibodies in combination with a variety of technologies to the detection of protein markers. In traditional cTnI protein detection, the commonly used antibody detection methods have several limitations. Especially when the concentration of cTnI in the blood circulation is low, these methods may lead to misdiagnosis or missed diagnosis due to insufficient sensitivity. In addition, a variety of interfering substances in the blood may also affect the accuracy of the test results. The stability of antibodies is easily affected by storage conditions. Improper temperature control, long-term storage, and repeated freezing and thawing of samples may reduce antibody activity, thereby affecting the reliability of the test results. Summary of the invention
[0006] In order to overcome the inherent defects of traditional protein detection methods, the present invention provides a cTnI protein detection kit and detection method based on aptamer-coupled hybridization chain reaction. The kit of the present invention is used to detect the concentration of cTnI protein in blood samples. The kit utilizes the ability of nucleic acid aptamers to specifically bind to target antigen proteins, and through the design of nucleic acid aptamers and the introduction of hybridization chain reaction, a highly specific detection system is constructed, which can specifically detect cTnI protein in a multi-protein environment, and exhibits a strong anti-interference ability for biological matrix samples, thereby providing a new technology for cTnI protein detection with high sensitivity and high specificity.
[0007] The technical solution adopted by the present invention is as follows:
[0008] 1. cTnI protein detection kit based on aptamer-coupled hybridization chain reaction
[0009] The cTnI protein detection kit is mainly composed of specific antibodies, nucleic acid aptamers, nucleic acid probes, SA-HRP reaction solution, luminol and hydrogen peroxide.
[0010] The specific antibody is Y302 antibody, and the Y302 antibody has high affinity to cTnI protein.
[0011] The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1, specifically: CCAATGCAGTGGGGAGGGACTGCGTTGGAGTTATTGAGTGTTCGATTCGG CGTG-biotin.
[0012] The nucleic acid probe includes probe H1-B and probe H2; the nucleotide sequence of the probe H1-B is shown in SEQ ID NO.2, specifically:
[0013] biotin-AGTGTTCGATTCGGCGTGGGTTAACACGCCGAATCGAACACTC AATAAC;
[0014] The nucleotide sequence of the probe H2 is shown in SEQ ID NO.3, specifically:
[0015] TTAACCCACGCCGAATCGAACACTGTTATTGAGTGTTCGATTCGGCG TG.
[0016] The cTnI protein detection kit also includes an ELISA plate, an antigen standard, a blocking solution, a diluent and a washing solution.
[0017] The antigen standard is a commercial cTnI protein solution with gradient concentrations.
[0018] The blocking solution is a phosphate buffer containing 10 wt% bovine serum albumin; the diluent is a phosphate buffer; and the washing solution is a phosphate buffer containing 0.5 wt% Tween 20.
[0019] 2. Application of cTnI protein detection kit
[0020] The cTnI protein detection kit is used to detect the cTnI protein concentration in blood.
[0021] 3. Detection method using cTnI protein detection kit
[0022] The detection method comprises the following steps:
[0023] S1. Add 30 nmol / L specific antibody solution to the ELISA plate. The amount of specific antibody solution added is 100 μL / well. Combine on a shaker for 1 to 3 hours. After the reaction is completed, discard the liquid in the well and wash with washing solution for 2 to 3 times.
[0024] S2, add blocking solution, the amount of blocking solution added is 150 μL / well, block on a shaker for 0.5-1.5 hours, discard the liquid in the well, and wash with washing solution 2-3 times;
[0025] S3, add diluent to at least one well of the ELISA plate as a blank group, and add the sample to be tested to at least one well other than the blank group, the amount of diluent and the sample to be tested is 100 μL / well, shake on a shaker for 0.5-1.5 hours, discard the liquid in the well, and wash with washing solution 2-3 times;
[0026] S4, adding 400 nmol / L aptamer solution, the amount of aptamer solution added is 100 μL / well, combining on a shaker for 0.5-1.5 h, after the reaction is completed, washing with washing solution for 2-3 times;
[0027] S5. Add nucleic acid probe solution at a rate of 100 μL / well, combine on a shaker for 0.5 to 1.5 hours, discard the liquid in the wells, and wash with washing solution for 2 to 3 times;
[0028] In the nucleic acid probe solution, the concentrations of probe H1-B and probe H2 are both 50 nmol / L;
[0029] S6, add 62.5U / L SA-HRP reaction solution, the amount of SA-HRP reaction solution added is 100μL / well, combine on a shaker for 0.5-1.5h, discard the liquid in the well, and wash 2-3 times with washing solution;
[0030] S7, adding luminol solution, the amount of luminol solution added is 50 μL / well; placing the ELISA plate in an ELISA instrument and setting the detection program, adding hydrogen peroxide solution before the detection, the amount of hydrogen peroxide solution added is 50 μL / well;
[0031] S8. Obtain the pure chemiluminescence value of the sample to be detected and the pure chemiluminescence value of the blank group through chemiluminescence detection, calculate the difference between the pure chemiluminescence value of the sample to be detected and the pure chemiluminescence value of the blank group to obtain the chemiluminescence difference, substitute the chemiluminescence difference into the pre-drawn standard curve to obtain the cTnI protein concentration in the sample to be detected.
[0032] The pre-drawn standard curve is a linear relationship curve between the chemiluminescence difference and the cTnI protein concentration. The pre-drawn standard curve is established based on the chemiluminescence signal difference obtained by detecting multiple cTnI protein standards of different concentrations in this kit and the corresponding cTnI protein concentration.
[0033] This study adopted an innovative detection strategy, namely the use of aptamer-coupled hybridization chain reaction (HCR) technology. This method not only reduces the detection cost, but also has more relaxed requirements on the storage conditions of the kit due to the high stability of the aptamer.
[0034] Specifically, aptamers, as single-stranded oligonucleotides with high affinity and specificity, can remain stable over a wide temperature range, reducing the risk of activity loss due to improper storage. In addition, the synthetic nature of aptamers ensures their batch-to-batch consistency, thereby improving the repeatability and reliability of test results. By combining aptamers with HCR technology, this study aims to develop a more accurate, economical, and easy-to-store cTnI protein detection method.
[0035] The beneficial effects of the present invention are as follows:
[0036] 1. The kit of the present invention is based on the ability of nucleic acid aptamers to specifically bind to cTnI protein. By introducing hybridization chain reaction into the design of nucleic acid aptamers, this amplification technology without enzyme participation is convenient and effective, and can improve the sensitivity of detection. The detection range of cTnI protein concentration of the kit of the present invention is 2.9ng / mL to 580ng / mL, which is higher than the lower limit of 10ng / ml of radioimmunoassay established by Cummins.
[0037] 2. The detection system of the present invention has high specificity, can specifically detect cTnI in a multi-protein environment, and exhibits strong anti-interference ability for biological matrix samples. Therefore, the present invention can be used to detect the concentration of cTnI protein in plasma samples.
[0038] 3. The detection method of the present invention not only overcomes its limitations, but also has the advantages of high sensitivity, strong specificity, simple operation, rapid response, strong anti-interference ability, cost-effectiveness and reliable results. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 It is a schematic diagram of the principle of the present invention;
[0040] Figure 2 It is a schematic diagram of feasibility proof of hybridization chain reaction in the present invention;
[0041] Figure 3 It is a selective schematic diagram of the cTnI protein detection method based on aptamer-coupled hybridization chain reaction in the present invention;
[0042] Figure 4 It is the standard curve of the cTnI protein detection method based on aptamer-coupled hybridization chain reaction in the present invention. DETAILED DESCRIPTION
[0043] The present invention is further described below with reference to the accompanying drawings in detail. However, these embodiments are only intended to illustrate the present invention and do not limit the scope of the present invention.
[0044] like Figure 1As shown, the cTnI protein detection kit of the present invention realizes quantitative detection of cTnI protein in biological samples based on aptamer-specific recognition of target antigen and coupled hybridization chain reaction, and selects cTnI protein as the detection object. The kit of the present invention firstly uses the high affinity of the specific antibody on the ELISA plate to the cTnI protein to capture the cTnI protein on the ELISA plate, and then triggers the nucleic acid signal amplification reaction through the affinity of the 5' end of the nucleic acid aptamer with the cTnI protein and the 3' end of the nucleic acid aptamer to trigger the hybridization chain reaction function, thereby realizing high-sensitivity and high-specificity detection of the cTnI protein.
[0045] The principle of the aptamer-coupled hybridization chain reaction in the present invention is as follows:
[0046] Step 1: In the presence of cTnI protein, the specific antibody fixed on the 96-well ELISA plate can specifically recognize cTnI protein;
[0047] Step 2: When the nucleic acid aptamer CT 28-tri is added, the aptamer part (i.e., the 5' end of the nucleic acid aptamer) can non-covalently bind to the antigen cTnI protein to be tested, so that the aptamer can specifically recognize and bind to the specific epitope of the cTnI protein;
[0048] Step 3: The 3' end of the aptamer can trigger the hybridization chain reaction (HCR), so that the hairpin structures of probes H1-B and H2 are opened successively, and finally a long double-stranded DNA chain with multiple repeating structures can be obtained. Since H1-B carries a biotin tag, after the hybridization chain reaction, multiple biotin tags can be connected to one antigen, thus completing the signal amplification process;
[0049] Step 4: Finally, by adding streptavidin-labeled horseradish peroxidase, i.e., SA-HRP (Streptavidin-Horseradish Peroxidase) reaction solution, the horseradish peroxidase is fixed to the ELISA plate through the combination of biotin and streptavidin, and the amount of fixed horseradish peroxidase is positively correlated with the amount of antigen (cTnI protein);
[0050] Step 5: Horseradish peroxidase can catalyze the chemiluminescent substrate luminol and hydrogen peroxide to produce chemiluminescent signals, and quantitative detection can be completed using an enzyme reader.
[0051] The kit provided by the present invention comprises an ELISA plate, a specific antibody, a nucleic acid aptamer, a nucleic acid probe, an antigen standard, a blocking solution, a diluent and a washing solution, a SA-HRP reaction solution, luminol and hydrogen peroxide.
[0052] Wherein, the ELISA plate is preferably a 96-well ELISA plate.
[0053] Among them, the specific antibody is the Y302 antibody which has a high affinity to the cTnI protein.
[0054] The nucleic acid aptamer is CT 28-tri. The secondary structure of CT 28-tri is as follows: Figure 1 As shown in (B), the 3' end of CT 28-tri is modified with biotin, and the nucleotide sequence of CT 28-tri is shown in SEQ ID NO.1, specifically:
[0055] CCAATGCAGTGGGGAGGGACTGCGTTGGAGTTATTGAGTGTTCGATT CGGCGTG-biotin.
[0056] The 5' end of the aptamer can non-covalently bind to the cTnI protein, and the 3' end of the aptamer can trigger a hybridization chain reaction.
[0057] The nucleic acid probe contains two hybridization chain reaction substrates, which refer to nucleic acid fragments involved in the hybridization chain reaction. The two hybridization chain reaction substrates are probe H1-B and probe H2. The hybridization chain reaction can amplify the nucleic acid signal based on the recognition of cTnI protein by the nucleic acid aptamer, thereby improving the sensitivity of the detection.
[0058] The 5' end of the probe H1-B is modified with biotin, and the nucleotide sequence of the probe H1-B is shown in SEQ ID NO.2, specifically:
[0059] biotin-AGTGTTCGATTCGGCGTGGGTTAACACGCCGAATCGAACACTC AATAAC;
[0060] The nucleotide sequence of probe H2 is shown in SEQ ID NO.3, specifically:
[0061] TTAACCCACGCCGAATCGAACACTGTTATTGAGTGTTCGATTCGGCG TG.
[0062] The antigen standard is a commercial cTnI protein standard solution with gradient concentrations, which is used to establish the standard curve of this kit.
[0063] The blocking solution is phosphate buffered solution (PBS) containing 10 wt % bovine serum albumin (BSA).
[0064] The diluent is a phosphate buffer solution, which is used to dilute the sample solution or as a blank group.
[0065] The washing solution is phosphate buffered saline with Tween-20 (PBST) containing 0.5 wt % Tween-20.
[0066] The SA-HRP reaction solution is a streptavidin-horseradish peroxidase solution, and luminol and hydrogen peroxide are reaction substrates of the SA-HRP reaction solution, which are used for further amplification of the signal. In a specific implementation, luminol and hydrogen peroxide can be obtained by commercial means, and the amounts of the two can refer to the product manual, as long as the chemiluminescent substrates luminol and hydrogen peroxide are in excess in the system.
[0067] Among them, nucleic acid probes, nucleic acid aptamers, blocking solutions, specific antibodies and antigen standards need to be stored in a -20°C refrigerator. SA-HRP reaction solution, luminol and hydrogen peroxide need to be stored in a 4°C refrigerator. Luminol needs to be stored away from light, and the ELISA plate, diluent and washing solution can be kept at room temperature.
[0068] The kit of the present invention is used for quantitative detection of cTnI protein. Each sample detection is accompanied by a standard curve. The concentration of cTnI protein in the sample is calculated by substituting the difference of the chemiluminescent signal of the detection sample and the blank group into the standard curve.
[0069] In the examples of the present invention, all DNA sequences were synthesized by Shanghai Shenggong Bioengineering Co., Ltd. The specific examples of the present invention are as follows:
[0070] Example 1
[0071] In this embodiment, probe H1-B solution, probe H2 solution and nucleic acid aptamer solution ( Figure 2 The feasibility of the hybridization chain reaction was verified by agarose gel electrophoresis using agarose gel electrophoresis.
[0072] The specific steps are as follows:
[0073] First, weigh 0.5 g of agarose powder and place it in a conical flask, add 25 mL of 1×TAE buffer solution (Tris-Acetate-EDTA Buffer), place the conical flask in a microwave oven and heat until the solution is slightly boiling, take it out and shake it until the agarose powder is completely dissolved.
[0074] Next, 2.5 μL of 10000× SuperRed nucleic acid dye was added thereto, and the mixture was gently shaken to obtain a clear agarose gel solution having a mass fraction of 2% agarose.
[0075] Next, slowly pour the agarose gel solution into the gel tank, insert the comb, and let it stand for 30 minutes until the gel solution is completely cooled and solidified. Add an appropriate amount of 10× DNA loading buffer (DNA Loading Buffer) to the prepared sample according to the volume ratio, and take 10μL of each sample and add it to the corresponding channel.
[0076] Next, turn on the power supply, set the electrophoresis voltage to 170V, and turn off the power supply when the indicator band reaches two-thirds of the gel. Place the gel in a gel imaging system for exposure and imaging.
[0077] The results are as follows Figure 2 As shown, "n" represents trigger (trigger chain of HCR). CT28 sequence (from 5 end to 3 end): CCAATGCAGTGGGGAGGGACTGCGTTGGCT. CT 28-trigger sequence (from 5 end to 3 end) CCAATGCAGTGGGGAGGGACTGCGTTGGAGTTATTGAGTGTTCGATTCGG CGTG. Therefore, the sequence of trgger is (from 5 end to 3 end): AGTTATTGAGTGTTCGATTCGGCGTG). The two hairpin structures of trigger probe H1-B and probe H2 open each other to form a long DNA double-stranded structure, which is mainly composed of a trigger, n probes H1-B and probe H2. Lane 1 is the band of probe H1-B, lane 2 is the band of probe H2, lane 3 is the band of nucleic acid aptamer CT 28-tri, lane 4 is the band of probe H1-B and probe H2 added simultaneously, and lane 5 is the band of probe H1-B, probe H2 and nucleic acid aptamer CT 28-tri added simultaneously.
[0078] Depend on Figure 2It can be seen that when lane 4 is compared with lanes 1 and 2, no new bands appear when the two hybridization chain reaction substrates are mixed, indicating that H1-B and H2 can also exist stably in the nucleic acid probe and will not trigger each other to open. When lane 5 is compared with lane 4, after adding the nucleic acid aptamer CT 28-tri, the bands of probes H1-B and H2 are significantly reduced, and multiple new bands with a certain base difference appear in the lane. The new band is the product after CT 28-tri triggers. Since the number of DNA substrates involved in the hybridization chain reaction amplification is uncertain, the number of bases in the product band is uncertain. Since the difference between products of different lengths comes from the integer multiples of H1-B and H2, the interval between different product bands is a fixed value.
[0079] Example 2
[0080] This kit can be used to detect the concentration of cTnI protein in plasma. The specific steps are as follows:
[0081] S1. In a 96-well ELISA plate, add 100 μL of specific antibody solution to each well. The concentration of the specific antibody solution is 30 nmol / L. Combine for 2 hours on a shaker (37°C, 100 rpm). After the reaction is completed, discard the liquid in the well and wash 3 times with 200 μL / well of washing solution.
[0082] In this embodiment, the specific antibody solution uses Y302 antibody purchased from Hi-Tide Biotechnology Co., Ltd. (Finland) with the product number RC4T21-Y302.
[0083] S2, add 150 μL / well of blocking solution, block on a shaker (37°C, 100 rpm) for 1 h, discard the liquid in the well, and wash three times with 200 μL / well of washing solution;
[0084] S3, add 100 μL / well of diluent as the blank group, add the sample to be tested as the test group, the amount of the sample to be tested is 100 μL per well, combine on a shaker (37°C, 100 rpm) for 1 hour, discard the liquid in the well, and wash 3 times with 200 μL / well of washing solution;
[0085] S4, add aptamer solution, the amount of aptamer solution added is 100 μL per well, the concentration is 400 nmol / L, and combine on a shaker (37°C, 100 rpm) for 1 hour. After the reaction is completed, wash with 200 μL / well of washing solution for 3 times;
[0086] S5. Add 100 μL of nucleic acid probe mixture to each well. The final concentration of the two nucleic acid probes in the nucleic acid probe mixture is 50 nmol / L. Combine on a shaker (37°C, 100 rpm) for 1 hour. Discard the liquid in the well and wash three times with 200 μL / well of washing solution.
[0087] S6. Add 100 μL of SA-HRP reaction solution (62.5 U / L) to each well, incubate on a shaker (37°C, 100 rpm) for 1 h, discard the liquid in the well, and wash three times with 200 μL of washing solution.
[0088] S7. Add 50 μL of chemiluminescent substrate luminol solution to each well, place it in the microplate reader and set the detection program, then inject 50 μL of chemiluminescent substrate hydrogen peroxide solution into the well for chemiluminescence detection to obtain the pure chemiluminescence value of the sample to be detected, and then subtract the pure chemiluminescence value of the blank group to obtain the chemiluminescence difference. Substitute the chemiluminescence difference into the standard curve of chemiluminescence and cTnI protein concentration to obtain the cTnI protein concentration in the sample to be detected.
[0089] In this embodiment, luminol solution and hydrogen peroxide solution were purchased from Merck Millipore with the product number of BIO-000001.
[0090] The standard curve is established by using the difference of chemiluminescent signals obtained by detecting different concentrations of cTnI protein standards in this kit and the corresponding cTnI protein concentration. The standard curve is used as the standard for quantitative detection of cTnI protein concentration in the sample to be detected.
[0091] Example 3
[0092] a. Optimization of testing conditions
[0093] The key experimental condition parameters were optimized, including the concentration of specific antibody (optimization range: 5nmol / L~80nmol / L), CT 28-tri concentration (optimization range: 50nmol / L~600nmol / L), hybridization chain reaction probe concentration (optimization range: 50nmol / L~400nmol / L), and SA-HRP concentration (optimization range: 1000-fold dilution to 10000-fold dilution). According to the signal-to-noise ratio, the best actual concentration and reaction conditions were selected: the concentration of specific antibody was 30nmol / L, the concentration of CT 28-tri was 400nmol / L, the concentration of hybridization chain reaction probe was 50nmol / L, and the concentration of SA-HRP was diluted 8000 times.
[0094] b. Detection of cTnI protein content in samples
[0095] The cTnI antigen was prepared into a concentration gradient standard (2.9 ng / mL-580 ng / mL), and the kit was used to detect the cTnI protein based on the aptamer-coupled hybridization chain reaction. The logarithm of the cTnI antigen concentration was used as the X-axis, and the measured chemiluminescence signal difference was used as the Y-axis to draw a standard curve for the cTnI antigen concentration detection.
[0096] c. cTnI protein content detection system and conditions
[0097] cTnI protein content detection system
[0098] The concentration of specific antibody was 30 nmol / L, the concentration of nucleic acid aptamer CT 28-tri was 400 nmol / L, the concentration of hybridization chain reaction probe was 50 nmol / L, the SA-HRP reaction solution was diluted 8000 times with diluent, and the concentration after dilution was 62.5 U / L. Luminol solution and hydrogen peroxide solution were purchased from Merck Millipore with the catalog number BIO-000001.
[0099] cTnI protein content detection conditions
[0100] Add 100 μL of specific antibody solution to each well of a 96-well ELISA plate and combine on a shaker (37°C, 100 rpm) for 2 h. After the reaction, wash three times with 200 μL of washing solution, add 150 μL of blocking solution and block on a shaker (37°C, 100 rpm) for 1 h, and then wash three times with 200 μL of washing solution after blocking.
[0101] The cTnI antigen was diluted with diluent to a series of concentration gradients (2.9ng / mL-580ng / mL), and 100μL was added to each well, and the cells were combined on a shaker (37°C, 100rpm) for 1h. After the combination, the cells were washed 3 times with 200μL of washing solution, and 100μL of nucleic acid aptamer solution was added to each well, and the cells were combined on a shaker (37°C, 100rpm) for 1h. After the reaction, the cells were washed 3 times with 200μL of washing solution. The hybridization chain reaction probe H1-B and probe H2 were mixed in equal volumes (the final concentrations of probe H1-B and probe H2 in the mixed solution were both 50nmol / L after mixing), 100μL of the mixed solution was added to each well, and the cells were combined on a shaker (37°C, 100rpm) for 1h. After the combination, the cells were washed 3 times with 200μL of washing solution.
[0102] Add 100 μL of SA-HRP reaction solution to each well and combine on a shaker (37°C, 100 rpm) for 1 hour. Wash three times with 200 μL of washing solution, add 50 μL of chemiluminescent substrate luminol to each well, place in a microplate reader and set the detection program, then inject 50 μL of chemiluminescent substrate hydrogen peroxide into the well for chemiluminescent detection.
[0103] d. Selective testing
[0104] The kit of the present invention is used to detect the concentration of cTnI protein in a blood sample. Since the blood sample contains a variety of macromolecular proteins, in this embodiment, the selectivity of the kit of the present invention is tested by adding PD-L1 protein, IFN-α protein, RBD protein, cTnI protein and a combination of the four proteins to the detection system of the kit. The results are as follows: Figure 3 shown.
[0105] Depend on Figure 3 It can be seen that the relative chemiluminescence values of the target cTnI protein and the Mixer group containing cTnI protein are significantly higher than those of other proteins, and when multiple components exist at the same time, the cTnI protein can still be detected with high specificity, indicating that the detection method of the present invention can effectively distinguish cTnI protein from other proteins and has high selectivity.
[0106] e. Establishment of standard curve
[0107] The logarithmic value of cTnI protein concentration is used as the X-axis, and the measured chemiluminescence signal difference is used as the Y-axis to draw the standard curve of cTnI antigen concentration detection. Figure 4 As shown in the figure, the cTnI protein concentration standard curve has good linearity in the range of 2.9 ng / mL-580 ng / mL, and R 2 =0.9869. The established cTnI protein detection method based on aptamer-coupled hybridization chain reaction achieved quantitative detection of the target cTnI protein by measuring the chemiluminescence signal value.
[0108] f. Precision and accuracy inspection
[0109] The concentration of the target cTnI protein was set to 1 nmol / L (low concentration), 5 nmol / L (medium concentration), and 10 nmol / L (high concentration), and the chemiluminescent signal values of different concentrations of cTnI protein were measured, and each concentration was tested in triplicate. The accuracy was calculated according to the formula (measured value / true value) × 100%, and the precision was expressed as relative standard deviation.
[0110] The experimental results showed that the precision of cTnI protein at low, medium and high concentrations were 3.17%, 1.12% and 1.03% respectively, and the accuracy were 99.3%, 102.1% and 96.9% respectively. The results showed that the cTnI protein detection method based on aptamer-coupled hybridization chain reaction has good precision and accuracy.
[0111] g. cTnI protein real sample addition and recovery detection
[0112] In order to investigate the anti-interference ability of the established aptamer-coupled hybridization chain reaction method in actual biological samples, the antigens were divided into three concentrations: low, medium and high, namely 1 nmol / L, 5 nmol / L and 10 nmol / L, and added to 5% blank plasma to perform recovery experiments on simulated biological samples.
[0113] The recovery rate is calculated by the actual measured value of the sample / the true value, and the result is expressed as a percentage. The recovery data of the actual sample addition is shown in the following table:
[0114]
[0115] The “signal value” in the above table refers to the chemiluminescent signal value measured by the microplate reader, usually expressed in relative light units (RLU).
[0116] As can be seen from the above table, the method of the present invention can successfully quantitatively determine the concentration of cTnI protein in 5% plasma. The relative standard deviation is 0.4% to 5.28%, and the recovery rate is 93.4% to 107.2%. Therefore, it can be concluded that the aptamer-coupled hybridization chain reaction established by the present invention has good resistance to biological matrix interference and can be applied to the detection of actual samples.
[0117] The antibody amino acid sequence and nucleic acid sequence involved in the present invention are:
[0118] SEQ ID NO.1:
[0119] Name: Nucleotide sequence of nucleic acid aptamer
[0120] Sequence type: DNA (other DNA)
[0121] Organism source: synthetic construct
[0122] CCAATGCAGTGGGGAGGGACTGCGTTGGAGTTATTGAGTGTTCGATT CGGCGTG-biotin
[0123] SEQ ID NO.2:
[0124] Name: Nucleotide sequence of probe H1-B
[0125] Sequence type: DNA (other DNA)
[0126] Organism source: synthetic construct
[0127] biotin-AGTGTTCGATTCGGCGTGGGTTAACACGCCGAATCGAACACTC AATAAC
[0128] SEQ ID NO.3:
[0129] Name: Nucleotide sequence of probe H2
[0130] Sequence type: DNA (other DNA)
[0131] Organism source: synthetic construct
[0132] TTAACCCACGCCGAATCGAACACTGTTATTGAGTGTTCGATTCGGCG TG.
Claims
1. A cTnI protein detection kit based on aptamer-coupled hybridization chain reaction, characterized in that: The cTnI protein detection kit is mainly composed of specific antibodies, nucleic acid aptamers, nucleic acid probes, SA-HRP reaction solution, luminol and hydrogen peroxide.
2. The cTnI protein detection kit based on aptamer-coupled hybridization chain reaction according to claim 1, characterized in that: The specific antibody is Y302 antibody.
3. The cTnI protein detection kit based on aptamer-coupled hybridization chain reaction according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.
1.
4. The cTnI protein detection kit based on aptamer-coupled hybridization chain reaction according to claim 1, characterized in that: The nucleic acid probe includes probe H1-B and probe H2; the nucleotide sequence of the probe H1-B is shown in SEQ ID NO.2; the nucleotide sequence of the probe H2 is shown in SEQ ID NO.
3.
5. The cTnI protein detection kit based on aptamer-coupled hybridization chain reaction according to claim 1, characterized in that: The cTnI protein detection kit also includes an ELISA plate, an antigen standard, a blocking solution, a diluent and a washing solution.
6. The cTnI protein detection kit based on aptamer-coupled hybridization chain reaction according to claim 5, characterized in that: The antigen standard is a cTnI protein solution with gradient concentration.
7. The cTnI protein detection kit based on aptamer-coupled hybridization chain reaction according to claim 5, characterized in that: The blocking solution is a phosphate buffer containing 10 wt% bovine serum albumin; the diluent is a phosphate buffer; and the washing solution is a phosphate buffer containing 0.5 wt% Tween 20.
8. Use of the cTnI protein detection kit according to any one of claims 1 to 7 in detecting cTnI protein concentration.
9. A detection method applied to the cTnI protein detection kit according to any one of claims 1 to 7, characterized in that: The detection method comprises the following steps: S1. Add 30 nmol / L specific antibody solution to the ELISA plate at a volume of 100 μL / well, and combine on a shaker for 1 to 3 hours. After the reaction is complete, discard the liquid in the well and wash with washing solution for 2 to 3 times. S2, add blocking solution, the amount added is 150 μL / well, block on a shaker for 0.5-1.5 hours, discard the liquid in the well, and wash with washing solution 2-3 times; S3, add diluent as a blank group, add the sample to be tested, the amount of diluent and the sample to be tested is 100 μL / well, shake on a shaker for 0.5-1.5h, discard the liquid in the well, and wash with washing solution 2-3 times; S4, adding 400 nmol / L aptamer solution, the amount of aptamer solution added is 100 μL / well, combining on a shaker for 0.5-1.5 h, after the reaction is completed, washing with washing solution for 2-3 times; S5. Add nucleic acid probe solution at a rate of 100 μL / well, combine on a shaker for 0.5 to 1.5 hours, discard the liquid in the wells, and wash with washing solution for 2 to 3 times; In the nucleic acid probe solution, the concentrations of probe H1-B and probe H2 are both 50 nmol / L; S6, add 62.5U / L SA-HRP reaction solution, the amount of SA-HRP reaction solution added is 100μL / well, combine on a shaker for 0.5-1.5h, discard the liquid in the well, and wash 2-3 times with washing solution; S7, adding luminol solution, the amount of luminol solution added is 50 μL / well; placing the ELISA plate in an ELISA instrument, adding hydrogen peroxide solution, the amount of hydrogen peroxide solution added is 50 μL / well; S8. Obtain the pure chemiluminescence value of the sample to be detected and the pure chemiluminescence value of the blank group through chemiluminescence detection, calculate the difference between the pure chemiluminescence value of the sample to be detected and the pure chemiluminescence value of the blank group to obtain the chemiluminescence difference, substitute the chemiluminescence difference into the pre-drawn standard curve to obtain the cTnI protein concentration in the sample to be detected.
10. The detection method according to claim 9, characterized in that: The pre-drawn standard curve is a linear relationship curve between the chemiluminescence difference and the cTnI protein concentration. The pre-drawn standard curve is established based on the chemiluminescence signal difference obtained by detecting multiple cTnI protein standards of different concentrations in this kit and the corresponding cTnI protein concentration.