The growth-promoting strain Clonostachys rosea MSF05 of Morchella esculenta
By screening and identifying the morel-promoting strain Pink Helix Polysporus MSF05, the soil microecology was improved, and the continuous cropping obstacles in morel cultivation were solved, which promoted the growth and yield of morels.
Patent Information
- Application Number
- CN202510553375.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2045-04-29
AI Technical Summary
The problems of difficulty in seedling emergence, poor seedling growth, increased pests and diseases and reduced yields in morel cultivation have affected their sustainable development.
The morel-promoting strain Clonostachys rosea MSF05 was screened, and it was identified through molecular biology technology to provide bacterial agents or composite microbial preparations to improve soil microecology and promote morel growth.
It significantly improves the mycelium growth rate and biomass of morels, solves continuous cropping obstacles, and improves the production efficiency and adaptability of morels.
Smart Images

Figure CN120118754B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a Clonostachys rosea strain MSF05 that promotes the growth of Morchella Clonostachys rosea MSF05 Background Art
[0002] Continuous cropping obstacle, also known as crop replant disorder or replant problem, refers to the problems such as difficult emergence, poor seedling growth, increased pests and diseases, reduced yield, and deterioration of variety that occur when the same or closely related crops are continuously planted on the same piece of land under conventional cultivation management. This phenomenon widely affects the cultivation of various plants such as food crops, cash crops, vegetables, forest trees, and traditional Chinese medicinal materials, and has become a major obstacle to the development of the planting industry in China. Its sources include soil microorganisms, soil enzymes, soil-borne diseases, allelopathic autotoxicity, etc. One important reason is the change in the soil microbial structure
[0003] The genus Morchella Morchella spp. belongs to the large class of fungi Ascomycota, and specifically belongs to the Pezizomycetes class, Pezizales order, and Morchellaceae family. This rare edible and medicinal fungus is named "Morchella" because its head has a unique uneven surface, similar to a sheep's stomach. Since the successful commercial cultivation of Morchella, the soil ecological problems caused by soil and continuous cropping have become an obstacle to the sustainable development of Morchella. Various enzymes in the soil play a key role in the utilization of nutrients such as C, N, and P, and participate in the cycling of these elements in the soil. The soil enzyme activity is closely related to the abundance and diversity of microorganisms in the habitat, and is a key factor in the function of the soil ecosystem
[0004] Based on this, the present invention analyzes the evolution of culturable microbial groups in the soil of continuous cropping cultivation of Morchella, and isolates the dominant microorganisms in the continuous cropping soil of Morchella. Further screen the strains that promote the growth of Morchella, and classify the species of each strain by combining microscopic and macroscopic characteristics such as morphology and physiology with molecular biology techniques, so as to provide theoretical support and practical guidance for the sustainable and stable development of the Morchella planting industry Summary of the Invention
[0005] The main object of the present invention is to provide a Clonostachys rosea strain MSF05 that promotes the growth of Morchella to solve the problems of the growth of Morchella in the background art
[0006] The system of the present invention separates and identifies beneficial microorganisms in the cultivation soil of Morchella, providing practical experience for the continuous cultivation and stable development of Morchella. By using the plate confrontation test combined with molecular biology techniques, strains with promoting effects can be quickly screened out, and the types of strains can be accurately determined through molecular-level identification, providing reliable technical support for the continuous high-yield cultivation of Morchella.
[0007] Specifically, the present invention provides the following technical solutions:
[0008] The present invention has isolated and identified a strain of Morchella growth-promoting fungus Gliocladium roseum ( Clonostachys rosea ), named MSF05, and its taxonomic name is: Clonostachys rosea , and the preservation number is GDMCC No: 65937.
[0009] In one embodiment, the present invention provides a microbial agent, and the microbial agent contains the Gliocladium roseum ( Clonostachys rosea ) MSF05. In some specific embodiments, the active ingredient of the microbial agent may be Gliocladium roseum MSF05 or / and the metabolite of Gliocladium roseum MSF05. Optionally, the microbial agent may be added with surfactants (such as Tween 20, Tween 80, etc.), protectants (such as glycerol, sodium alginate, etc.), stabilizers (such as agar, gelatin, etc.), buffers (such as phosphate buffer), etc.
[0010] In another embodiment, the present invention provides a compound microbial preparation, and the compound microbial preparation contains the Gliocladium roseum ( Clonostachys rosea ) MSF05, and the active ingredient of the compound microbial preparation may also contain other biological components or non-biological components; in one embodiment, the compound microbial preparation is made of two or more non-antagonistic microbial strains.
[0011] In some embodiments, in the microbial agent or compound microbial preparation provided by the present invention, Gliocladium roseum MSF05 and / or the metabolite of Gliocladium roseum MSF05 may exist in the form of cultured live microorganisms, fermentation broth of live microorganisms, filtrate of live microorganism cultures, or a mixture of microorganisms and filtrates.
[0012] In other embodiments, the microbial agent or compound microbial preparation provided by the present invention may be in various dosage forms, such as liquid agents, emulsions, suspensions, powders, granules, wettable powders, or water-dispersible granules, etc.
[0013] In one embodiment, the present invention provides the application of the Gliocladium roseum ( Clonostachys rosea ) MSF05, or the microbial agent, or the compound microbial preparation in promoting the growth of Morchella or preparing a Morchella growth promoter.
[0014] In one embodiment, the present invention provides the application of the Clonostachys rosea f. catenulata ( Clonostachys rosea ) MSF05, or the said microbial agent, or the said compound microbial preparation in repairing the soil with Morchella conica continuous cropping obstacle or in preparing a soil conditioner for repairing the soil with Morchella conica continuous cropping obstacle.
[0015] In a more specific embodiment, the present invention provides a growth promoter for Morchella conica, and the said promoter contains the fermentation culture solution of the Clonostachys rosea f. catenulata ( Clonostachys rosea ) MSF05.
[0016] Furthermore, in the said promoter, the culture medium for fermentation culture is glucose 10 g / L, yeast 2 g / L, peptone 8 g / L, sodium chloride 0.1 g / L, potassium dihydrogen phosphate 0.4 g / L, magnesium sulfate 0.2 g / L and sodium hydroxide 0.24 g / L.
[0017] In one embodiment, the present invention provides a method for culturing Morchella conica strains. During the process of culturing the strains, the said growth promoter for Morchella conica is added. Those skilled in the art can understand that as an edible and medicinal fungus, the process of producing Morchella conica strains includes multiple strain culturing processes such as mother strain propagation culture (primary strain), original strain propagation culture (secondary strain), and cultivated strain propagation culture (tertiary strain). During the propagation culture process, adding a growth promoter can shorten the culture process, reduce the production time cost, and improve the industrial production efficiency. In some specific embodiments, such as the growth promoter culture using the improved YPD medium provided by the present invention and the growth promoter culture of the Morchella conica wheat grain medium provided by the present invention, both have improved the production rate of Morchella conica.
[0018] In one embodiment, the present invention provides a method for cultivating Morchella conica. During the process of covering the soil with Morchella conica, the said growth promoter for Morchella conica is applied. Those skilled in the art know that during the cultivation process of Morchella conica, it is necessary to cover the soil with the strains to complete the processes of mycelial growth, primordium differentiation, and fruiting body formation. In the specific implementation process, adding the growth promoter for Morchella conica provided by the present invention can improve the production efficiency of Morchella conica.
[0019] A method for improving the adaptability of continuous cropping cultivation of Morchella conica, applying the Clonostachys rosea f. catenulata ( Clonostachys rosea ) MSF05, or the said microbial agent, or the said compound microbial preparation to the soil with continuous cropping obstacle. It should be understood that the strain screened by the present invention is a growth-promoting strain obtained based on the differential strain analysis of continuous cropping soil and healthy soil. Based on this, adding the growth-promoting strain lacking in the continuous cropping obstacle soil to repair the continuous cropping obstacle soil can improve the utility of the adaptability of continuous cropping cultivation of Morchella conica.
[0020] The technical effects achieved by the present invention:
[0021] The present invention analyzed the soil samples of Morchella sextelata YMe151 cultivated soil by high-throughput sequencing, and found that the microbial diversity of non-continuous cropping healthy soil was significantly higher than that of continuous cropping soil, and there were obvious differences in the community structure. Based on the idea of reconstructing the soil flora, culturable microorganisms were isolated from the soil where Morchella grew well and there was no continuous cropping disease. Through the plate confrontation experiment with Morchella, multiple target strains that promoted the mycelial growth of Morchella were obtained. The strains with obvious growth promotion effects were screened out, and the growth-promoting bacteria were morphologically observed, physiologically and biochemically determined and molecularly identified as Gliocladium roseum ( Clonostachys rosea ) MSF05. Further, its bacterial liquid was added to plate culture and test tube culture to verify its effect on the growth of Morchella. When 50% concentration of MSF05 bacterial liquid was added, the mycelial growth rate of Morchella in test tube culture reached 22.13 mm / d, and the biomass was as high as 2.407 g, with a significant growth promotion effect.
[0022] As a precious edible and medicinal mushroom, the planting scale of Morchella has been continuously expanding, but the problem of soil continuous cropping has become the main obstacle to fruiting in its soil-covered cultivation. The present invention explored the soil microbial structure of Morchella and screened out the beneficial microorganism Gliocladium roseum ( Clonostachys rosea ) MSF05, which provided technical support for reconstructing the soil microecology, alleviating the continuous cropping obstacle of Morchella and biological control. Description of the Drawings
[0023] Figure 1 Bacterial community structure diagram of non-continuous cropping soil and continuous cropping soil of Morchella at the phylum level;
[0024] Figure 2 Fungal community structure diagram of non-continuous cropping soil and continuous cropping soil of Morchella at the phylum level;
[0025] Figure 3 Co-culture plate diagram of MSF05 and Morchella; on the left side of the plate is the target strain MSF05, and on the right side is Morchella. There is no obvious gap between the mycelia of Morchella and the colonies of the target strain, and the co-culture shows that the strain has a typical growth promotion effect;
[0026] Figure 4 Macroscopic morphological structure diagram (A) and microscopic morphological structure diagram (B) of the growth-promoting strain MSF05 on the plate;
[0027] Figure 5 Growth promotion effect diagram of strain MSF05 on the mycelia of test tube species of Morchella. In the figure, the comparison diagrams of the growth of Morchella under the influence of CK and MSF05 in the bacterial liquid are shown in sequence;
[0028] Figure 6 Growth promotion effect diagram of plate culture and test tube culture with MSF05 bacterial liquid added on the mycelia of Morchella. Detailed Embodiments
[0029] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. When purchasing commodities in the experimental methods, if specific conditions are not specified, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase.
[0030] The pink Sporidesmium sclerotivorum provided by the present invention Clonostachys rosea MSF05, classified name: Clonostachys rosea , with the preservation number GDMCC No: 65937, the preservation unit: Guangdong Provincial Microbial Culture Collection Center, address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou; Institute of Microbiology, Guangdong Academy of Sciences, and the preservation date is February 25, 2025.
[0031] Example 1
[0032] 1. Test materials
[0033] Morchella sextelata YMe151, and the culture medium is shown in Table 1.
[0034] Table 1
[0035] Test media Composition YPD medium Glucose 20 g / L, yeast 2 g / L, peptone 2 g / L, agar 16 g / L Solid modified YPD medium Glucose 10 g / L, yeast 2 g / L, peptone 8 g / L, sodium chloride 0.1 g / L, potassium dihydrogen phosphate 0.4 g / L, magnesium sulfate 0.2 g / L, sodium hydroxide 0.24 g / L, agar 16 g / L Liquid modified YPD medium Glucose 10 g / L, yeast 2 g / L, peptone 8 g / L, sodium chloride 0.1 g / L, potassium dihydrogen phosphate 0.4 g / L, magnesium sulfate 0.2 g / L, sodium hydroxide 0.24 g / L Morchella wheat grain medium Wheat grains 49.5%, buckwheat husks 49.5%, lime 1% Beef extract peptone agar medium Peptone 10 g / L, beef extract powder 3 g / L, sodium chloride 5 g / L, agar 15 g / L Rose bengal medium Peptone 5 g / L, glucose 10 g / L, potassium dihydrogen phosphate 1 g / L, magnesium sulfate 0.5 g / L, agar 15 g / L, rose bengal 0.033 g / L, chloramphenicol 0.1 g / L
[0036] 2. Methods
[0037] Collection of soil samples
[0038] Investigate the continuous cropping obstacle situation of Morchella, select greenhouse cultivation, and the planting soil (dNC) where Morchella grows well and there is no continuous cropping disease. Use the five-point sampling method to collect the mycelium layer soil after the harvest of Morchella as samples, take 0.5 kg at each point, and bring it back to the laboratory at 4 °C in a cold chain. Mix the 5 samples and divide them into 2 equal parts for storage and standby.
[0039] High-throughput Illumina sequencing analysis of soil microorganisms
[0040] Taking the continuous cropping soil of Morchella as the comparison group (dCC), send the dNC and dCC soil samples to Shanghai Personal Biotechnology Co., Ltd. within 24 hours. Use the MP FastDNA® Spin Kit for Soil kit (MP Biomedical, USA) to extract the DNA in the soil samples. Using the diluted genomic DNA as a template, use specific primers with Barcodes for PCR amplification. The amplified products are cloned and sequenced on the Illumina platform. Through splicing (FLASH software), filtering (Vsearch software), and OTUs clustering, species annotation and abundance analysis are carried out to reveal the species composition of bacteria and fungi in the samples.
[0041] Isolation of culturable soil microorganisms
[0042] For bacterial culture, nutrient agar medium is used, and for fungal culture, Rose Bengal medium is selected. Take 1 g of soil sample, dilute it in gradient with sterile water, and then take 0.1 mL of the dilution solutions of 10 -3 、10 -4 、10 -5 respectively, set three replicates, and evenly spread them on the surface of the medium. Invert the culture dishes and place them in a constant temperature incubator at 37 °C for bacterial culture, while fungi are cultured at 28 °C. After 24 hours of bacterial culture, observe the formation of single colonies; fungal culture takes 3 to 5 days.
[0043] Compare the control group CK with the experimental group T in the experimental design. Further pick the dominant single colonies on the gradient plates of the T samples and streak them for pure culture to isolate and purify the dominant bacteria.
[0044] Screening of growth-promoting strains for Morchella
[0045] Using the Morchella sextelata strain YMe151 as the indicator bacterium, the growth-promoting experiments of the isolated bacterial and fungal strains are carried out by the plate confrontation culture method and co-culture to screen the potentially beneficial bacteria in the Morchella soil. Use a punch with a pore diameter of 6 mm to take the well-grown Morchella mycelium blocks after activation and inoculate them on one side of the modified YPD plate. In the treatment group, streak and inoculate the dominant strains that have been activated for 24 hours on the other side of the Morchella mycelium blocks; while the control group does not inoculate the dominant strains. Set three replicates. Continue to culture at a constant temperature of 24 °C and observe.
[0046] Identification of growth-promoting strains
[0047] Inoculate the screened growth-promoting strains on the corresponding fungal or bacterial media, and use the streak plate method to isolate single colonies. After the culture is completed, observe the size, color, surface characteristics, edge shape, etc. of the colonies to preliminarily determine the strain type. For the target fungi: directly observe the morphology of the dominant fungal colonies after culture, and stain them with Congo red dye solution, and observe the individual morphology and staining conditions of the growth-promoting strains under a 100× oil immersion microscope.
[0048] Molecular biology identification: After each strain is purified, genomic DNA is extracted from fungi and bacteria using kits respectively, and amplified using the fungal universal primers ITS1 / ITS4 and the bacterial 16S rDNA universal primer pair. The synthesis of PCR primers and the sequencing of amplification products are completed by Tsingke Biotechnology (Kunming). The sequences are bidirectionally sequenced and spliced, compared on NCBI, and the maximum similar sequences are selected to construct a phylogenetic tree. Use Clustalx for multiple sequence alignment, and import the results into MEGA 6.0 software for cluster analysis and construct a phylogenetic tree diagram to determine their species.
[0049] Addition of growth-promoting bacterial liquid and flat-plate culture experiment of Morchella
[0050] The strain MSF05, which has a growth-promoting effect on the mycelial growth of Morchella, screened by the plate confrontation experiment, was fermented and cultured in a liquid YPD medium (the formula removed agar): at a temperature of 28 °C and a rotation speed of 150 r / min. After 3 days of culture, the concentration of the bacterial liquid was measured by an ultraviolet spectrophotometer to reach 3.0×10 5 CFU; after the bacterial liquid was filtered through a sterile gauze and collected by a 0.22 μm sterile filter, the filtered bacterial liquid was added and formulated into a solid modified YPD medium at 5 concentration levels: no filtrate (0%), 10%, 20%, 30%, 50%, with 3 replicates for each concentration, and 0% as the control (CK). In the center of the prepared 9 cm solid medium, a mycelial block of Morchella was inoculated with a puncher with a diameter of 6 mm for culture. Starting from the 2nd day, the colony diameter was measured by the cross-streaking method every day for 7 consecutive days to obtain the daily average growth rate (mm / d) of the mycelium. On the 9th day, the weight of the mycelium was weighed, and the dry weight of the mycelial biomass of Morchella was calculated to determine the effect of the dominant bacteria on the mycelial growth of Morchella.
[0051] Growth-promoting effect of strong growth-promoting strains
[0052] The strain MSF05 was fermented and cultured in a liquid modified YPD medium at a temperature of 28 °C and a rotation speed of 150 r / min. After 3 days of culture, the concentration of the bacterial liquid was measured by an ultraviolet spectrophotometer to reach 3.0×10 5 CFU for standby. A mycelial block of Morchella was inoculated into a test tube of Morchella wheat grain medium prepared by sterilization with a sterilized puncher with a diameter of 6 mm. At the same time, the growth-promoting bacterial liquid was inoculated at 5 concentration levels: sterile liquid (0%), 10%, 20%, 30%, 50%, and the water content was supplemented. Each concentration of the growth-promoting strain was set with 3 replicates, and the growth of Morchella mycelium in the test tube was observed under room temperature conditions. The length of the mycelial layer was measured at 3-4 days, and the growth rate (mm / d) of Morchella mycelium was calculated.
[0053] Results
[0054] Analysis of soil microbial diversity in Morchella planting soil and continuous cropping soil
[0055] Such as Figure 1 、 Figure 2 , taking the continuous cropping soil of Morchella as the comparison group (dCC), the microbial community composition characteristics of the healthy soil (dNC) of non-continuous cropping soil of Morchella were analyzed. The results showed that the microbial diversity of non-continuous cropping soil was higher than that of continuous cropping soil, and the community structure was significantly different.
[0056] For bacteria, at the phylum level, the relative abundances of Chloroflexi, Acidobacteriota, and Bacteroidota in non - continuous cropping soil were significantly higher than those in continuous cropping soil, and they were the dominant species in non - continuous cropping healthy soil. The relative abundances of Actinobacteriota and Cyanobacteria were higher in continuous cropping soil. This indicates that Chloroflexi, Acidobacteriota, and Bacteroidota may be related to the normal growth of Morchella, and it is expected to screen probiotics for Morchella in healthy non - continuous cropping soil.
[0057] For fungi, the relative abundances of Ascomycota and Mortierellomycota in continuous cropping soil were higher than those in non - continuous cropping soil, while the relative abundances of Basidiomycota and Rozellomycota were significantly lower than those in non - continuous cropping soil.
[0058] Screening of beneficial microorganisms for Morchella
[0059] Isolation of culturable dominant microorganisms in soil: Comparing the control group dCC and the experimental group dNC in the experimental design, picking dominant single colonies on the gradient plates of dNC samples for streak pure culture. After preliminary isolation and purification, multiple dominant microorganisms in the Morchella mycelium - based soil were obtained.
[0060] Plate confrontation test of dominant strains and Morchella: Culturing multiple soil dominant strains and Morchella on improved YPD medium for 2 - 7 days respectively, comparing the mycelial growth of Morchella in the control group and the treatment group, comparing the mycelial growth rate and growth rate of Morchella. The effects of different dominant strains on the mycelial growth of Morchella were different, with both promoting and inhibiting effects. The MSF05 strain showed a promoting effect on the mycelial growth of Morchella ( Figure 3 ) There was no obvious gap between the mycelium of Morchella and the colony of the target strain MSF05, and the co - culture showed that the strain had a typical growth - promoting effect.
[0061] Species identification of the microorganism strain MSF05 with a growth - promoting effect on Morchella
[0062] Figure 4 It can be seen that the isolated and screened MSF05 strain grows slowly on YPD medium, the mycelium is villous, light white, the colony is large, and there is a tendency to expand outwards; the mycelium is thick, aseptate, and there are a large number of spores. The morphological structure belongs to Ascomycota, Helicascales, Clonostachys, Bionectriaceae, Gliocladium roseum Clonostachys roseaBasically similar. The size of the ITS amplified sequence fragment of the MSF05 strain is 574 bp, and the sequence is shown in SEQ ID No. 1. Combining the morphological characteristics of the MSF05 strain and the ITS sequence alignment results, the MSF05 strain isolated in the present invention was identified as a growth-promoting fungus of Morchella, belonging to the genus Clonostachys rosea, and the taxonomic name is: Clonostachys rosea , after preservation, the preservation number is GDMCC No: 65937.
[0063] ITS amplified sequence of the MSF05 strain (SEQ ID No. 1):
[0064] GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA
[0065] TTACAGTAGTCATCCGGGTTGCCGCAAGGCCTCCCGGGTAACCTACCACC
[0066] CTTTGTTTATTACACTTTGTTGCTTTGGCAGGCCTGCCCTCGGGCTGCTG
[0067] GCTCCGGCCGGCGAGCGCCTGCCAGAGGACCTAAACTCTGTTTGTCTATA
[0068] TTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGG
[0069] TTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTG
[0070] CAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGT
[0071] ATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACAACCCTCAAGCTCAGC
[0072] TTGGTGTTGGGCCCCGCCGCCCCGGCGGGCCCTAAAGTCAGTGGCGGTGC
[0073] CGTCCGGCTCCGAGCGTAGTAATTCTTCTCGCTCTGGAGGTCCGGTCGTG
[0074] TGCTCGCCAGCAACCCCCAATTTTTTTCAGGTTGACCTCGGATCAGGTAG
[0075] GGATACCCGCTGAACTTAAGCATA
[0076] Analysis of the growth-promoting effect of the growth-promoting strain MSF05
[0077] The bacterial solution of MSF05 was added to the test tubes of the Morchella mcllvaineana wheat grain medium, and Morchella mcllvaineana fungal blocks were inoculated for culture ( Figure 5 ). After 4 days of culture, in the wheat grain test tube culture experiment with the addition of the MSF05 bacterial solution, the growth rate of Morchella mcllvaineana mycelium was 14.31 mm / d compared with that of CK ( Figure 6 ). The effect of the growth rate of Morchella mcllvaineana mycelium was not clear at low concentrations of the MSF05 bacterial solution, but the growth rate showed a curve growth with the increase of the concentration. Among them, the highest growth rate of the mycelium was 22.13 mm / d at 50% of MSF05, and the growth-promoting effect was obvious.
[0078] The results of the plate experiment with the addition of the bacterial filtrate of the MSF05 strain showed that ( Figure 6 ): The growth rate of Morchella mcllvaineana mycelium was the highest at 20% of its concentration, reaching 30.33 mm / d. With the increase of the bacterial solution concentration, the growth rate decreased slightly, but the growth-promoting effect was compared with that of CK; for the change of the biomass of Morchella mcllvaineana mycelium, although the biomass decreased slightly at the low concentration of 10%, the biomass showed a curve growth with the increase of the concentration, and the biomass increased at the 50% bacterial solution concentration level, reaching 2.407 g.
[0079] Through the plate culture and test tube culture with the addition of the growth-promoting bacterial solution, the comprehensive verification result was that the growth-promoting effect of the MSF05 strain was significant, and the addition concentration of 30% - 50% was the appropriate concentration of the growth-promoting bacterial solution.
[0080] In recent years, with the rapid growth of the consumption demand for Morchella mcllvaineana, the production scale of Morchella mcllvaineana has gradually increased, and continuous cropping obstacle has become a major problem. One of the important reasons for the occurrence of continuous cropping obstacle is the change of the soil microbial structure. In this invention, high-throughput sequencing analysis was used to find that the microbial diversity of non-continuous cropping soil was significantly higher than that of continuous cropping soil, and there were obvious differences in the community structure. Therefore, culturable microorganisms were isolated from non-continuous cropping soil, and beneficial bacteria for Morchella mcllvaineana planting soil were screened based on the theory of soil microbial flora restoration. By screening a variety of soil microorganisms from Morchella mcllvaineana cultivation soil, and then through confrontation with Morchella mcllvaineana, target strains with promoting effects were screened out. Their bacterial solutions were added to the Morchella mcllvaineana plate medium for co-culture, and morphological observation, physiological and biochemical determination and molecular identification were carried out on the screened growth-promoting bacteria. Through the test tube addition of the target bacterial solution culture experiment, multiple verifications were carried out and finally Clonostachys roseaMSF05 (Gliocladium roseum) has a strong growth-promoting effect on the growth of Morchella hyphae. After testing, when the concentration of MSF05 bacterial liquid is 50%, the growth rate of Morchella hyphae cultured in test tubes reaches 22.13 mm / d, and the biomass is as high as 2.407 g. The growth-promoting effect is significant. This strain can be used for promoting the growth of Morchella hyphae at all stages of industrial production, and adding growth-promoting strains lacking differences to the soil with continuous cropping obstacles of Morchella to repair the soil with continuous cropping obstacles, so as to improve the adaptability of continuous cropping cultivation of Morchella.
[0081] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A Clonostachys rosea f. catenulata ( Clonostachys rosea ), MSF05, characterized in that Classification name: Clonostachys rosea , with the preservation number GDMCC No: 65937.
2. A bacterial agent, characterized in that, The microbial agent contains Gliocladium roseum ( Clonostachys rosea ) MSF05 as described in claim 1.
3. A compound microbial agent, characterized in that, The composite microbial agent contains Gliocladium roseum ( Clonostachys rosea ) MSF05 as described in claim 1.
4. Use of the Clonostachys rosea f. catenulata ( Clonostachys rosea ) MSF05 described in claim 1, or the microbial agent described in claim 2, or the compound microbial agent described in claim 3 in promoting the mycelial growth of Morchella esculenta or in preparing a promoter for promoting the mycelial growth of Morchella esculenta.
5. A Morchella hypha growth promoter, characterized in that, The promoter contains the fermentation culture solution of Clonostachys rosea Clonostachys rosea MSF05 described in claim 1.
6. The accelerator according to claim 5, characterized in that, The culture medium for fermentation culture is glucose 10 g / L, yeast 2 g / L, peptone 8 g / L, sodium chloride 0.1 g / L, potassium dihydrogen phosphate 0.4 g / L, magnesium sulfate 0.2 g / L, and sodium hydroxide 0.24 g / L.
7. A method for cultivating Morchella spp., characterized in that: During the cultivation of the strain, the morel mycelium growth promoter described in claim 5 or 6 is added.
8. A method for cultivating Morchella esculenta, characterized in that, During the process of covering the soil for morel cultivation, the morel mycelium growth promoter described in claim 5 or 6 is applied.
Citation Information
Patent Citations
Morchella growth-promoting strain bacillus MSB09
CN120118808A