Application of Aloxistatin in preparation of antiviral infection drugs

Abstract

The invention relates to an application of Aloxistatin in preparation of a medicine for resisting virus infection, in particular to an application of Aloxistatin in preparation of a medicine for treating Orthopoxvirus virus infection or related diseases caused by Orthopoxvirus viruses, and particularly relates to an application of Aloxistatin in preparation of a medicine for treating Orthopoxvirus virus infection or related diseases caused by Orthopoxvirus viruses. Aloxistatin can significantly inhibit the activity of cysteine protease I7L of poxvirus, has potential ability to treat related diseases caused by orthopoxvirus such as monkey poxvirus, pox virus or vaccinia virus, and provides an effective drug use strategy for treating major infectious diseases caused by orthopoxvirus such as monkey poxvirus.

Description

Application of Aloxistatin in the preparation of drugs for antiviral infection

[0001] This application claims priority from PCT patent application PCT / CN2022 / 129537, filed on November 3, 2022. This application incorporates the entire text of the aforementioned Chinese patent application. Technical Field

[0002] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of Aloxistatin in the preparation of a drug for treating orthopoxvirus infection or related diseases caused by orthopoxvirus. Background Art

[0003] Monkeypox virus (MPXV) belongs to the Poxviridae family and is an enveloped double-stranded DNA virus. It was first discovered in monkeys in 1958 and first infected humans in 1970. After being infected by the monkeypox virus, humans will experience symptoms such as fever, headache and swollen lymph nodes, followed by the appearance of pus-filled blisters. Infection with the monkeypox virus can cause a series of serious complications such as encephalitis, sepsis and permanent vision loss, and in severe cases, death. [1] The monkeypox virus is mainly divided into two evolutionary branches - the Central African evolutionary branch and the West African evolutionary branch. The monkeypox virus currently prevalent is the West African evolutionary branch, with a mortality rate of about 1%, while the Central African evolutionary branch has a mortality rate of 10.6%. Therefore, the monkeypox virus has a certain potential harm. The transmission of the monkeypox virus mainly occurs in Africa and occasionally occurs in other countries in the world. [2 , 3] However, since May 2022, the number of monkeypox virus infections has increased dramatically worldwide, and the World Health Organization (WHO) has declared the monkeypox outbreak a global health emergency. [3] .

[0004] Monkeypox virus DNA replication is different from other DNA viruses. It can be carried out in the cytoplasm of the host cell. Viral DNA replication, transcription, accumulation of viral structural proteins and assembly of viral particles all occur in the "virus factory" located in the cytoplasm. [4] The accumulation of monkeypox virus structural proteins requires a proteolytic process mediated by two proteases, G1L and I7L, which plays a key role in the maturation of viral particles. G1L is a metallopeptidase that can cleave the core protein encoded by the L4R gene. I7L is a cysteine ​​protease that mainly acts in the late stage of the virus assembly process and contains a conserved catalytic triad consisting of cysteine, aspartic acid and histidine.[5] . This protease can recognize the Ala-Gly-Xaa sequence and cut after Gly. During the viral life cycle, it can cut and process the envelope protein encoded by the A17L gene and the four viral core structural proteins encoded by the A10L, A3L, A12L, and L4R genes. In addition, the G7L protein, which is a component of the mature viral core in the cell, also requires hydrolysis by I7L protease to function. These proteins play an important role in the life cycle of monkeypox virus, so the I7L protease that hydrolyzes these proteins to enable them to function also plays a vital role. Therefore, I7L protease has the potential to become a target for anti-monkeypox virus drugs, and it can be used as a target for the development of inhibitors. [4,6-10] .

[0005] Aloxistatin (E64d, CAS: 88321-09-9, structural formula shown below) is an irreversible, broad-spectrum cysteine ​​protease inhibitor that does not inhibit serine proteases. Aloxistatin can inhibit platelet aggregation and osteoblast differentiation. Furthermore, aloxistatin can effectively reduce the invasion of SARS-CoV-2 particles into cells by inhibiting the activity of cysteine ​​proteases called cathapsins.

[0006] Summary of the Invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiency of the prior art in the lack of effective anti-monkeypox virus drugs. The present invention provides the use of aloxistatin in the preparation of a drug for treating viral infection, specifically the use of aloxistatin in the preparation of a drug for treating orthopoxvirus infection or related diseases caused by orthopoxviruses. The present invention finds that aloxistatin has a good inhibitory effect on the I7L protease of orthopoxviruses, such as the monkeypox virus I7L protease, and has considerable potential in the treatment of monkeypox virus infection and diseases caused by monkeypox virus infection, providing an effective drug use strategy for treating major infectious diseases caused by monkeypox virus.

[0008] The present invention solves the above technical problems through the following technical solutions.

[0009] The first aspect of the present invention provides a compound as represented by formula (I), a salt thereof, a solvate thereof, or a pharmaceutical composition comprising the same, for use in the preparation of a medicament for treating orthopoxvirus infection or related diseases caused by orthopoxvirus;

[0010] In some embodiments of the present invention, the orthopoxvirus is selected from the group consisting of monkeypox virus, smallpox virus, cowpox virus, and vaccinia virus.

[0011] In some specific embodiments of the present invention, the orthopoxvirus is monkeypox virus.

[0012] In other specific embodiments of the present invention, the orthopoxvirus is smallpox virus.

[0013] In other specific embodiments of the present invention, the orthopoxvirus is vaccinia virus.

[0014] The second aspect of the present invention provides a use of a compound represented by formula (I), a salt thereof, a solvate thereof, or a pharmaceutical composition comprising the same in the preparation of an I7L protease inhibitor;

[0015] In some embodiments of the present invention, the I7L protease inhibitor is an I7L protease inhibitor of monkeypox virus or smallpox virus.

[0016] The third aspect of the present invention provides a method for treating infection by an orthopoxvirus or a related disease caused by an orthopoxvirus, comprising administering to a patient in need thereof an effective amount of a compound of formula (I), a salt thereof, a solvate thereof, or a pharmaceutical composition comprising the same;

[0017] In some embodiments of the present invention, the orthopoxvirus is selected from the group consisting of monkeypox virus, smallpox virus, cowpox virus, and vaccinia virus.

[0018] In some specific embodiments of the present invention, the orthopoxvirus is monkeypox virus.

[0019] In other specific embodiments of the present invention, the orthopoxvirus is smallpox virus.

[0020] In other specific embodiments of the present invention, the orthopoxvirus is vaccinia virus.

[0021] The fourth aspect of the present invention provides a method for inhibiting I7L protease activity, comprising the steps of using a compound represented by formula (I), a salt thereof, a solvate thereof, or a pharmaceutical composition comprising the same;

[0022] In some embodiments of the present invention, the I7L protease is the I7L protease of monkeypox virus or smallpox virus.

[0023] A fifth aspect of the present invention provides a pharmaceutical composition for treating infection by an orthopoxvirus or a related disease caused by an orthopoxvirus, or inhibiting I7L protease activity, the pharmaceutical composition comprising a compound represented by formula (I), a salt thereof, or a solvate thereof as an active ingredient;

[0024] In some embodiments of the present invention, the orthopoxvirus is selected from monkeypox virus, smallpox virus, cowpox virus and vaccinia virus; for example, monkeypox virus.

[0025] In other specific embodiments of the present invention, the orthopoxvirus is smallpox virus.

[0026] In other specific embodiments of the present invention, the orthopoxvirus is vaccinia virus.

[0027] In some specific embodiments of the present invention, the orthopoxvirus is monkeypox virus.

[0028] In some embodiments of the present invention, the I7L protease is the I7L protease of monkeypox virus or smallpox virus.

[0029] The beneficial effects of the present invention are:

[0030] To date, aloxistatin has not demonstrated significant efficacy against monkeypox virus. This study, however, innovatively discovered for the first time that aloxistatin significantly inhibits the activity of the poxvirus cysteine ​​protease I7L, demonstrating its potential for treating monkeypox virus-related diseases. Furthermore, aloxistatin is safe and reliable, enabling rapid clinical trials and providing an effective treatment for the monkeypox virus epidemic. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] FIG1 shows that the small molecule Aloxistatin has inhibitory activity against monkeypox virus protease I7L.

[0032] FIG2 shows that the small molecule Aloxistatin has inhibitory activity against variola virus protease I7L.

[0033] FIG3 shows that the small molecule Aloxistatin has inhibitory activity against vaccinia virus replication. DETAILED DESCRIPTION

[0034] Example 1: In vitro enzyme activity inhibition experiment

[0035] To a black 384-well microtiter plate (PerkinElmer, Catalog No. 6007270), add 40 μL of monkeypox virus and variola virus I7L protease solutions (SEQ ID NO: 5 and SEQ ID NO: 6, respectively) at a final concentration of 0.4 μM to each well. Add 1 μL of each of 14 concentration gradients of aloxistatin solution (Selleck, Catalog No. S7393, starting at 2000 μM, with a two-fold serial dilution) to the first 14 columns. Add 1 μL of DMSO to the 15th column as a positive control, and 40 μL of buffer to the 16th column as a negative control. Then, 10 μL of the substrate MCA-DDLQMVIAGAKSK (Dnp) (SEQ ID NO: 1) (brand: Jier Biochemical, product number: 996977) with a final concentration of 50 μM was added to each well, and the plate was placed in a microplate reader for detection. The initial enzyme activity reaction velocity was calculated at the point 4 minutes before the enzymatic reaction.

[0036] As shown in FIG1 , this embodiment demonstrates through in vitro biochemical enzyme activity inhibition experiments that Aloxistatin has a good inhibitory effect on monkeypox virus cysteine ​​protease I7L, IC 50 It is 27.23μM.

[0037] As shown in FIG2 , this example demonstrates that Aloxistatin has a good inhibitory effect on variola virus cysteine ​​protease I7L through in vitro biochemical enzyme activity inhibition experiments. 50 It is 25.65μM.

[0038] SEQ ID NO: 5 (Monkeypox virus I7L protease):

[0039] SEQ ID NO: 6 (Variola virus I7L protease):

[0040] Example 2: Antiviral activity experiment

[0041] 1.5×10 4HeLa cells were seeded at a cell density of 100 μg / mL in 48-well plates (JiaTe Bio, Catalog No. TCP-010-048) and incubated overnight. After incubation with various concentrations of the compound for 1 hour, the cells were infected with vaccinia virus (recombinantly obtained from Wuhan University) at an MOI of 0.05 for 2 hours and incubated for an additional 24 hours in drug-only medium (DMEM supplemented with 10% FBS) (Thermo Fisher Scientific, Catalog No. C11995500CP). The supernatant was collected and viral DNA was extracted using a viral DNA / RNA extraction kit (Novozymes, Catalog No. 027E3242BA). Real-time fluorescence quantitative PCR (qRT-PCR) technology was used to quantify the viral DNA copy number in the supernatant using the upstream primer 5'-gatgataacactatcatgta-3' (SEQ ID NO: 2) and the downstream primer 5'-gtataattatcaaaatacaagacgtc-3' (SEQ ID NO: 3). The control group was DMSO. The orthopoxvirus HA gene (SEQ ID NO: 4: atgacacgattaccaatacttttgttactaatatcattagtatacgctacaccttttcctcagacatctaaaaaaataggtgatgatgcaactctatcatgtaatcgaaataatacaaatgactacgttgttatgagtgcttggtataaggagcccaattccattattcttttagctgctaaaagcgacgtcttgtattttgataattataccaaggataaaatatcttacgactctccatacgatgatctagttacaactatcacaattaaatcattgactgctagagatgccggtact) was cloned into the pBS vector as a standard. 3 -10 9 copies), determine the copy number, and generate a standard curve.

[0042] Cell viability was assessed in triplicate for each compound concentration in a 96-well plate (Corning, Catalog No. 10023601). All compounds were serially diluted in maintenance medium (DMEM with 2% FBS) (Thermo Fisher Scientific, Catalog No. 8123545) at an initial concentration of 400 μM. After 24 hours of incubation, the supernatant was removed and added to 100 μL of culture medium containing CCK-8 (Macro Leaf Bio, Catalog No. GK10001). After an additional 2 hours of incubation, absorbance at 450 nm was measured using a BioTek spectrophotometer to calculate cell viability.

[0043] As shown in FIG3 , this embodiment demonstrates through antiviral activity experiments that Aloxistatin has an inhibitory effect on vaccinia virus replication. 50 13.7 μM, CC 50 Greater than 400μM.

[0044] Although the above describes specific embodiments of the present invention, it should be understood by those skilled in the art that these are merely illustrative and that various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.

[0045] References

[0046] 1.LUM FM,TORRES-RUESTA A,TAY MZ,et al.Monkeypox:disease epidemiology,host immunity and clinical interventions[J].Nat Rev Immunol,2022,22(10):597-613.

[0047] 2.MCFADDEN G.Poxvirus tropism[J].Nature Reviews Microbiology,2005,3(3):201-13.

[0048] 3.COHEN J. Monkeypox outbreak questions intensify as cases soar[J]. Science, 2022, (376-May 27 TN.6596).

[0049] 4.ANSARAH-SOBRINHO C,MOSS B.Role of the I7protein in proteolytic processing of vaccinia virus membrane and core components[J].J Virol,2004,78(12):6335-43.

[0050] 5.ANSARAH-SOBRINHO C,MOSS B.Vaccinia Virus G1 Protein,a Predicted Metalloprotease,Is Essential for Morphogenesis of Infectious Virions but Not for Cleavage of Major Core Proteins[J].Journal of Virology,2004,78(13):6855-63.

[0051] 6.ALESHIN A E,DRAG M,GOMBOSUREN N,et al.Activity,specificity,and probe design for the smallpox virus protease K7L[J].J Biol Chem,2012,287(47):39470-9.

[0052] 7.YANG S J,HRUBY D E.Vaccinia virus A12L protein and its AG / A proteolysis play an important role in viral morphogenic transition[J].Virol J,2007,4:73.

[0053] 8.BYRD C M,BOLKEN T C,HRUBY D E.Molecular dissection of the vaccinia virus I7L core protein proteinase[J].J Virol,2003,77(20):11279-83.

[0054] 9.BYRD C M,HRUBY D E.Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity[J].Virol J,2005,2:63.

[0055] 10.SZAJNER P,JAFFE H,WEISBERG A S,et al.Vaccinia Virus G7L Protein Interacts with the A30L Protein and Is Required for Association of Viral Membranes with Dense Viroplasm To Form Immature Virions[J].Journal of Virology,2003,77(6):3418-29.

Claims

1. Use of a compound of formula (I), a salt thereof, a solvate thereof, or a pharmaceutical composition comprising the same in the preparation of a medicament for treating orthopoxvirus infection or related diseases caused by orthopoxvirus; 2. The use according to claim 1, characterized in that The orthopoxvirus is selected from the group consisting of monkeypox virus, smallpox virus, cowpox virus and vaccinia virus.

3. The use according to claim 2, characterized in that The orthopoxvirus is monkeypox virus, smallpox virus or vaccinia virus.

4. Use of a compound of formula (I), a salt thereof, a solvate thereof, or a pharmaceutical composition comprising the same in the preparation of an I7L protease inhibitor; Preferably, the I7L protease inhibitor is an I7L protease inhibitor of monkeypox virus or smallpox virus.

5. A method for treating an infection caused by an orthopoxvirus or a related disease caused by an orthopoxvirus, comprising administering to a patient in need thereof an effective amount of a compound of formula (I), a salt thereof, a solvate thereof, or a pharmaceutical composition comprising the same; 6. The method according to claim 5, wherein The orthopoxvirus is selected from the group consisting of monkeypox virus, smallpox virus, cowpox virus and vaccinia virus.

7. The method according to claim 6, wherein The orthopoxvirus is monkeypox virus, smallpox virus or vaccinia virus.

8. A method for inhibiting I7L protease activity, comprising the step of using a compound of formula (I), a salt thereof, a solvate thereof, or a pharmaceutical composition comprising the same; Preferably, the I7L protease is the I7L protease of monkeypox virus or smallpox virus.

9. A pharmaceutical composition for treating orthopoxvirus infection or related diseases caused by orthopoxvirus, or inhibiting I7L protease activity, comprising a compound of formula (I), a salt thereof, or a solvate thereof as an active ingredient; 10. The pharmaceutical composition according to claim 9, wherein The orthopoxvirus is selected from monkeypox virus, smallpox virus, cowpox virus and vaccinia virus; and / or the I7L protease is the I7L protease of monkeypox virus or smallpox virus; Preferably, the orthopoxvirus is monkeypox virus, smallpox virus or vaccinia virus.

Images