Construction method and application of spontaneous dyslipidemia gene mouse model
Through the dual gRNA strategy targeting the CYP2S1 gene and the Cas9 protein for gene editing, a mouse model of CYP2S1 gene knockout was constructed, which solved the problem of the existing hyperlipidemia model affecting other organ functions, and provided a stable mouse model of spontaneous lipid disorder genes for studying drug development and treatment of hyperlipidemia.
Patent Information
- Application Number
- CN202510143180.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-10
- Publication Date
- 2025-06-10
AI Technical Summary
Existing hyperlipidemia models in mice may affect the function of other organs, leading to body disorders, and lack of stable hyperlipidemia mouse models for studying drug development and treatment of hyperlipidemia.
By designing a dual gRNA strategy targeting the CYP2S1 gene, using Cas9 protein for gene editing, a mouse model of CYP2S1 gene knockout is constructed to ensure that spontaneous lipid disorders can be stably simulated.
The constructed mouse model of spontaneous lipid disorders can effectively simulate lipid disorders, providing a stable animal model for studying the pathogenesis of lipid disorders and developing lipid-lowering drugs.
Smart Images

Figure BDA0005265544150000061 
Figure BDA0005265544150000071 
Figure BDA0005265544150000072
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for constructing and applying a spontaneous hyperlipidemia gene mouse model. Background Art
[0002] With the rapid development of the modern social economy, the significant improvement of people's living standards, and the great changes in lifestyles, more and more patients are troubled by hyperlipidemia. There is great work pressure, improper diet, a busy state, mental tension, and a lack of sufficient rest and relaxation time. Dietary habits have gradually tended to high-sugar, high-fat, and high-cholesterol foods, such as fried foods, animal offal, dairy products, etc. In addition, the sharp reduction in exercise volume and long-term sedentary behavior have become the norm. Under the combined action of these complex factors, the incidence of hyperlipidemia in the population shows an increasing trend year by year, and more and more patients are troubled by this disease, bringing many negative impacts to their own health and family life.
[0003] Cytochrome P450 enzymes were discovered in the early 1960s and belong to the hemoglobin-like enzymes. It is a large enzyme superfamily composed of many isozymes and subtypes. CYP450 is mainly bound to the endoplasmic reticulum of cells in the form of membrane proteins in organisms and participates in the aerobic metabolism of endogenous substances (such as steroid hormones, fatty acids, etc.) and exogenous substances (drugs, carcinogens, etc.). The CYP2 family is the largest and most complex family in the CYPs family, and it has become one of the research hotspots in recent years by participating in the regulation of the functions of a variety of important proteins. CYP2S1 is a monooxygenase belonging to the CYP450 family and mainly maintains the stability of the body by participating in the metabolism of some endogenous or exogenous carcinogens.
[0004] Currently, existing hyperlipidemia model mice include ApoE (apolipoprotein E) gene knockout mice, LDLR (low-density lipoprotein receptor) gene knockout mice, etc., and there are also cases of inducing hyperlipidemia by feeding C57BL / 6J mice with a high-fat diet. However, these mouse models may affect the damage of other organs of their own, resulting in disorders of the body's functions. There is an urgent need for a stable hyperlipidemia mouse model that does not cause damage to other organs of its own to provide a good animal basis for the development and treatment of drugs for hyperlipidemia. Summary of the Invention
[0005] The purpose of the first aspect of the present invention is to provide a nucleic acid product targeting the CYP2S1 gene.
[0006] The purpose of the second aspect of the present invention is to provide a CYP2S1 gene editing system.
[0007] The purpose of the third aspect of the present invention is to provide a recombinant cell.
[0008] The object of the fourth aspect of the present invention is to provide the application of the nucleic acid product targeting the CYP2S1 gene of the first aspect of the present invention, the CYP2S1 gene editing system of the second aspect of the present invention, or the recombinant cell of the third aspect of the present invention in the preparation of a product for knocking out the CYP2S1 gene.
[0009] The object of the fifth aspect of the present invention is to provide a method for constructing a spontaneous dyslipidemia gene animal model.
[0010] The object of the sixth aspect of the present invention is to provide the application of the animal model constructed by the construction method of the fifth aspect of the present invention in the study of dyslipidemia.
[0011] The seventh aspect of the present invention provides the application of the animal model constructed by the construction method of the fourth aspect of the present invention in the screening of anti-dyslipidemia drugs.
[0012] In order to achieve the above object, the technical solution adopted by the present invention is:
[0013] The first aspect of the present invention provides a nucleic acid product targeting the CYP2S1 gene, including a first gRNA and a second gRNA. The nucleotide sequence of the first gRNA is shown in SEQ ID NO: 1-2 and SEQ ID NO: 4; the nucleotide sequence of the second gRNA is shown in SEQ ID NO: 3.
[0014] The present application adopts a dual gRNA strategy to ensure effective knockout of the target gene, thereby preparing an animal model with the knocked-out gene.
[0015] The second aspect of the present invention provides a CYP2S1 gene editing system, including the nucleic acid product of the first aspect of the present invention.
[0016] In some embodiments of the present invention, the CYP2S1 gene editing system further includes a Cas9 protein.
[0017] In some embodiments of the present invention, the Cas protein is selected from Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d, and Cas14, including any recombinant variants thereof, particularly selected from Cas9, including any recombinant variants thereof.
[0018] The third aspect of the present invention provides a recombinant cell, which includes the nucleic acid product targeting the CYP2S1 gene of the first aspect of the present invention or the CYP2S1 gene editing system of the second aspect of the present invention.
[0019] Understandably, by editing the CYP2S1 gene of cells using the CYP2S1 gene editing system, the obtained recombinant cells can transmit the mutant genotype to daughter cells through cell division, and have stability and heritability.
[0020] The fourth aspect of the present invention provides the use of the nucleic acid product targeting the CYP2S1 gene of the first aspect of the present invention, the CYP2S1 gene editing system of the second aspect of the present invention, or the recombinant cells of the third aspect of the present invention in the preparation of a product for knocking out the CYP2S1 gene.
[0021] In some embodiments of the present invention, the product includes a reagent or a kit.
[0022] The fifth aspect of the present invention provides a method for constructing a spontaneous dyslipidemia gene animal model, including the following steps: transferring the CYP2S1 gene editing system of the second aspect of the present invention into the fertilized eggs of a target animal to obtain F0 generation animals; mating the F0 generation animals with wild-type animals to obtain F1 generation animals, that is, obtaining a spontaneous dyslipidemia gene animal model.
[0023] In some embodiments of the present invention, the method of transfer includes microinjection.
[0024] In some embodiments of the present invention, the target animals include common model animals such as mice and rabbits.
[0025] In some embodiments of the present invention, the construction method further includes identifying the genotype of the animal model using primer pairs with nucleic acid sequences as shown in SEQ ID NOs: 5-7.
[0026] In some embodiments of the present invention, the method of identification includes one or more of PCR and Sanger sequencing.
[0027] In some embodiments of the present invention, identifying the genotype of the animal model includes the following steps:
[0028] Extracting genomic DNA from the toes or tails of the animals;
[0029] Using this DNA as a template, performing PCR amplification with primer pairs having nucleic acid sequences as shown in SEQ ID NOs: 5-7 to obtain an amplification product;
[0030] Performing agarose gel electrophoresis on the PCR amplification product or sequencing the amplification product;
[0031] Identifying the genotype of the target animal according to the results of agarose gel electrophoresis or the results of sequencing.
[0032] The genotypes of the animal models are as follows: the CYP2S1 wild-type band is 717 bp, and the CYP2S1 mutant band is 514 bp.
[0033] In some embodiments of the present invention, the PCR amplification program includes pre-denaturation at 95 °C for 2-4 min; denaturation at 94 °C for 10-20 s; annealing at 58-62 °C for 10-20 s; extension at 70-72 °C for 55-60 s, with a total of 32-36 cycles; extension at 70-72 °C for 4-6 min, and preservation at 4 °C.
[0034] In the sixth aspect of the present invention, there is provided the use of the animal model constructed by the construction method of the fourth aspect of the present invention in the study of dyslipidemia.
[0035] In the seventh aspect of the present invention, there is provided the use of the animal model constructed by the construction method of the fourth aspect of the present invention in the screening / development of anti-dyslipidemic drugs.
[0036] The beneficial effects of the present invention are as follows:
[0037] The present invention discloses for the first time that the knockout of the CYP2S1 gene can lead to dyslipidemia (elevated triglycerides) in animals. In response to this phenomenon, specific gRNAs are designed to specifically knockout the CYP2S1 gene, thereby constructing a spontaneous dyslipidemia gene animal model. This model can be used to study the function of the CYP2S1 gene and the molecular mechanism of spontaneous dyslipidemia, providing new references for clinical diagnosis and treatment.
[0038] The present invention provides an ideal animal model for in-depth study of the pathogenesis of dyslipidemia-related diseases. During the breeding process, the environmental conditions and nutritional supply are strictly controlled, and no changes are made to any components of the feed, ensuring the stability and repeatability of the model animals (mice). This enables researchers to more accurately observe and analyze the development process of dyslipidemia in animals and its association with other physiological indicators in subsequent studies.
[0039] In terms of identification, abnormal increases in key blood lipid components such as triglycerides and low-density lipoproteins and abnormal changes in high-density lipoproteins in the serum of the model animals (mice) can be accurately monitored, and these data provide an intuitive and quantitative basis for evaluating the degree of dyslipidemia.
[0040] The successful establishment of this animal model provides an effective screening platform for the development of new lipid-lowering drugs, enabling the rapid evaluation of the efficacy and safety of drugs at the level of live animals and accelerating the R & D process of lipid-lowering drugs. Secondly, this animal model is also of great significance for studying the interaction between factors such as diet and environment and lipid disorders. By conducting different dietary interventions or environmental factor exposure experiments on model animals, the mechanism of action of these factors in the occurrence and development of lipid disorders can be explored in depth, providing theoretical support for the formulation of personalized prevention and treatment strategies for lipid disorders. Brief Description of the Drawings
[0041] Figure 1 It is the identification result of CYP2S1 mouse genotype. According to the mutant band of CYP2S1 mouse being 514bp and the wild-type band being 717bp, the gel electrophoresis result of mouse genotype identification shows that: the mouse numbered in red has a band at 514bp, which is CYP2S1 - / - (mutant / knockout) mouse; the mouse numbered in blue has a band at 514bp and 717bp respectively, which is CYP2S1 + / - (heterozygous) mouse; the mouse numbered in green has a band at 717bp, which is CYP2S1 + / + (wild-type) mouse.
[0042] Figure 2 It is the partial sequencing result of the gene of CYP2S1 gene knockout mouse.
[0043] Figure 3 It is the analysis of the body weight change curve of CYP2S1 knockout mice. For wild-type mice (CYP2S1 + / + ) and mutant mice (CYP2S1 - / - ), the body weights of male and female mice (n = 5) were recorded starting from the 4th week after birth, and the relevant body weight change curves were plotted. The left figure is the body weight change graph of male mice from 4 weeks to 25 weeks, and the right figure is the body weight change graph of female mice from 4 weeks to 25 weeks. Compared with wild-type mice, there is no gender difference in the body weight change of CYP2S1 knockout mice, and there is no difference with time change, indicating that CYP2S1 knockout does not affect the postnatal growth of mice.
[0044] Figure 4 It is the blood lipid analysis of CYP2S1 knockout mice. The serum of 8-week-old mice was taken for blood lipid detection. Compared with wild-type mice, the levels of TG, LDL-C, and HDL-C in CYP2S1 - / - mice were all increased, and there was statistical significance (*p < 0.05, **p < 0.01).
[0045] Figure 5For H&E staining analysis; among them, A is the H&E result diagram of the heart, liver, kidney, and spleen, and B is the H&E result diagram of the lymph node, thymus, lung, and stomach tissues. Detailed implementation mode
[0046] The content of the present invention will be further described in detail below through specific examples.
[0047] It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.
[0048] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.
[0049] The features and properties of the present invention will be further described in detail below in conjunction with the embodiments.
[0050] Exons 2-6 (E2-E6) of the Cyp2s1 gene were knocked out, and the knockout affected the expression of the non-coding gene Gm45226.
[0051] Example 1
[0052] A method for constructing a spontaneous dyslipidemia gene mouse model includes the following steps:
[0053] gRNA (gRNA-A1, gRNA-A2, gRNA-B1, and gRNA-B2, all at a concentration of 1 pmol / μL), Cas9 protein (15 ng / μL, purchased from NEB), were directly microinjected into C57BL / 6J mouse fertilized eggs to produce offspring with targeted knockout of the CYP2S1 gene, that is, F0 generation mice. The F0 generation positive mice (8 weeks old) were mated with wild-type mice (C57BL / 6J) to obtain F1 generation mice, and the F1 generation mice were self-crossed to obtain homozygotes (CYP2S1 gene knockout mice (CYP2S1 - / - ))), that is, the spontaneous dyslipidemia gene model mice were obtained.
[0054] Among them, the sense strand nucleotide sequence of gRNA-A1 is GCGCCCACTCAGCAGAGCGG TGG (SEQ ID NO:1);
[0055] The sense strand nucleotide sequence of gRNA-A2 is TAGAAAACCTTTGCGCTTCC AGG (SEQ ID NO:2);
[0056] The nucleotide sequence of the antisense strand of gRNA-B1 is AAGTCCCGCAGCAAGTAACA CGG (SEQ ID NO:3);
[0057] The nucleotide sequence of the sense strand of gRNA-B2 is ACAGTGCAAGACGTAGTGAG AGG (SEQ ID NO:4).
[0058] The underlined part of the above sequence is the PAM sequence.
[0059] Example 2
[0060] 1. Genotype identification of CYP2S1 gene knockout mice
[0061] Genotype identification of the CYP2S1 gene knockout mice in Example 1 was performed by PCR amplification, agarose gel electrophoresis, and sequencing, as follows:
[0062] 1) Collection of mouse samples
[0063] Wear protective gloves. Hold the mouse's tail with the right hand and rotate it a few times, then place it on the cage. Use the index finger and thumb of the left hand to move along the mouse's tail upwards until firmly grasping the skin of the mouse's head and ears, clamping the back skin of the mouse and the mouse's tail. Then, use a sterilized scissors to cut 1 - 2 cm of the mouse's toe and place it in a 1.5 mL EP tube. Finally, gently place the mouse back into the cage.
[0064] 2) Crude extraction of mouse DNA by alkaline lysis method:
[0065] Use a pipette tip to aspirate 180 μL of DNA lysis buffer A (0.40 g Na 2 EDTA·2H 2 O, 0.074 g NaOH, made up to 1.0 L with ddH 2 O) into the 1.5 mL EP containing the toe. Incubate in a metal bath at 100 °C for one hour. Ensure that the sample is completely immersed in the liquid before loading. After the sample returns to room temperature, add 20 μL of DNA lysis buffer B (18.20 g Tris dissolved in ddH 2 O, adjust the pH to 8.20, made up to 100 mL with ddH 2 O). Mix well and centrifuge to obtain the crude purified DNA of the mouse, which is used for subsequent PCR amplification or stored in a refrigerator at 4 °C for later use.
[0066] 3) Amplification of mouse DNA
[0067] Prepare the PCR amplification reaction system as shown in Table 1 and perform PCR amplification according to Table 2.
[0068] Table 1 PCR Amplification Reaction System
[0069]
[0070]
[0071] The primer nucleotide sequence of CYP2S1-Wild Type in Table 1 is AACTTGCTGATGACGGTCACATA (SEQ ID NO: 5); the primer nucleotide sequence of CYP2S1-Mutant Type is TCTCTAAATAAGAGGGTAGTGGGC (SEQ ID NO: 6); the primer nucleotide sequence of CYP2S1-Common Type is GGTGCTAACTGGGAATGTTACCC (SEQ ID NO: 7).
[0072] Table 2 PCR Amplification Reaction Program
[0073]
[0074] 4) Agarose Gel Electrophoresis Analysis
[0075] Weigh an appropriate amount of agarose and dissolve it in the electrophoresis buffer (usually 1×TAE, 4.84 g Tris, 1.14 mL glacial acetic acid, 1.14 mL 0.5 mol / L EDTA solution, adjust the pH to 8.30 with sodium hydroxide, and make up to 1000 mL with ddH 2 O) in an Erlenmeyer flask. Place it in a microwave oven and heat for 1 - 3 min to fully dissolve. Rinse the flask body with slow running water, cool the solution to about 60 °C, add EB (nucleic acid dye) with a volume of 1‰ of 0.5 mg / mL, gently shake well, and then pour the gel into a specific mold. If there are bubbles, remove them. After the gel solution has fully cooled and solidified for 20 - 30 min, place it in the electrophoresis tank for electrophoresis. Generally, the electrophoresis time is 25 - 30 min (the specific time depends on the actual situation). After electrophoresis, use a GE gel imager to observe the electrophoresis results, automatically expose and take pictures, record the identification results and save the pictures.
[0076] The electrophoresis results are as Figure 1 shown. The genotypes of the mice are as follows: the CYP2S1 wild-type band is 717 bp, and the CYP2S1 mutant-type band is 514 bp. If there is only a 717 bp band in the electrophoresis results and no 514 bp band, it is a CYP2S1 + / + (wild-type) mouse( Figure 1 green number in the middle); if there is only a 514 bp band and no 717 bp band, it is a CYP2S1 - / - (mutant-type) mouse( Figure 1Those with two bands of 514bp and 717bp are CYP2S1 (in red numbers); those with both a 514bp band and a 717bp band are CYP2S1 + / - (heterozygous) mice ( Figure 1 (in blue numbers). By measuring the mice of the spontaneously dyslipidemic gene model constructed in Example 1, there is one band at 514bp, which is CYP2S1 - / - , and further sequencing the PCR-amplified DNA sequence, the results are as Figure 2 shown, indicating that the CYP2S1 knockout mice were successfully constructed.
[0077] 2. Lipid synthesis and metabolism in CYP2S1 gene knockout mice
[0078] The CYP2S1 knockout mice in Example 1 were conventionally raised, and their living habits were recorded and observed. At the same time, wild-type mice were set as the control group. Eight-week-old mice of each group were taken, and their blood lipids were analyzed using a blood lipid kit (detecting lipid-related indicators such as TC, TG, HDL-C, and LDL-C in serum), and the morphological changes of the whole body tissues of the CYP2S1 knockout mice were examined using H&E staining technology. The specific experimental procedures are as follows:
[0079] (1) Detection of lipid-related indicators such as TC, TG, HDL-C, and LDL-C in serum
[0080] 1) Collection of mouse serum samples
[0081] After the mice were anesthetized with ether, blood was collected by orbital enucleation. When collecting blood, gently massage the heart to allow the blood to flow out. The fresh blood was collected in a 1.5 mL EP tube, left to stand at room temperature for 20 min, then centrifuged at 1000 g for 20 min, and the upper pale yellow serum was collected in a new 1.5 mL EP tube and stored in a -80 °C refrigerator.
[0082] 2) Detection of blood lipids
[0083] A blood lipid detection kit from Nanjing Jiancheng Bioengineering Institute was used, and the experimental operations were carried out strictly in accordance with the kit instructions to determine the contents of TG, TC, HDL-C, and LDL-C in the mouse serum, as shown roughly in Tables 3 - 6.
[0084] Table 3 TG reagent operation table
[0085]
[0086] Calculation formula for liquid samples such as serum: C 标准 : Standard concentration, mmol / L.
[0087] Table 4 TC reagent operation table
[0088]
[0089]
[0090] Calculation formula for liquid samples such as serum: C 标准 : Concentration of standard product, mmol / L.
[0091] Table 5 HDL-L reagent operation table
[0092]
[0093] Calculation formula for liquid samples such as serum: C 标准 : Concentration of standard product, mmol / L.
[0094] Table 6 HDL-C reagent operation table
[0095]
[0096] Calculation formula for liquid samples such as serum: (Operation of microplate reader), (Operation of automatic biochemical analyzer), C 标准 : Concentration of standard product, mmol / L.
[0097] (2) Hematoxylin-eosin staining H&E (Hematoxylin&Eosin staining)
[0098] 1) Specimen collection
[0099] After the mice were fully anesthetized with isoflurane, blood was collected by the method of eye enucleation. A part of the blood was collected in a 1.5 mL EP tube. After centrifugation, the upper layer of serum was taken out and stored in an environment of -80 °C for later use.
[0100] After the mice were sacrificed by cervical dislocation, the limbs of the mice were fixed on the dissection board, and the tissues and organs of the mice were taken out according to the experimental requirements and placed in cold PBS. The whole process was controlled within half an hour, otherwise it would affect the subsequent experimental results.
[0101] 2) Fixation
[0102] The collected tissues and organs were drained of water with filter paper and then placed flat in an embedding cassette, and fixed overnight in 4% paraformaldehyde (PFA, 4.00 g paraformaldehyde, NaOH dissolved in ddH 2 O, adjusted to pH = 7.40 with HCl, and made up to 1000 mL with ddH 2 O) for subsequent preparation of paraffin sections.
[0103] 3) After the tissue is fixed, place it in a dehydrator for automatic dehydration treatment, and the program settings are shown in Table 7.
[0104] Table 7 Dehydration treatment program
[0105]
[0106] 4) Embed and trim the tissue
[0107] Preheat the embedding machine in advance to completely melt the high-melting-point solid paraffin. Drop the high-melting-point wax onto the pre-prepared paraffin mold. According to the principle that the largest surface of the tissue faces down, place the tissue in the mold and transfer it to the cooling table to completely solidify, and then remove the metal mold. First, use a blade to trim the excess wax layer around the wax block, and then use a microtome to repair the wax block at a thickness of 10 μm until the maximum tissue area of the exposed part is reached, and then store it in a refrigerator at -20 °C for subsequent formal sectioning operations.
[0108] 5) Tissue sectioning
[0109] Turn on the spreading machine in advance, adjust the temperature to 38 °C - 42 °C, and the baking temperature to 65 °C. Fix the wax block on the microtome and section continuously at a thickness of 3 μm. Place it in water at 37 °C until the tissue is completely unfolded, then pick up the section with a glass slide at a 45° angle. Place the tissue section at 65 °C for 40 min, and the section can be stored in a cool place.
[0110] 6) Dewaxing
[0111] 65 °C oven for 30 min → Xylene I solution for 30 min → Xylene II solution for 25 min;
[0112] 7) Hydration
[0113] Absolute ethanol I solution for 25 min → Absolute ethanol II solution for 20 min → 90% ethanol solution for 15 min → 80% ethanol solution for 10 min → 70% ethanol solution for 5 min.
[0114] 8) Hematoxylin staining
[0115] Place the dewaxed section in the hematoxylin stain and immerse it completely for an appropriate time (1 - 2 min) to stain the cell nuclei, then rinse slowly with running water and blue back for 15 min.
[0116] 9) Eosin staining
[0117] Place the blue-backed paraffin section in the eosin stain to stain the cytoplasm for about 5 - 10 s, and soak it in water to wash off the excess dye (the staining time is determined according to the tissue site and the use of the dye).
[0118] 10) Dehydration and clearing
[0119] 70% ethanol solution for 20 min → 80% ethanol solution for 20 min → 90% ethanol solution for 20 min → anhydrous ethanol I solution for 20 min → anhydrous ethanol II solution for 20 min → xylene I solution for 20 min → xylene II solution for 20 min.
[0120] 11) Seal the slide
[0121] Place the dehydrated and transparent slices in a fume hood to dry, drop an appropriate amount of neutral resin (xylene: neutral resin = 1:1) on the tissue suspension, and then seal the slices with a cover glass to avoid bubbles. After the neutral resin solidifies, place the slices under a white light microscope for observation and filming.
[0122] During the feeding period, the inventors recorded and observed the living habits of the mice. Like normal mice, the knockout mice had normal body weight ( Figure 3 ), well-developed, soft and shiny fur, no hair loss and unkemptness, no skin infection symptoms, intact claws and toes, no ulcers or scabs, normal reproduction and no embryonic lethality, indicating that knocking out CYP2S1 does not affect the growth and development of mice. Next, the blood lipids of CYP2S1 mice were analyzed. The knockout of this gene found that the levels of TG, LDL-C and HDL-C in the blood of mice were significantly increased, and there was a statistical difference (*p<0.05, **p<0.01)( Figure 4 TG, T-CHO, LDL-C and HDL-C are important components of lipid synthesis, suggesting that CYP2S1 is involved in lipid synthesis and metabolism. Next, to verify whether CYP2S1 knockout mice would affect the changes in their own tissue morphology, the inventors took 8-week-old CYP2S1 + / + Mice and CYP2S1 - / - Five mice were killed by cervical dislocation, and then the heart, liver, spleen, lung, kidney, inguinal lymph node, thymus and intestinal tissues of the mice were dissected. There was no significant difference between the organs and the control group by naked eye observation. Subsequently, the tissues were sampled, fixed, dehydrated, embedded, and sliced for H&E staining analysis. Microscopic observation showed that there was no obvious abnormality in the heart structure of the two groups of mice, and the texture structure of the myocardial cells was clear and normal; the liver tissue structure was intact and not damaged, and the structure of the hepatic lobules and hepatic sinusoids was clear and normal; the kidney tissue structure was normal, and the renal units were complete and clear; the red pulp, white pulp and lymph nodule structures in the spleen were clear and normal. The results showed that the lymph node capsule, cortex and medulla structure of the two groups of mice were clear and normal; the cortex and medulla structure of the thymus tissue were normal, without atrophy or fusion; the lung tissue showed that the bronchus and alveolar structures at all levels were intact and normal), that is, there were no obvious histological morphological changes in the heart, liver, spleen, lung, kidney, lymph node, and thymus tissues of the knockout mice ( Figure 5)。It is indicated that the CYP2S1 knockout mice constructed in Example 1 can be used as spontaneous dyslipidemia gene model mice for the research and development of lipid metabolism disorders and the occurrence and development of diseases, providing an animal model for the development and treatment of drugs for hyperlipidemia. This provides an extremely ideal model basis for in-depth study of the specific role of this gene in lipid metabolism disorders and the occurrence and development of diseases, and effectively excludes the confounding factors that may be brought about by the abnormal tissue development affected by gene knockout.
[0123] The embodiments of the present invention have been described in detail above in conjunction with the accompanying drawings. However, the present invention is not limited to the above embodiments. Various changes can be made without departing from the gist of the present invention within the scope of knowledge possessed by those of ordinary skill in the art. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.
Claims
1. A nucleic acid product targeting the CYP2S1 gene, comprising a first gRNA and a second gRNA, wherein the nucleotide sequence of the first gRNA is shown in SEQ ID NOs: 1 to 2 and SEQ ID NO: 4; the nucleotide sequence of the second gRNA is shown in SEQ ID NO:
3.
2. A CYP2S1 gene editing system, comprising the nucleic acid product according to claim 1.
3. The CYP2S1 gene editing system according to claim 2, characterized in that The CYP2S1 gene editing system also includes Cas9 protein.
4. The CYP2S1 gene editing system according to claim 3, characterized in that The Cas protein is selected from at least one of Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d and Cas14.
5. A recombinant cell, characterized in that The recombinant cell comprises the nucleic acid product targeting the CYP2S1 gene according to claim 1 or the CYP2S1 gene editing system according to any one of claims 2 to 4.
6. Use of the nucleic acid product targeting the CYP2S1 gene according to claim 1, the CYP2S1 gene editing system according to any one of claims 2 to 4, or the recombinant cell according to claim 5 in the preparation of a product for knocking out the CYP2S1 gene.
7. A method for constructing a spontaneous dyslipidemia gene animal model, comprising the following steps: The CYP2S1 gene editing system described in any one of claims 2 to 4 is transferred into the fertilized eggs of the target animal to obtain F0 generation animals; the F0 generation animals are mated with wild-type animals to obtain F1 generation animals, that is, a spontaneous dyslipidemia gene animal model is obtained.
8. The construction method according to claim 7, characterized in that: The method of introduction includes microinjection.
9. The construction method according to claim 7, characterized in that: The construction method further comprises using a primer pair with nucleic acid sequences such as those shown in SEQ ID NOs: 5 to 7 to identify the genotype of the animal model.
10. Use of the animal model constructed by the construction method according to any one of claims 7 to 9 in the study of dyslipidemia.