A Pogostemon cablin transcription factor PcIDD2 and its application in positively regulating the biosynthesis of pogostone

By overexpressing or silencing PcIDD2 transcription factor in patchouli, the biosynthesis of patchouli ketone was significantly regulated, and the problem of unresolved patchouli ketone synthesis pathway was solved, efficient patchouli ketone production was achieved, and genetic engineering and metabolic regulation of medicinal plants was promoted, and its economic value was enhanced.

CN120118169BActive Publication Date: 2025-07-22GUANGZHOU UNIVERSITY OF CHINESE MEDICINE
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510607602.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-07-22
Estimated Expiration
2045-05-13

AI Technical Summary

Technical Problem

The biosynthesis pathway of patchouli ketone in the prior art has not been fully analyzed and the transcriptional regulation mechanism is not clear, which makes it difficult to achieve efficient expression and high yield of patchouli ketone, which limits its economic value.

Method used

The patchouli transcription factor PcIDD2 was isolated and identified and used to overexpress or silencing PcIDD2 in patchouli through the Agrobacterium-mediated genetic transformation system, which significantly regulated the biosynthesis of patchouli ketone, and the changes in ketone content were detected by HPLC.

Benefits of technology

It significantly increases the content of patchouli ketone, provides low-cost and efficient synthesis methods, provides possibilities for genetic engineering and metabolic regulation of medicinal plants, and promotes the application of patchouli ketone in the fields of medicine, fragrance and cosmetics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118169B_ABST
    Figure CN120118169B_ABST
Patent Text Reader

Abstract

The present application provides a Pogostemon cablin transcription factor PcIDD2 and its application in positively regulating the biosynthesis of pogostone. The amino acid sequence of the Pogostemon cablin transcription factor PcIDD2 is shown in SEQ ID NO.1; it is a potential transcription factor with the function of promoting the biosynthesis of pogostone and is of great significance for promoting the efficient synthesis of pogostone.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of plant genetic engineering, and particularly relates to a Pogostemon cablin transcription factor PcIDD2 and its application in positively regulating the biosynthesis of pogostone. Background Art

[0002] Pogostemon cablin Pogostemon cablin (Blanco) Benth. is a perennial aromatic herb or subshrub of the genus Pogostemon in the family Lamiaceae. As a genuine medicinal material in the Lingnan region, it is listed as one of the "Top Ten Southern Medicines" due to its unique medicinal value and extensive clinical applications. As a medicinal material, Pogostemon cablin refers to its dried above-ground parts, which are pungent in taste, slightly warm in nature, and belong to the spleen, stomach, and lung meridians. It has the effects of aromatic turbidity elimination, harmonizing the middle and stopping vomiting, and relieving summer heat and dampness. It is mainly used to treat syndromes such as damp turbidity obstructing the middle energizer, epigastric distension and vomiting, summer heat and dampness exterior syndrome, fever and fatigue, etc., and plays an important role in traditional Chinese medicine treatment. At the same time, the essential oil and secondary metabolites of Pogostemon cablin have extensive application values in the fields of medicine, spices, and cosmetics.

[0003] As one of the main active components of the essential oil of Pogostemon cablin, pogostone has attracted much attention due to its significant anti-inflammatory, antibacterial, antiviral and other pharmacological effects. Currently, Pogostemon cablin is the only plant source for producing pogostone, which greatly restricts the research on the biosynthesis pathway of pogostone. The biosynthesis pathway of pogostone has not been fully elucidated yet, and there are very few key enzymes verified on its pathway. Existing research has only verified that the protein encoded by Pogostemon cablin acyl-activating enzyme PcAAE2 can catalyze the formation of 4-methylvaleric acid coenzyme A (4MVCoA) from 4-methylvaleric acid, and confirmed that 4-methylvaleric acid is a precursor compound for the biosynthesis of pogostone. However, the transcriptional regulation mechanism of pogostone is still in the blank of research.

[0004] Therefore, achieving the efficient expression of Pogostemon cablin and significantly increasing the content of pogostone is one of the ways to realize the economic value of Pogostemon cablin. Summary of the Invention

[0005] The embodiments of this application provide a Pogostemon cablin transcription factor PcIDD2 and its application in positively regulating the biosynthesis of pogostone to solve the problems existing in the related technologies. The technical solutions are as follows:

[0006] In the first aspect, the embodiments of this application provide a Pogostemon cablin transcription factor PcIDD2, and the amino acid sequence of the Pogostemon cablin transcription factor PcIDD2 is shown as SEQ ID NO.1.

[0007] Second aspect, the embodiments of the present application provide a gene encoding Pogostemon cablin transcription factor PcIDD2, and the nucleotide sequence of the cDNA reading frame of the gene encoding Pogostemon cablin transcription factor PcIDD2 is shown in SEQ ID NO.2; or the Pogostemon cablin transcription factor PcIDD2 encoded by the gene, and its corresponding amino acid sequence is shown in SEQ ID NO.1.

[0008] In one embodiment, the gene encoding Pogostemon cablin transcription factor PcIDD2 is amplified with the primer pair shown in SEQ ID NO.3 and SEQ ID NO.4.

[0009] Third aspect, the embodiments of the present application provide the application of the Pogostemon cablin transcription factor PcIDD2, or the gene encoding Pogostemon cablin transcription factor PcIDD2 in regulating the biosynthesis of pogostone.

[0010] Fourth aspect, the embodiments of the present application provide an overexpression vector inserted with the gene encoding Pogostemon cablin transcription factor PcIDD2, and the nucleotide sequence of the cDNA reading frame of the gene encoding Pogostemon cablin transcription factor PcIDD2 is shown in SEQ ID NO.2; or the Pogostemon cablin transcription factor PcIDD2 encoded by the gene, and its corresponding amino acid sequence is shown in SEQ ID NO.1.

[0011] Fifth aspect, the embodiments of the present application provide a transgenic engineering bacterium transformed with the overexpression vector, and the transgenic engineering bacterium is an Agrobacterium engineering bacterium.

[0012] Sixth aspect, the embodiments of the present application provide the application of the overexpression vector, or the transgenic engineering bacterium in regulating the biosynthesis of pogostone.

[0013] In one embodiment, regulating the biosynthesis of pogostone is carried out in Pogostemon cablin plants.

[0014] Seventh aspect, the embodiments of the present application provide a biological agent for improving the biosynthesis of pogostone, and the active ingredient of the biological agent is the overexpression vector, or the transgenic engineering bacterium.

[0015] Eighth aspect, the embodiments of the present application provide a method for improving the biosynthesis of pogostone, and the method includes increasing the expression of the gene encoding Pogostemon cablin transcription factor PcIDD2 in Pogostemon cablin; the nucleotide sequence of the cDNA reading frame of the gene encoding Pogostemon cablin transcription factor PcIDD2 is shown in SEQ ID NO.2; or the Pogostemon cablin transcription factor PcIDD2 encoded by the gene, and its corresponding amino acid sequence is shown in SEQ ID NO.1.

[0016] The advantages or beneficial effects in the above technical solutions at least include:

[0017] In this application, the IDD family transcription factor PcIDD2 was first isolated and identified from Pogostemon cablin, and it was revealed that it can significantly and positively regulate the biosynthesis of pogostone. Transient overexpression in Pogostemon cablin leaves can significantly increase the content of pogostone. Conversely, using virus-induced gene silencing experiments (VIGS) can significantly reduce the content of pogostone, indicating that this is a potential transcription factor with the function of promoting pogostone biosynthesis and is of great significance for promoting the efficient synthesis of pogostone.

[0018] The current methods for extracting pogostone face problems of high cost and low yield, making it difficult to meet market demand. Through transient overexpression technology, the efficient expression of the PcIDD2 transcription factor can be achieved in a short time, enhancing its regulatory ability on the pogostone synthesis pathway, thereby promoting the expression of key enzymes PcAAE2 and significantly increasing the content of pogostone.

[0019] Based on the Agrobacterium-mediated genetic transformation system, this technology can not only be applied to the genetic engineering transformation of Pogostemon cablin, but also be extended to other medicinal plants, providing new possibilities for the functional genomics and metabolic regulation breeding of various medicinal plants.

[0020] The above summary is only for the purpose of the specification and is not intended to be limiting in any way. In addition to the above-described illustrative aspects, embodiments, and features, further aspects, embodiments, and features of this application will be readily apparent by reference to the drawings and the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In the drawings, unless otherwise specified, the same reference numerals throughout the several drawings denote the same or similar components or elements. These drawings are not necessarily drawn to scale. It should be understood that these drawings only depict some embodiments disclosed in this application and should not be regarded as limiting the scope of this application.

[0022] Figure 1 This is a schematic diagram of the activity of the key enzyme gene promoter in the tobacco transient transformation PcIDD2-activated pogostone synthesis pathway of this application PcAAE2 of this application;

[0023] Figure 2 This is a schematic diagram of the expression level of pogostone in Pogostemon cablin by transient overexpression and virus-induced gene silencing PcIDD2 transcription factors. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0024] In the following text, only some exemplary embodiments are briefly described. As those skilled in the art can recognize, the described embodiments can be modified in various different ways without departing from the spirit or scope of the present application. Therefore, the accompanying drawings and the description are considered to be exemplary in nature rather than restrictive.

[0025] In order to provide a method for increasing the yield of pogostone in Pogostemon cablin at low cost and reliably, the present application isolated and identified the IDD family transcription factor PcIDD2 from Pogostemon cablin, and revealed that it can significantly and positively regulate the biosynthesis of pogostone.

[0026] The present invention realizes increasing the content of pogostone in Pogostemon cablin through the transcription factor PcIDD2 by the following technical solutions. The method includes the following steps:

[0027] Step 1: Clone the PcIDD2 gene of Pogostemon cablin and construct a pLB- PcIDD2 cloning vector;

[0028] Step 2: Use restriction endonucleases ( Pac I / Not I, Sac I / Xma I) to construct an overexpression vector pJLTRBO- PcIDD2 and a virus-induced gene silencing (VIGS) vector pTRV2- PcIDD2 respectively;

[0029] Step 3: Use the overexpression vector pJLTRBO- PcIDD2 , and overexpress it in Pogostemon cablin mediated by Agrobacterium tumefaciens PcIDD2 ;

[0030] Step 4: Use the VIGS vector pTRV2- PcIDD2 , and inhibit its expression in Pogostemon cablin mediated by Agrobacterium tumefaciens PcIDD2 ;

[0031] Step 5: Quantitatively analyze the content of pogostone in leaves by HPLC method (Agilent C18 column, gradient elution with acetonitrile - 0.1% formic acid water).

[0032] As one of the implementation manners, step 1 further includes:

[0033] Using the total RNA of Pogostemon cablin extracted as a template, and obtaining cDNA by using HiScript III 1st Strand cDNA Synthesis Kit (gDNA wiper);

[0034] According to PcIDD2The nucleotide sequence of the gene, i.e., SEQ ID NO.2, was used to design specific primers, and the gene was amplified from cDNA by PCR PcIDD2 The gene was ligated to the pLB vector after gel recovery and purification to obtain the cloning vector pLB- PcIDD2 , and the plasmid was extracted;

[0035] The specific primers are as follows:

[0036] Forward primer SEQ ID NO.3: ATGATGTCTGGTGATGTG

[0037] Reverse primer SEQ ID NO.4: CTAGTGATTGCTAGTGAAGT.

[0038] As one of the embodiments, step 2 further includes:

[0039] Amplify the PcIDD2 gene from the correctly sequenced pLB- PcIDD2 and use restriction endonucleases ( Pac I / Not I, Sac I / Xma I) to construct the overexpression vector pJLTRBO- PcIDD2 and the VIGS vector pTRV2- PcIDD2 .

[0040] As one of the embodiments, the PcIDD2 gene was constructed on the plant overexpression vector pJLTRBO, and the Pac I and Not I restriction enzyme sites were introduced upstream and downstream of the primers.

[0041] As one of the embodiments, the PcIDD2 gene fragment was constructed on the VIGS vector pTRV2, and the Sac I and Xma I restriction enzyme sites were introduced upstream and downstream of the primers.

[0042] As one of the embodiments, step 3 further includes:

[0043] Step 3.1, Use PcIDD2 the overexpression vector to construct an Agrobacterium engineering strain;

[0044] Step 3.2, Use the Agrobacterium engineering strain constructed in step 3.1 to transiently transform Pogostemon cablin leaves;

[0045] Step 3.3, Extract Pogostemon cablin leaves.

[0046] As one of the embodiments, step 3.1 specifically includes:

[0047] The overexpression vector was transferred into Agrobacterium tumefaciens GV3101 containing the pSoup-p19 helper plasmid by the freeze-thaw method to obtain an Agrobacterium engineering strain containing the target vector.

[0048] As one of the embodiments, step 4 further includes:

[0049] Step 4.1: Use the VIGS vectors pTRV1 and pTRV2- PcIDD2 to construct Agrobacterium engineering strains respectively;

[0050] Step 4.2: Use the Agrobacterium engineering bacteria constructed in step 4.1 to transiently transform Pogostemon cablin leaves;

[0051] Step 4.3: Extract Pogostemon cablin leaves.

[0052] As one of the embodiments, step 4.1 specifically includes:

[0053] Transfer pTRV1, pTRV2- PcIDD2 and the pTRV2 empty plasmid into Agrobacterium tumefaciens GV3101 containing the pSoup-p19 helper plasmid by the freeze-thaw method respectively to obtain Agrobacterium engineering strains.

[0054] The present invention also provides a method for detecting the content of pogostone in Pogostemon cablin of the overexpression and silencing systems constructed above, which is detected by HPLC. PcIDD2 The following further elaborates on the present invention in detail with specific examples and drawings.

[0055] Example 1: Pogostemon cablin

[0056] Gene cloning PcIDD2 Using the extracted total RNA of Pogostemon cablin as a template, cDNA was obtained by using HiScript III 1st Strand cDNA Synthesis Kit (gDNA wiper) (Nanjing Novoprotein Biological Technology Co., Ltd.); according to

[0057] the nucleotide sequence of the gene (SEQ ID NO.2), specific primers were designed. PcIDD2 The nucleotide sequence is as follows:

[0058] The nucleotide sequence is as follows:

[0059]

[0060] The 4 C2H2 zinc finger domain sites are located at 199..255, 325..415, 426..490, and 500..570 respectively.

[0061] The specific primers are as follows:

[0062] Forward primer SEQ ID NO.3: ATGATGTCTGGTGATGTG;

[0063] Reverse primer SEQ ID NO.4: CTAGTGATTGCTAGTGAAGT

[0064] Amplify the PcIDD2 gene from cDNA by PCR, ligate it with the pLB vector (Tiangen Biochemical Co., Ltd.) after gel recovery and purification to obtain the cloning vector pLB- PcIDD2 , and extract the plasmid for sequencing.

[0065] Through the above steps, the coding sequence (SEQ ID NO.2) of the Pogostemon cablin PcIDD2 transcription factor was obtained and its protein coding sequence (SEQ ID NO1) was deduced, where the start codon is ATG and the stop codon is TAG.

[0066] The protein coding sequence is as follows:

[0067] SEQ ID NO.1: MMSGDVFSVPNSAAPKLPNLESQPNPNFSSKPPSKKRRNLPGTPDPDAEVIALSPKTLMATNRFICEICNKGFQRDQNLQLHRRGHNLPWKLKQRANKDQIKKKVYICPEKSCVHHDPARALGDLTGIKKHFSRKHGEKKWKCDKCSKKYAVQSDWKAHSKTCGTREYKCDCGTLFSRKDSFITHRAFCDALAEESARITTTTHVGNNNLSFRNDDLNGFAGIPHLAGGYRPDFGAGNSILGDHNQQKPRLSLWLDQHQPNPNMDHNSNMFTSSEMLNQIAASSNLFNSSMANYATLSLSPRGMKEEPRGSCTMADSLASLYSTDNQRSSPQAPMSATALLQKAAQMGSTNSPAGFCGNAAGVMMSSSSPSSSSTNTLSSFAAAAQNRRELHQVFGAAAAPDNSAARGGSDAMMNFMSSGNHLNGVSLHSGLHGVEHSLTRDFLGMGGDGGGAGPFSPQELAKFASMSSAMGLTHFTSNH。

[0068] Example 2, Key Enzyme Gene for Pogostone Biosynthesis PcAAE2 Construction of Dual-Luciferase Experimental Vector for Promoter of

[0069] According to the sequence information obtained from the Pogostemon cablin database, design PcAAE2 specific primers for promoter amplification, and use Pogostemon cablin genomic DNA as a template for amplification. Introduce Xma I and Nco I restriction enzyme sites at the upstream and downstream of the primers. The primer sequences are as follows:

[0070] Forward primer pGreenII 0800-LUC-PcAAE2-FP (SEQ ID NO. 9): tcgaattcctgcagcccgggGCATTTTTAGGTTATTTTATTGACT;

[0071] Reverse primer pGreenII 0800-LUC-PcAAE2-RP (SEQ ID NO. 10): gtttttggcgtcttccatggATACTGAAAAACATAATAAAATTGA.

[0072] From the correctly sequenced pLB- PcIDD2Amplify the PcIDD2 gene, construct it on pGreenII62SK, and introduce Sac I and Xma I restriction enzyme sites at the upstream and downstream of the primers. The primer sequences are as follows:

[0073] Forward primer pGreenII 62SK-PcIDD2-FP (SEQ ID NO. 11): agcccaagctgagctcATGATGTCTGGTGATGTGTTTTCTG;

[0074] Reverse primer pGreenII 62SK-PcIDD2-RP (SEQ ID NO. 12): tcgaattcctgcagcccgggCTAGTGATTGCTAGTGAAGTGG.

[0075] Using the method of recombinant plasmid, the amplified PcAAE2 promoter fragment and PcIDD2 fragment were respectively constructed into pGreenII 0800-LUC and pGreenII 62SK through ClonExpress II One Step Cloning Kit (Nanjing Novoprotein Scientific Inc.), and the reporter plasmid pGreenII0800-LUC- PcAAE2 and effector plasmid pGreenII 62SK- PcIDD2 .

[0076] Example 3. Transient transformation of tobacco to detect the activation effect of transcription factor PcIDD2 on the PcAAE2 promoter of the key enzyme.

[0077] Transfer the reporter plasmid pGreenII 0800-LUC- PcAAE2 , effector plasmid pGreenII 62SK- PcIDD2 and empty plasmid pGreenII 62SK into Agrobacterium tumefaciens GV3101 (pSoup-p19) respectively to obtain the corresponding Agrobacterium engineering strains.

[0078] Inoculate the positive bacteria of the above Agrobacterium engineering strains in 50 mL of liquid medium at a ratio of 1:25 and expand the culture until OD 600 =0.6 - 0.8, centrifuge at 5000 g for 5 min, add 15 mL of infection buffer 1 to resuspend the cells, centrifuge at 5000 g for 3 min at room temperature, then add infection buffer 1 to resuspend the cells again, and adjust OD 600 to 0.6. The reporter plasmid pGreenII 0800-LUC- PcAAE2The bacterial liquid was mixed with the effector plasmid pGreenII 62SK- PcIDD2 The bacterial liquid was mixed at a ratio of 1:9 as the experimental group, and the promoter was mixed with the empty plasmid pGreenII 62SK as the control group. 7.5 μL of 200 mM acetosyringone (AS) was added to the above-mentioned mixed infection solution (10 mL) to make its final concentration 150 μmol / L, and it was left standing in the dark for 3 - 5 h. Then, the solution was injected into the leaves of Nicotiana benthamiana using a 1 mL sterile syringe, cultured in the dark for one night, and then cultured under normal light for 4 days.

[0079] After 4 days of injection, the leaves of Nicotiana benthamiana were punched in the injection area with a 6 mm puncher. Three leaf discs were punched from each tobacco plant as one biological replicate, grinding beads were added, and they were ground using an automatic grinder. The enzyme activity was detected using the Dual-Luciferase Reporter Assay Kit from Beyotime and a microplate reader, and the operation was carried out according to the kit instructions. The results were as Figure 1 shown. Dual-LUC analysis was used to analyze the transcriptional activity of the transcription factor PcIDD2 on the PcAAE2 promoter, with the empty plasmid pGreenII 62SK as the control. The results showed that the transcription factor PcIDD2 significantly activated the PcAAE2 activity of the promoter.

[0080] Preparation of infection buffer 1 (500 mL): 2.5 g D-glucose, 1.066 g MES, 0.380 g Na2HPO4·12H2O, add ddH2O to 500 mL, and use it freshly prepared.

[0081] Example 4, PcIDD2 Construction of overexpression vector and promotion of pogostone synthesis in Pogostemon cablin

[0082] Amplify the PcIDD2 gene from the correctly sequenced pLB- PcIDD2 recombinant plasmid, construct it on the plant expression vector pJLTRBO, and introduce Pac I restriction enzyme site in the forward primer and Not I restriction enzyme site in the reverse primer. The primer sequences are as follows:

[0083] Forward primer pJLTRBO-PcIDD2-FP (SEQ ID NO.5): ttcgtgttcttgtcattaattaaATGATGTCTGGTGATGTGTTTTCTG;

[0084] Reverse primer pJLTRBO-PcIDD2-RP (SEQ ID NO.6): tcaagttgcaggaccgcggccgcCTAGTGATTGCTAGTGAAGTGGGTG.

[0085] The overexpression vector pJLTRBO- PcIDD2 was transferred into Agrobacterium tumefaciens GV3101 (pSoup-p19) (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by the freeze-thaw method to obtain an engineered Agrobacterium strain.

[0086] The positive strain of the engineered Agrobacterium strain constructed was inoculated in 30 mL of liquid medium at a ratio of 1:30 and expanded to OD 600 = 0.8 - 1.0, centrifuged at 5000 rpm for 5 min; the cells were resuspended with 20 mL of infection buffer 2 and centrifuged at 5000 rpm for 5 min; then resuspended with infection buffer 2 again to make its OD 600 = 0.8 - 1.0, and left to stand in the dark at room temperature for 2 - 4 h for standby. The engineered Agrobacterium strain after expanded culture was injected into the leaves of Pogostemon cablin plants at the 6 - 8 leaf stage by syringe infection. The control group was Pogostemon cablin treated with Agrobacterium transformed with the empty plasmid pJLTRBO. The plants were first treated in the dark overnight and then cultured under normal light for 4 days.

[0087] The transformed and cultured Pogostemon cablin leaves were cut, frozen in liquid nitrogen and ground into powder. The powder was placed in an EP tube, 600 μL was added, ultrasonic treatment (power 250 W, frequency 40 kHz) was carried out for 30 min, and the supernatant was centrifuged and filtered through a 0.22 μm filter to prepare sample 1 and control sample 1.

[0088] Preparation of infection buffer 2 (500 mL): 5 mL of 1 M MgCl2, 5 mL of 1 M MES, 500 μL of 200 mM AS, add ddH2O to 500 mL.

[0089] Example 5, Construction of virus-induced gene silencing vector, inhibition of pogostone synthesis in Pogostemon cablin

[0090] Amplify the PcIDD2 gene from the correctly sequenced pLB- PcIDD2 recombinant plasmid, construct it on the VIGS system vector pTRV2, and introduce Sac I and Xma I restriction enzyme sites at the upstream and downstream of the primers. The primer sequences are as follows:

[0091] Forward primer pTRV2-PcIDD2-FP (SEQ ID NO.7): atccggtaccgagctcACTACTACCCATGTTGGGAATAATA;

[0092] Reverse primer pTRV2-PcIDD2-RP (SEQ ID NO.8): gtcttcgggacatgcccgggCGACGATCTCTGATTATCCGTA.

[0093] pTRV1, pTRV2- PcIDD2 and the empty pTRV2 plasmid were respectively transferred into Agrobacterium tumefaciens GV3101 (pSoup-p19) (purchased from Shanghai Vidy Biotechnology Co., Ltd.) by the freeze-thaw method to obtain Agrobacterium engineering strains.

[0094] The positive strains of the constructed Agrobacterium engineering bacteria were respectively inoculated in 30 mL of liquid medium at a ratio of 1:30 and expanded to OD 600 = 0.8 - 1.0, centrifuged at 5000 rpm for 5 min; the cells were resuspended with 20 mL of infection buffer 2 and centrifuged at 5000 rpm for 5 min; then resuspended with infection buffer 2 to make its OD 600 = 0.6 - 0.8. The bacterial suspensions of pTRV1 and pTRV2- PcIDD2 were mixed at a volume ratio of 1:1 and allowed to stand in the dark at room temperature for 2 - 4 h for standby. The expanded Agrobacterium engineering strains were injected into the leaves of Pogostemon cablin plants at the 6 - 8 leaf stage by syringe injection. The control group was Pogostemon cablin treated with the mixed bacterial suspension of pTRV1 and pTRV2. The plants were first treated in the dark overnight and then cultured under normal light for 21 days.

[0095] The transformed and cultured Pogostemon cablin leaves were cut, frozen in liquid nitrogen and ground into powder. The powder was placed in an EP tube, 600 μL was added, ultrasonic treatment (power 250 W, frequency 40 kHz) was carried out for 30 min, and the supernatant was centrifuged and filtered through a 0.22 μm filter; Sample 2 and control sample 2 were prepared.

[0096] Example 6. Determination of pogostone content in transiently transformed Pogostemon cablin leaves by high performance liquid chromatography (HPLC)

[0097] The HPLC experiment used an Agilent Eclipse Plus C18 column (250 mm × 4.6 mm, 5 μm) chromatographic column. Mobile phase A: 0.1% formic acid aqueous solution, B: acetonitrile. Detection wavelength: 310 nm, flow rate: 1.0 mL / min, injection volume: 10 μL; The gradient elution conditions are shown in Table 1:

[0098] Table 1

[0099]

[0100] Accurately weigh 5.00 mg of pogostone, and dissolve it in methanol to prepare a stock solution with a concentration of 1.00 mg / mL. Appropriately pipette an aliquot of the reference stock solution, and dilute it 5, 20, 50, 100, 200, 400, and 800 times with methanol to prepare 7 reference solutions with different mass concentrations of 200 μg / mL, 50 μg / mL, 20 μg / mL, 10 μg / mL, 5 μg / mL, 2.5 μg / mL, and 1.25 μg / mL respectively. Inject the samples for determination under the chromatographic conditions, and record the chromatograms. Using the mass concentration of the reference solution as the abscissa (μg / mL) and the peak area as the ordinate (Y), perform linear regression to plot the standard curve.

[0101] The accumulation amount of pogostone was determined by HPLC. Substitute the peak area into the linear regression equation to calculate the concentration of pogostone in the sample (μg / mL), and further calculate the content of pogostone in Pogostemon cablin leaves.

[0102] The HPLC detection method developed in this study optimizes the mobile phase system, significantly reducing the instrument maintenance cost while being environmentally friendly (avoiding buffer salt pollution) and having the advantage of mass spectrometry compatibility (suitable for LC-MS combined analysis). The integrated application of this technical system provides an innovative solution for the large-scale production and precise regulation of active ingredients in medicinal plants, showing broad industrial application prospects in both synthetic biology and modern agriculture.

[0103] Samples 1 prepared in Example 4, control sample 1, samples 2 prepared in Example 5, and control sample 2 were detected using the method of Example 6, and the results are as Figure 2 shown.

[0104] As Figure 2 shown, in the transient overexpression experiment, compared with the control group, the content of pogostone in the Pogostemon cablin leaves overexpressing PcIDD2 significantly increased by 88.48%; in the VIGS experiment, compared with the control group, the content of pogostone significantly decreased by 78.17%.

[0105] This indicates that this application involves the Pogostemon cablin transcription factor PcIDD2. The transcription factor was constructed into the overexpression vector and the VIGS system vector, and the vectors were transferred into Agrobacterium and then transformed into Pogostemon cablin leaves; the content of pogostone in Pogostemon cablin leaves was determined by HPLC, and the genetic transformation methods of transient overexpression and VIGS were used to find that the content of pogostone in Pogostemon cablin leaves was significantly regulated; the transcription factor PcIDD2 can promote the synthesis of pogostone in Pogostemon cablin. It proves the key role of the PcIDD2 transcription factor in the biosynthetic pathway of pogostone, providing a theoretical basis for further optimizing the production of pogostone.

[0106] Therefore, in this application, overexpression and gene silencing are achieved through transgenic technology PcIDD2 Thereby regulating the synthesis of pogostone, clarifying the mechanism of action of PcIDD2 as a key transcription factor, better analyzing the transcriptional regulation network of pogostone, and providing an important theoretical basis for subsequent research. In addition, combined with the dual-luciferase assay, the evaluation of the regulatory effect of PcIDD2 is made more accurate, providing data support for further optimizing the genetic engineering strategy and improving the operability of the technology.

[0107] In the description of this specification, the descriptions referring to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0108] In addition, the terms "first" and "second" are only used for descriptive purposes and cannot be understood as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. Thus, the features defined with "first" and "second" may explicitly or implicitly include at least one of these features. In the description of the present application, "a plurality" means two or more unless otherwise specifically defined.

[0109] The above is only the specific implementation manner of the present application, but the protection scope of the present application is not limited thereto. Any person skilled in the art within the technical scope disclosed in the present application can easily think of various changes or substitutions, and these should all be covered by the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. A Pogostemon cablin transcription factor PcIDD2, characterized in that, The amino acid sequence of the Pogostemon cablin transcription factor PcIDD2 is shown in SEQ ID NO.

1.

2. A gene encoding Pogostemon cablin transcription factor PcIDD2, characterized in that, The nucleotide sequence of the cDNA reading frame of the gene encoding the Pogostemon cablin transcription factor PcIDD2 is shown in SEQ ID NO.2; or the Pogostemon cablin transcription factor PcIDD2 encoded by the gene, and its corresponding amino acid sequence is shown in SEQ ID NO.

1.

3. The gene encoding Pogostemon cablin transcription factor PcIDD2 according to claim 2, characterized in that, The gene encoding the Pogostemon cablin transcription factor PcIDD2 is amplified with the primer pair shown in SEQ ID NO.3 and SEQ ID NO.

4.

4. Use of the Pogostemon cablin transcription factor PcIDD2 as claimed in claim 1, or the gene encoding the Pogostemon cablin transcription factor PcIDD2 as claimed in claim 2 or 3, in regulating the biosynthesis of pogostone, characterized in that, The Pogostemon cablin transcription factor PcIDD2, or the gene encoding the Pogostemon cablin transcription factor PcIDD2, is overexpressed in Pogostemon cablin.

5. An overexpression vector inserted with the gene encoding the Pogostemon cablin transcription factor PcIDD2 as described in claim 2, characterized in that, The nucleotide sequence of the cDNA reading frame of the gene encoding the Pogostemon cablin transcription factor PcIDD2 is shown in SEQ ID NO.2; or the Pogostemon cablin transcription factor PcIDD2 encoded by the gene, and its corresponding amino acid sequence is shown in SEQ ID NO.

1.

6. A genetically engineered bacterium transformed with the overexpression vector described in claim 5, characterized in that, The transgenic engineering bacteria are Agrobacterium engineering bacteria.

7. Use of the overexpression vector according to claim 5, or the genetically engineered bacterium according to claim 6, in regulating the biosynthesis of pogostone, characterized in that, The overexpression vector, or the transgenic engineering bacteria, is overexpressed in Pogostemon cablin.

8. A biological agent for enhancing the biosynthesis of pogostone, characterized in that, The active ingredient of the biological agent is the overexpression vector described in claim 5, or the transgenic engineering bacteria described in claim 6.

9. A method for enhancing the biosynthesis of pogostone, characterized in that, The method includes increasing the expression of the gene encoding the Pogostemon cablin transcription factor PcIDD2 in Pogostemon cablin; the nucleotide sequence of the cDNA reading frame of the gene encoding the Pogostemon cablin transcription factor PcIDD2 is shown in SEQ ID NO.2; or the Pogostemon cablin transcription factor PcIDD2 encoded by the gene, and its corresponding amino acid sequence is shown in SEQ ID NO.1.

Citation Information

Patent Citations

  • Novel short-side-chain fatty acid CoA ligases and application thereof in preparation of patchouli ketone

    CN113278597A