Plasmid system for traceless gene editing and drug-resistant plasmid removal in enterobacteriaceae bacteria and application of plasmid system
By using pGGTOX and pCP-oriT plasmids in Enterobacteriaceae bacteria to combine homologous recombination principles, the problem of insufficient efficiency and accuracy of existing gene editing technology is solved, and efficient and accurate gene editing and drug-resistant plasmid removal is achieved.
Patent Information
- Application Number
- CN202510374856.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-27
- Publication Date
- 2025-06-10
AI Technical Summary
Existing gene editing technologies such as CRISPR/Cas9 have non-specific shearing problems, which affects the efficiency and accuracy of editing. At the same time, the tool construction is cumbersome and time-consuming, and lacks high-efficiency, high-accuracy and multi-functional gene editing tools.
A plasmid system for Enterobacteriaceae bacteria is provided, comprising a pGGTOX plasmid and a pCP-oriT plasmid. The pGGTOX plasmid achieves traceless gene editing through the MqsR toxin gene and R6K replicon, and the pCP-oriT plasmid achieves traceless knockout through FLP recombinase, combining the principle of homologous recombination to achieve efficient and accurate gene editing and drug-resistant plasmid removal.
It has achieved efficient and accurate gene editing and removal of drug-resistant plasmids in Enterobacteriaceae bacteria, simplified the tool construction process, significantly improved the efficiency of gene editing, and reduced the risk of drug-resistant plasmid production and transmission.
Smart Images

Figure CN120118931A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering, and specifically relates to a plasmid system for scarless gene editing and drug-resistant plasmid elimination in Enterobacteriaceae bacteria. Background Art
[0002] Homologous recombination is an important genetic phenomenon in organisms, which depends on the homology of DNA sequences. Inside cells, when there are DNA fragments with similar sequences, they can undergo exchange and recombination through the action of a series of enzymes. This naturally occurring process provides a theoretical basis for gene editing using homologous recombination. By designing DNA fragments containing homologous sequences on both sides of the target gene and introducing them into cells, the homologous recombination mechanism inside the cells can be guided to precisely modify the target gene, such as knocking out, replacing, or inserting specific gene sequences.
[0003] With the continuous in-depth research on life sciences, precise gene editing technologies have become increasingly important. In the fields of medicine, agriculture, biotechnology, etc., people need to modify specific genes to study their functions, treat diseases, improve crop varieties, etc. Gene editing using homologous recombination can achieve highly precise manipulation of genes, avoiding the uncertainties brought by some random insertion or mutation methods.
[0004] The spread of bacterial drug resistance poses a huge threat to public health. The transfer of drug-resistant plasmids between bacteria is one of the main ways for the spread of drug resistance. By knocking out drug-resistant plasmids, the generation and spread of drug-resistant bacteria can be effectively reduced. Using the principle of homologous recombination, homologous recombination fragments targeting specific regions on drug-resistant plasmids can be designed to guide the recombination mechanism inside the cells to remove key genes or sequences on the drug-resistant plasmids, thereby achieving the knockout of drug-resistant plasmids.
[0005] The continuous progress of molecular biology techniques, such as gene cloning, vector construction, nuclease techniques, etc., provides technical support for constructing tool plasmids based on homologous recombination. Researchers can use these technical means to integrate the elements required for homologous recombination, such as homologous arms, selection markers, etc., into plasmid vectors to construct tool plasmids that can efficiently perform gene editing and drug-resistant plasmid knockout inside cells. At the same time, various advanced gene manipulation techniques, such as electroporation, chemical transformation, etc., also make it easier and more efficient to introduce tool plasmids into cells. Invention Content.
[0006] At present, the CRISPR / Cas9 system is widely used in the field of gene editing. However, the CRISPR / Cas9 technology has the problem of non-specific cleavage, that is, it may cleave at sites other than the target site, resulting in off-target effects. This will affect the efficiency and accuracy of editing. And the tool construction in the application process of the CRISPR / Cas9 system is relatively cumbersome and time-consuming. Therefore, there is an urgent need for a gene editing tool with high efficiency, high accuracy and multi-function in the field of gene editing. Summary of the Invention
[0007] To solve the problems in the prior art, the present invention provides a plasmid system for scarless gene editing and drug-resistant plasmid clearance in Enterobacteriaceae bacteria and its application.
[0008] To achieve the above object of the present invention, the present invention provides the following technical solutions:
[0009] In the first aspect, the present invention provides a plasmid system for scarless gene editing and drug-resistant plasmid clearance in Enterobacteriaceae bacteria, which comprises a pGGTOX plasmid with gene editing and plasmid clearance functions and a pCP-oriT plasmid with resistance gene elimination functions. Among them, the pGGTOX contains: the MqsR gene, the R6K replicon, the rhaS gene, the SFGFP gene and the Apr gene connected in sequence; the pCP-oriT contains: the FLIP gene, the λ-repressor gene, the CmR gene, the Rep101 gene, the Hyg gene and the oriT gene connected in sequence.
[0010] Further, the Enterobacteriaceae bacteria include one or more of the genera Escherichia, Salmonella, Shigella, Klebsiella, Serratia, Yersinia, Proteus. Preferably, the Enterobacteriaceae bacteria include the genera Escherichia and Klebsiella.
[0011] In the second aspect, the present invention provides a construction method of the above plasmid system, which includes the following steps:
[0012] Construct the pGGTOX plasmid: Amplify the R6K gene, the Apr gene, the MqsR gene, the rhaS gene and the SFGFP gene respectively to obtain the target gene fragments; Use the pGGAselsct plasmid as a template, and amplify with primers pGGE1 and pGGE2. Phosphorylate the amplified large gene fragment and then circularize it with T4 enzyme to obtain the pGGA plasmid; Insert the Apr gene into the pGGA plasmid to obtain the pGGB plasmid, and amplify the Apr gene with primers containing restriction sites on both sides; Connect the R6K gene, the Apr gene with restriction sites on both sides, the MqsR gene, the rhaS gene and the SFGFP gene fragments by a one-step method to obtain the pGGTOX plasmid;
[0013] Construction of pCP-oriT plasmid: The FLIP gene, λ-repressor gene, CmR gene, Rep101 gene, Hyg gene and oriT gene were amplified respectively to obtain the target gene fragments; the FLIP gene, λ-repressor gene, CmR gene, Rep101 gene, Hyg gene and oriT gene were ligated into a ring by seamless cloning technology to obtain the pCP-oriT plasmid.
[0014] Furthermore, in the step of constructing the pGGTOX plasmid, two pairs of BsmBⅠ and BsaI restriction enzyme sites were introduced on both sides of the Apr gene.
[0015] In the third aspect of the present invention, a method for gene knockout in Enterobacteriaceae bacteria is provided. The plasmid system described in the claims is used for gene knockout, including the following steps:
[0016] Determine the gene fragment to be knocked out in Enterobacteriaceae bacteria, and amplify the homologous arm gene fragments on both sides of the gene to be knocked out by designing primers; insert the homologous arm gene fragments on both sides into the pGGTOX plasmid by a one-step method and transform them into the vector bacterium WM3064 as the donor bacterium, and use Enterobacteriaceae bacteria as the recipient bacterium; conduct conjugation transfer between the donor bacterium and the recipient bacterium, and use the principle of homologous recombination to knock out the gene fragment to be knocked out to obtain a recombinant strain; use WM3064 transformed with the pCP-oriT plasmid as the donor bacterium and the above recombinant strain as the recipient bacterium for conjugation transfer, eliminate the resistance gene fragment in the middle of the homologous arm gene, and remove the pCP-oriT plasmid by increasing the culture temperature.
[0017] In the fourth aspect of the present invention, a method for clearing drug-resistant plasmids in Enterobacteriaceae bacteria is provided. The above plasmid system clears drug-resistant plasmids in Enterobacteriaceae bacteria, including the following steps:
[0018] Determine the plasmid to be knocked out in Enterobacteriaceae bacteria, and amplify the gene sequences in the plasmid to be knocked out by designing primers to obtain the homologous arm gene fragments on both sides; insert the homologous arm gene fragments on both sides into the pGGTOX plasmid by a one-step method and transform them into the vector bacterium WM3064 as the donor bacterium, and use Enterobacteriaceae bacteria as the recipient bacterium; conduct conjugation transfer between the donor bacterium and the recipient bacterium, and use the principle of homologous recombination to fuse the pGGTOX plasmid with the plasmid to be knocked out to obtain a recombinant strain, and induce the expression of the MqsR toxin gene by rhamnose to clear the fusion plasmid, thereby clearing the drug-resistant plasmid.
[0019] In the fifth aspect of the present invention, there is provided an application of the above plasmid system in gene editing and drug-resistant plasmid elimination in Enterobacteriaceae bacteria, which includes one or more of Escherichia, Salmonella, Shigella, Klebsiella, Serratia, Yersinia, Proteus, and preferably, the Enterobacteriaceae includes Escherichia and Klebsiella.
[0020] The beneficial effects of the technical solution of the present invention are mainly reflected in:
[0021] The present invention uses the source recombination technology to eliminate the drug-resistant genes and drug-resistant plasmids in the plasmids carried by bacteria. First, homologous arm sequences flanking the drug-resistant genes are screened, which not only ensures the high specificity of homologous recombination of the two tool plasmids pGGTOX and pCP-oriT, but also has no impact on the host genes. Secondly, the constructed pGGTOX plasmid carries a green fluorescent protein, which shows green under a fluorescence microscope, and can quickly identify whether the pGGTOX plasmid has entered the target strain, saving time for the screening of the target strain. And in the whole process of homologous recombination, it only takes 3 days at the shortest from the wild strain to the knockout of the target gene and drug-resistant plasmid, greatly improving the gene editing efficiency and providing a new tool for the elimination of antibiotic resistance in the future. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] The accompanying drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments and descriptions thereof of the present invention are used to explain the present invention and do not constitute an improper limitation to the present invention.
[0023] Figure 1 It is a schematic diagram of the successfully constructed pGGTOX plasmid in the embodiment of the present invention;
[0024] Figure 2 It is a schematic diagram of the successfully constructed pCP-oriT plasmid in the embodiment of the present invention;
[0025] Figure 3 It is a working diagram of pGGTOX in the embodiment of the present invention;
[0026] Figure 4 It is a schematic diagram of the implementation scheme of pGGTOX in the embodiment of the present invention;
[0027] Figure 5 It is an electrophoresis diagram of the four fragment interfaces after the plasmid is successfully constructed in the embodiment of the present invention;
[0028] Figure 6 It is a successful knockout DAP phenotype diagram and an electrophoresis diagram on both sides of the homologous arm in the embodiment of the present invention, where A is the successful knockout DAP phenotype diagram and B is the electrophoresis diagram on both sides of the homologous arm;
[0029] Figure 7Electrophoresis diagram of successfully knocking out the mrk plasmid in the embodiments of the present invention;
[0030] Figure 8 Electrophoresis diagram of successfully knocking out the TA gene sequence in the embodiments of the present invention;
[0031] Figure 9 Phenotype diagram of successfully knocking out the Apr resistance gene in the embodiments of the present invention. Detailed implementation manners
[0032] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs.
[0033] It should be noted that the terms used herein are only for describing specific implementation manners and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. It should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for describing specific embodiments and not for limiting the protection scope of the present invention.
[0034] In a specific implementation manner of the present invention, a plasmid system for scarless gene editing and drug-resistant plasmid clearance in Enterobacteriaceae bacteria is provided, which consists of a pGGTOX plasmid with gene editing and plasmid clearance functions and a pCP-oriT plasmid with the function of eliminating resistance genes.
[0035] The pGGTOX contains: the MqsR gene, the R6K replicon, the rhaS gene, the SFGFP gene, and the Apr gene connected in sequence.
[0036] Specifically, the pGGTOX plasmid uses the MqsR toxin gene as a counter-selection marker, which does not exist in most Enterobacteriaceae bacteria and can be used as a counter-selection marker for Enterobacteriaceae bacteria under the regulation of the rhamnose promoter.
[0037] The replicon of the pGGTOX plasmid is R6K, which can replicate in the WM3064 recipient bacterium with the help of the replication protein provided by the pir gene. However, it cannot replicate in Enterobacteriaceae bacteria and must rely on the pir gene to provide replication-related proteins, while the recipient bacterium does not contain the pir gene. Therefore, strains with homologous recombination can be successfully screened.
[0038] The pGGTOX plasmid contains the SFGFP gene. The vector strain carrying the pGGTOX plasmid can be observed with green fluorescence under a fluorescence microscope, which can facilitate the identification of positive clones.
[0039] Two pairs of BsmBⅠ and BsaI restriction enzyme sites are also introduced into the pGGTOX plasmid. After digestion, different sticky ends are generated, which is convenient for constructing a tool plasmid containing homologous arms on both sides by one-step method.
[0040] Introducing apramycin resistance into the pGGTOX plasmid is convenient for gene editing of clinical isolated strains and is more conducive to the screening of strains with successful homologous recombination.
[0041] In this invention, the mqsR gene, R6K replicon, rhaS gene, SFGFP gene and Apr gene are combined for the first time to construct the pGGTOX plasmid. Through experimental verification, this plasmid can only grow in the WM3064 donor bacterium, can be introduced into the recipient bacterium to perform the function of gene editing, but cannot stably exist in the recipient bacterium. Therefore, the purpose of scarless gene editing can be achieved.
[0042] The pCP-oriT contains: the FLIP gene, λ-repressor gene, CmR gene, Rep101 gene, Hyg gene and oriT gene connected in sequence.
[0043] Specifically, pCP-oriT has a temperature-sensitive replicon, which can replicate normally at 30 °C and will be automatically lost when the temperature is higher than 37 °C, facilitating the self-elimination of the plasmid after work.
[0044] The pCP-oriT plasmid contains the DNA recombinase gene of yeast - FLP recombinase, which can eliminate the scar left by gene knockout, complement the gene elimination of the pGGTOX plasmid, and constitute a set of scarless gene knockout systems.
[0045] The FLP recombinase of the pCP-oriT plasmid recognizes the FRT site and deletes the FRT-flanked resistance gene to achieve scarless knockout.
[0046] The pCP-oriT plasmid carries the resistance genes of hygromycin and chloramphenicol, and these two resistances are more conducive to the screening of conjugants after conjugation transfer with the target strain.
[0047] At the same time, the pGGTOX plasmid can only grow in the WM3064 donor bacterium and is a suicide plasmid in the recipient bacterium. The pCP-oriT plasmid can replicate normally in the host strain and has the same growth curve as the wild type.
[0048] Further, the Enterobacteriaceae bacteria include one or more of the genera Escherichia, Salmonella, Shigella, Klebsiella, Serratia, Yersinia, and Proteus. Preferably, the Enterobacteriaceae bacteria include the genera Escherichia and Klebsiella.
[0049] In another specific embodiment of the present invention, a method for constructing the above plasmid system is provided, comprising the following steps:
[0050] Construct pGGTOX plasmid: Amplify the R6K gene, Apr gene, MqsR gene, rhaS gene, and SFGFP gene respectively to obtain the target gene fragments; Use the pGGAselsct plasmid as a template, amplify using primers, phosphorylate the amplified large gene fragment and then circularize it with T4 enzyme to obtain the pGGA plasmid; Insert the Apr gene into the pGGA plasmid to obtain the pGGB plasmid, and amplify the Apr gene with primers containing restriction sites on both sides; Connect the R6K gene, the Apr gene with restriction sites on both sides, the MqsR gene, the rhaS gene, and the SFGFP gene fragments by a one-step method to obtain the pGGTOX plasmid;
[0051] Specifically, it includes the following steps:
[0052] 1. Preparation before constructing the pGGTOX tool plasmid
[0053] First, we modified the pGGAselect plasmid (this tool plasmid was purchased from New England Biolabs, UK). There are multiple type II restriction enzyme sites on this plasmid, including (BsmB I, Bsa I, etc.). Secondly, we used the pSZU941-GFP plasmid as a template and amplified the gene sequences containing R6K and Apr resistance in this plasmid by PCR. The pSZU941-GFP plasmid was constructed by total gene synthesis in our laboratory in the previous stage, and its nucleotide sequence is shown in SEQ ID NO.1. Finally, we used the pTOX8-GFP plasmid with green fluorescence as a template and amplified the gene sequences containing MqsR, rhaS, and SFGFP in this plasmid by PCR. The pTOX8-GFP plasmid used in our laboratory was constructed by using pSZU941-GFP and pTOX8 (for the construction process, refer to the literature: A New Suite of Allelic-Exchange Vectors for the Scarless Modification of Proteobacterial Genomes; article website https: / / doi.org / 10.1128 / AEM.00990-19) plasmids as templates. The target fragments amplified by primers pTox-GFP-F / pTox-GFP-R and pTox-GFP-F / pTox-GFP-R were ligated by infusion, and the ligation interface was identified by primers tsPurpleF / GFP-AC-F. The identification results showed that the p'TOX8-GFP tool plasmid was successfully constructed.
[0054] The above primer sequences are as follows:
[0055] pTox-GFP-F: GGCCTTCTTCTGATATCGAGCTCTTGACGG;
[0056] pTox-GFP-R: TGTACACCTGGATCCCCAGCCTACACAA;
[0057] pTox-GFP-F: GGCCTTCTTCTGATATCGAGCTCTTGACGG;
[0058] pTox-GFP-R: TGTACACCTGGATCCCCAGCCTACACAA;
[0059] tsPurpleF: CGCGACGGTTTCTTACAGTG;
[0060] GFP-AC-F: CAGAGTCGGCCAAGGGACCGGCAGTTTACC。
[0061] 2. Linearization and site-directed mutagenesis of the pGGAselect plasmid to achieve convenient and directional insertion of homologous arms.
[0062] We synthesized artificial primers for the pGGAselect plasmid. After linearizing the pGGAselect plasmid, site-directed mutagenesis was performed. Subsequently, the linearized plasmid was phosphorylated at its 5' sticky ends using T4 phosphorylase, and then circularized using T4 ligase. Since the two required enzymes, Bsa I and BsmB I, belong to Type IIs restriction endonucleases, they can recognize non-palindromic sequences and cleave outside the recognition sequences. Therefore, the purpose of the modification was to introduce new gene sequences near the cleavage sites of the above two enzymes to distinguish them from the gene sequences of the original cleavage sites, ensuring specificity during subsequent gene ligation. Specifically, using plasmid pGGAselsct as a template, artificial primers pGGE1 and pGGE2 (designing the recognition sites of restriction endonucleases on the primers) were synthesized for amplification. The amplified large gene fragments were phosphorylated and then circularized using T4 enzyme to obtain the new plasmid pGGA. The primer sequences are as follows:
[0063] pGGE1: CCATCGTCTCACCACGGTCTCACCACTCCTGTAG;
[0064] pGGE2: ACTCCCGTCTCGATCCGGTCTCGATCCGTACCAAG.
[0065] 3. Construction of the pGGB plasmid by ligating three gene fragments using seamless cloning
[0066] After performing site-directed mutagenesis, we synthesized artificial primers pGG-Apr-F, pGG-Apr-R, Bsa-BsmB-R, and Bsa-BsmB-F. The Apr resistance gene in pSZU941-GFP and the four cleavage sites on the backbone of the pGGA plasmid were amplified by PCR and then removed. Subsequently, we used the pGGA site-directed mutagenesis plasmid as a template and performed single digestion with Not I to linearize it and use it as a backbone. These three fragments were ligated together using infusion, with the Apr resistance gene sandwiched between the cleavage sites, so that there were two BsmB I and Bsa I cleavage sites on each side of the Apr resistance gene, forming a new plasmid pGGB. The primer sequences are as follows:
[0067] pGG-Apr-F: ATTCTCGAGGCGGCCTGTTTGTCGGTGAACGCTCT;
[0068] pGG-Apr-R: CTCCGTACCAAGACTTGGGGATCCACTAGTGAGCT;
[0069] Bsa-BsmB-R: GACTCACATGCGGCCAGAAGTCTACAGGAATGGTGAGAC;
[0070] Bsa-BsmB-F: AGTCTTGGTACGGAGCGAGA.
[0071] 4. Construction of pGGTOX Tool Plasmid
[0072] Finally, we artificially synthesized the primers R6K-oriT-F and R6K-oriT-R, and amplified the R6K gene of the pSZU941-GFP plasmid by PCR. We artificially synthesized the primers gg-Apr-ggF and gg-Apr-ggR, and amplified multiple type II restriction enzyme sites and the APr resistance gene of the pGGB tool plasmid by PCR. We artificially synthesized the primers mqsR-F / mqsR-R and rhaS-GFP-F / rhaS-GFP-R, and amplified the rhaS, MqsR genes and the SFGFP gene of the pTOX8-GFP plasmid by PCR. These four gene fragments were ligated by seamless cloning, and then the ligation product was transformed into WM3064 or DH5αpir, and plated for overnight culture. After overnight culture on the agar plate, monoclonal colonies grew out. The monoclonal colonies were placed under a fluorescence microscope for observation. If the colonies showed green, it could be preliminarily proved that the pGGTOX plasmid was successfully constructed. To further confirm that all its gene sequences had been successfully ligated to form a circular plasmid, we artificially synthesized primer pairs to perform PCR identification on the ligation interfaces of the four gene sequences (tsPurpleF / GFP-AC-F; Szu941-for / Apr-end; Bsa-BsmB-F / pCasKp-id4386R; pKD46AntiF / Szu941-rev). The identification results showed that there were bands at the ligation interfaces of the 4 gene fragments (as Figure 5 ) The primer sequences and the construction of the pGGTOX plasmid system are as follows:
[0073] R6K-oriT-F: GGAGAAGTAATCGCTCACTGACCCGCTG;
[0074] R6K-oriT-R: TACCTTACTTTCTCATGAATCCCTTAACGTGAG;
[0075] gg-Apr-ggF: ATTCATGAGAAAGTAAGGTAAAGGCCTCGCG;
[0076] gg-Apr-ggR: TCGAGCGATATGGATCCCCAGCCTACACAA;
[0077] mqsR-F: TGGCCGCATGTGCCAGGCATCAAATAAAACGA;
[0078] mqsR-R: CAGTGAGCGATTACTTCTCCTTAAACGATACGATCAGTACG;
[0079] rhaS-GFP-F: ATTCATGAGAAAGTAAGGTAAAGGCCTCGCG;
[0080] rhaS-GFP-R: TCGAGCGATATGGATCCCCAGCCTACACAA;
[0081] tsPurpleF: CGCGACGGTTTCTTACAGTG;
[0082] GFP-AC-F: CAGAGTCGGCCAAGGGACCGGCAGTTTACC;
[0083] Szu941-for: GTAAGAGGATAACCCTGAGCTCGCTTGG;
[0084] Apr-end: CCGAGACACTGCACCATTCT;
[0085] Bsa-BsmB-F: AGTCTTGGTACGGAGCGAGA;
[0086] pCasKp-id4386R: GAGCGGGTGTTCCTTCTTCA;
[0087] pKD46AntiF: ACGAAAACTCACGTTAAGGGAT;
[0088] Szu941-rev: TTTACCTGGCCCAAATCGATAATGCTAGCA.
[0089] The seamless cloning kit was purchased from Yimus (Beijing) Technology Co., Ltd. The ligation system is as follows:
[0090] Gel extraction products of multiple type II restriction sites and APr resistance gene 1 μL (40 ng) Gel extraction product of SFGFP gene fragment 1 μL (50 ng) Gel extraction product of R6K gene fragment 2 μL (46 ng) Gel extraction product of MqsR gene fragment 0.7 μL (50 ng) 2×Seamless Cloning MIX 5 μL <![CDATA[dd H 2 O]]> 1 μL Total volume 10 μL
[0091] React at 50 °C for 30 s and then transform into WM3064.
[0092] Construction of pCP-oriT plasmid: The target gene fragments were obtained by amplifying the FLIP gene, λ-repressor gene, CmR gene, Rep101 gene, Hyg gene, and oriT gene respectively; the FLIP gene, λ-repressor gene, CmR gene, Rep101 gene, Hyg gene, and oriT gene were ligated into a circular form by seamless cloning technology to obtain the pCP-oriT plasmid.
[0093] Specifically, the process of constructing the pCP-oriT plasmid is similar to that of the pGGTOX plasmid. First, we used the plasmid pCP20 (construction process reference: One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products; literature website: https: / / doi.org / 10.1073 / pnas.120163297) as a template, and artificially synthesized primer pairs 1088flip-F and 1088flip-R to clone the FLIP gene (FLP recombinase) and the λ-repressor gene (λ-repressor), and used primer pairs 1088rep-F and 1088rep-R to clone the chloramphenicol resistance gene and the temperature-sensitive replicon Rep101 gene fragment. Then, artificially synthesized primer pairs 1295hyg-F and 1295hyg-R, and used the plasmid pCasKp-hph (construction process reference: CRISPR-Cas9 and CRISPR-Assisted Cytidine Deaminase Enable Precise and Efficient Genome Editing in Klebsiella pneumoniae; literature website: https: / / doi.org / 10.1128 / AEM.01834-18) as a template to amplify the hygromycin resistance gene. Finally, using primers 1211oriT-F and 1211oriT-R, the oriT fragment was amplified using the plasmid pSZU941-GFP as a template. These four fragments were ligated into a circular form by seamless cloning technology, thus completing the construction of pCP-oriT. The primer sequences and the seamless cloning system are as follows:
[0094] 1088flip-F: GGGGCAAGGATCCTGGTATCGGTCTGCG;
[0095] 1088flip-R: GCTTCTCACGGTTTGGTTGATGCGAGTG;
[0096] 1088rep-F: CCAAACCGTGAGAAGCACACGGTCACAC;
[0097] 1088rep-R: CCCGAAGCGCACCAAAAACTCGTAAAAGCT;
[0098] 1295hyg-F: CAGCTAGCTGCAAACCCTCACTGATCCG;
[0099] 1295hyg-R: CCAGGATCCTTGCCCCTCCAACGTCAT;
[0100] 1211oriT-F: TTTGGTGCGCTTCGGGGTCATTATAGCGA;
[0101] 1211oriT-R: GGTTTGCAGCTAGCTGTCAAGATATCAAGC.
[0102] The seamless cloning kit was purchased from Yimus (Beijing) Technology Co., Ltd. The ligation system is as follows:
[0103] Gel extraction product of hygromycin gene 1 μL (100 ng) Gel extraction product of FLIP gene 1 μL (50 ng) Recovery product of chloramphenicol resistance gene 2 μL (50 ng) Gel extraction product of oriT gene fragment 0.7 μL (150 ng) 2×Seamless Cloning MIX 5 μL <![CDATA[dd H 2 O]]> 1 μL Total volume 10 μL
[0104] React at 50 °C for 30 s and then transform into WM3064.
[0105] The nucleotide sequence of the pGGTOX plasmid constructed above is shown in SEQ ID NO.2, and the nucleotide sequence of the pCP-oriT plasmid is shown in SEQ ID NO.3.
[0106] In another specific embodiment of the present invention, a method for gene knockout in Enterobacteriaceae bacteria is provided. The above plasmid system is used for gene knockout, including the following steps:
[0107] Determine the gene fragment to be knocked out in Enterobacteriaceae bacteria, and amplify the two homologous arm gene fragments on both sides of the gene to be knocked out by designing primers; insert the two homologous arm gene fragments into the pGGTOX plasmid by a one-step method and transform into the vector bacterium WM3064 as the donor bacterium, and use Enterobacteriaceae bacteria as the recipient bacterium; perform conjugation transfer between the donor bacterium and the recipient bacterium, and use the principle of homologous recombination to knock out the gene fragment to be knocked out to obtain a recombinant strain; use WM3064 transformed with the pCP-oriT plasmid as the donor bacterium and the above recombinant strain as the recipient bacterium for conjugation transfer to eliminate the resistance gene fragment in the middle of the homologous arm gene, and remove the pCP-oriT plasmid by increasing the culture temperature.
[0108] In another specific embodiment of the present invention, a method for clearing drug-resistant plasmids in Enterobacteriaceae bacteria is provided. The above plasmid system clears drug-resistant plasmids in Enterobacteriaceae bacteria, including the following steps:
[0109] Identify the plasmid to be knocked out in Enterobacteriaceae bacteria. Obtain the homologous arm gene fragments on both sides by designing primers to amplify the gene sequence in the plasmid to be knocked out. Insert the homologous arm gene fragments on both sides into the pGGTOX plasmid by one-step method and transform it into the vector bacterium WM3064 as the donor bacterium, and use Enterobacteriaceae bacteria as the recipient bacterium. Conduct conjugation transfer between the donor bacterium and the recipient bacterium, and use the principle of homologous recombination to fuse the pGGTOX plasmid with the plasmid to be knocked out to obtain a recombinant strain. Use rhamnose to induce the expression of the MqsR toxin gene to eliminate the fusion plasmid, thereby eliminating the drug-resistant plasmid.
[0110] In another specific embodiment of the present invention, there is provided the application of the above plasmid system in gene editing and drug-resistant plasmid elimination in Enterobacteriaceae bacteria. The Enterobacteriaceae includes one or more of Escherichia, Salmonella, Shigella, Klebsiella, Serratia, Yersinia, and Proteus. Preferably, the Enterobacteriaceae includes Escherichia and Klebsiella.
[0111] Example 1
[0112] Use the pGGTOX tool plasmid to eliminate the DAPA gene sequence of Enterobacteriaceae Nissle1917 (purchased from Weidi Biotechnology, abbreviated as 1917), including the following steps:
[0113] 1. Selection and acquisition of homologous arms
[0114] Use the consensus sequence of 1000 bases adjacent to both sides of the DAPA motif as the homologous arms for gene elimination. Use synthetic primers to amplify the target fragments of the homologous arms on both sides by PCR.
[0115] Name Sequence PGG-BsaI-dap1F GGCTACGGTCTCGGGATAGCTGCACTTTGTACGTCCA PGG-BsaI-dap1R GGCTACGGTCTCGGTGGCAATTAGGCGGTCATGGGGT PGG-BsaI-dap2F GGCTACGGTCTCGGGAGCAAGCTAGCCCGACAGACAT PGG-BsaI-dap2R GGCTACGGTCTCGATGGCAGCACGGAATGGAGCAAAG
[0116] PCR reaction system for homologous arms on both sides:
[0117] Left homologous arm (1000bp)
[0118] Prime STAR Mix 25 μL Template of wild strain 1917 Diluted into bacterial liquid and add 1 μL PGG-BsaI-dap1F Final concentration 0.5 μM PGG-BsaI-dap1R Final concentration 0.5 μM <![CDATA[dd H 2 O]]> Adjust the volume of water according to the template concentration Total volume 50 μL
[0119] Right homologous arm (1260bp)
[0120] Prime STAR Mix 25 μL Template of wild strain 1917 Diluted into bacterial liquid and add 1 μL PGG-BsaI-dap2F Final concentration 0.5 μM PGG-BsaI-dap2R Final concentration 0.5 μM <![CDATA[dd H 2 O]]> Adjust the volume of water according to the template concentration Total volume 50 μL
[0121] Reaction conditions are:
[0122] (1): 95°C for 5 minutes; (2): 95°C for 30 seconds; (3): 55°C for 30 seconds; (4): 72°C for 1 minute and 30 seconds; (5): 72°C for 30 seconds; Steps (2), (3), and (4) are repeated 35 times.
[0123] 2. One-step construction of the tool plasmid pGGTOX-dap with homologous arms of the target gene
[0124] After agarose gel recovery of the gene sequences in Step 1, the concentration of the left homologous arm was 50 ng / μL and the concentration of the right homologous arm was 36 ng / μL, and the concentration of the pGGTOX plasmid (5471 bp) was 50 ng / μL. Then it was ligated with pGGTOX: The homologous arm fragments of the DAPA gene sequence were inserted into the pGGTOX plasmid by the method of Golden Gate cloning with BsaI digestion and T4 ligation.
[0125] Golden Gate cloning reaction system:
[0126]
[0127]
[0128] The reaction conditions were:
[0129] (1) 37°C for 20 minutes; (2) 37°C for 5 minutes; (3) 37°C for 5 minutes; Steps (2) and (3) were repeated 50 cycles.
[0130] 3. Use chemical / electroporation to introduce it into the vector bacterium
[0131] We used WM3064 (E. coli WM3064, purchased from NTCC, the same below) as the vector strain and introduced the constructed tool plasmid into WM3064 by electroporation or chemical transformation. 100 μL of the bacterial solution was spread on the plate and cultured overnight.
[0132] 4. Identification of pGGTOX-dap
[0133] First, its phenotype can be identified using a fluorescence microscope. If there is obvious green fluorescence in the bacteria under the microscope, it can be preliminarily proved that the pGGTOX-dap tool plasmid has been constructed and successfully entered the vector bacterium WM3064. Then this strain was cultured and stored in the bacterial library, and used as the donor strain for conjugation transfer.
[0134] 5. Preparation of the recipient strain
[0135] Using the wild-type Nissle1917 as the vector strain, the plasmid pKD46 (purchased from Youbao Biology) was introduced into 1917 by electroporation or chemical transformation. 100 μL of the bacterial solution was spread on the plate and cultured overnight. The successfully transformed strains were screened and stored, and used as the recipient strains for conjugation transfer.
[0136] 6. Conduct conjugation transfer with Nissle1917 and knock out the DAPA gene sequence using the principle of homologous recombination
[0137] Using WM3064 transformed with pGGTOX-dap as the donor and the 1917-pKD46 prepared in 5 as the recipient for conjugation transfer, it was dropped onto an LB agar plate containing DAPA and 2% glucose at a donor:recipient ratio of 2:1 and cultured overnight. The pGGTOX-dap plasmid was transferred into 1917-pKD46, and the conjugants were screened using an Apr plus 2% GLU agar plate the next day. The DAPA gene was knocked out using the method of homologous recombination. Observing that the strain was green proved that one side of the homologous arm of the pGGTOX-dap plasmid was integrated with 1917-pKD46, and a second induction was required for homologous recombination.
[0138] 7. Induce secondary homologous recombination.
[0139] According to the description in 6, after one side of the homologous arm of pGGTOX-dap was integrated with 1917-pKD46 after the first homologous recombination, we induced it to perform secondary homologous recombination. We induced it at 37°C in an LB broth containing Apr, DAPA, and 2% glucose (to remove the pKD46 plasmid), and shook the bacterial solution until the OD value reached 0.5 - 0.6. After resuspending the bacterial solution twice with a mixture of 2% rhamnose and M9, 100 μL of the bacterial solution was spread on an M9 plate containing Apr and DAPA and a plate only with Apr and M9. To prevent the number of bacteria on the M9 agar plate from being too large to screen out single colonies the next day, so we left half of the bacterial solution in the refrigerator overnight and then diluted and spread the plate the next day. After the secondary homologous recombination was completed, there would be two situations. The first was the strain with the target gene successfully knocked out, and the second was the strain that reverted to the Nissle1917 wild strain after secondary homologous recombination. Therefore, we used M9 agar plates with and without DAPA to conduct a preliminary phenotypic screening of the target strain.
[0140] 8. Identify whether the target gene has been knocked out and confirm the feasibility of the pGGTOX plasmid.
[0141] After overnight culture after the first plating, no monoclonal colonies were separated, and no obvious quantitative difference was observed on the agar plates with and without DAPA. We diluted the bacterial solution stored in the refrigerator by ten times and then took 100 μL to spread the plate again. The next day, we found an interesting phenomenon. The number of bacteria growing on the DAPA plate from the bacterial solution stored in the refrigerator overnight was very large, and almost no growth was observed on the plate without DAPA ( Figure 6A). It is possible that the low-temperature environment slows down bacterial metabolism. Coupled with the effect of exogenous supplementation of DAPA, it is easier for the pGGTOX-dap plasmid to perform secondary homologous recombination on the DAPA gene sequence of the Nissle1917 wild strain and replace the DAPA gene sequence. Its working efficiency is significantly higher than that without being placed in the refrigerator. After identification of the interfaces on both sides of the homologous arms and phenotypic identification through artificially synthesized primers (dap-ext-R / ggtox-R-esaF; dap-ext-F / ggtox-R-esaRPCR), it was confirmed that the DAPA gene sequence had been successfully knocked out ( Figure 6 B). We successfully knocked out the target gene with the pGGTOX plasmid using this method, proving the feasibility of this tool plasmid. The primer sequences are as follows:
[0142] dap-ext-R: GCAGGGCAGTGAGAAGATTTG; ggtox-R-esaF: CATGAGCTCACTAGTGGATCCC;
[0143] dap-cxt-F: GCTGTCGGTCACTTTCATGC; ggtox-R-esaR: GCCTCGAGAATTCTGACGTCT.
[0144] 9. Elimination of resistance genes and verification using the pCP-oriT plasmid
[0145] The modified plasmid pCP-oriT encoding the FRT site-specific FLP recombinase was conjugated with the correctly identified recombinant strain in the above experiment at a ratio of 4:1, and cultured upside down at 30 °C. The next day, a loopful of bacterial film was taken with an inoculation loop and streaked in three zones on a solid culture medium containing chloramphenicol, and cultured upside down overnight at 30 °C. While obtaining positive conjugants, the Flip recombinase was induced to function. Then, multiple monoclonal colonies were selected for PCR verification or phenotypic verification of the presence of the Apr resistance gene. Monoclonal colonies with negative Apr resistance after identification were transferred to LB medium and cultured at 37 °C for 12 h to remove the pCP-oriT plasmid ( Figure 9 ).
[0146] Example 2
[0147] Elimination of the mrk plasmid in Escherichia coli using the pGGTOX tool plasmid
[0148] 1. Design and acquisition of homologous arms
[0149] 700 bases were selected as homologous arms on one side of the mrk gene sequence of the mrk plasmid. The two homologous arms were amplified by PCR with artificially synthesized primers to obtain the target fragment.
[0150] Name Sequence pGG-rm-mrk2R-P GGCTACCGTCTCAATGGCGCCGGGACAATTTTATTACTCT pGG-rm-mrk2F-P GGCTACCGTCTCAGGAGCACTACCGCTACCATGGGC pGG-rm-mrk1R-P GGCTACCGTCTCAGTGGCAGATAGGCGCTGCTGTTAT pGG-rm-mrk1F-P GGCTACCGTCTCAGGATGTAAAACCGTGATGCTGGCG
[0151] PCR reaction system for homologous arms on both sides
[0152] Left homologous arm (700bp)
[0153] Prime STAR Mix 25 μL Using mrk plasmid as template Diluted to 1 ng and add 1 μL pGG-rm-mrk1R-P Final concentration 0.5 μM pGG-rm-mrk1F-P Final concentration 0.5 μM <![CDATA[dd H 2 O]]> Adjust the volume of water according to the template concentration Total volume 50 μL
[0154] Right homologous arm (700bp)
[0155] 2. One-step construction of the tool plasmid pGGTOX-mrk with homologous arms of the target gene
[0156] After the agarose gel recovery of the gene sequences in Step 1, the concentration of the left homologous arm was 128 ng / μL, the concentration of the right homologous arm was 69 ng / μL, and the concentration of the pGGTOX plasmid (5471bp) was 140 ng / μL. Then it was ligated with pGGTOX: The homologous arm fragments of the DAPA gene sequence were inserted into the pGGTOX plasmid by the method of restriction enzyme digestion, T4 ligation and Golden Gate cloning.
[0157] Golden Gate cloning reaction system.
[0158] pGGTOX plasmid 420 ng Left homologous arm fragment 25.6 ng Right homologous arm fragment 23 ng NEB Golden Gate Mix 1 μL Buffer T4 DNA Ligase 2 μL (10X) Nuclease-free Water To 20 μL
[0159] The reaction conditions were as follows:
[0160] (1) 42°C for 2 minutes; (2) 16°C for 2 minutes; (3) 60°C for 2 minutes; Steps (1) and (2) were repeated 60 cycles.
[0161] 3. Use chemical / electroporation to introduce it into the vector bacteria
[0162] We used WM3064 as the vector strain and introduced the constructed tool plasmid into WM3064 by electroporation or chemical transformation. 100 μL of the bacterial solution was spread on the plate and cultured overnight.
[0163] 4. Identification of pGGTOX-mrk
[0164] First, the phenotype can be identified using a fluorescence microscope. If there is obvious green fluorescence in the bacteria under the microscope, it can be preliminarily proved that the pGGTOX-mrk tool plasmid has been constructed and successfully entered the vector bacteria WM3064. Then this strain was enriched and stored in the bacterial library.
[0165] 5. Conjugation transfer with the clinical strain carrying the mrk plasmid and knockout of the mrk plasmid using the principle of homologous recombination
[0166] Use WM3064 transformed with pGGTOX-mrk as the donor and the clinical strain JNQH950 carrying the mrk plasmid (the strain bioinformation has been uploaded to NCBI, BioSample: SAMN36745160; Sample name: JNQH950; currently stored in the Affiliated Hospital of Shandong First Medical University (Qianfoshan Hospital)) as the recipient for conjugation transfer. Drop the donor:recipient at a ratio of 1:1 onto the LB agar plate with DAPA plus 2% glucose and incubate overnight. Transfer the pGGTOX-mrk plasmid into the clinical strain JNQH950 carrying the mrk plasmid, and use the method of homologous recombination to knockout the mrk plasmid. Observe the phenotype of the conjugants under a fluorescence microscope. If the conjugants are green under the microscope, it proves that the pGGTOX-mrk plasmid has been successfully inserted into the mrk plasmid through a single homologous recombination.
[0167] 6. Induce the expression of the MqsR toxin gene using rhamnose to eliminate the mrk plasmid.
[0168] As described in 5, after the entire pGGTOX-mrk plasmid is integrated with the mrk plasmid after the first homologous recombination, we induce the expression of the MqsR toxin gene downstream of its promoter using rhamnose to knockout the mrk plasmid together with the pGGTOX tool plasmid. We induce in the LB broth with 2% glucose and shake the bacterial solution until the OD value reaches 0.5 - 0.6. Resuspend the bacterial solution twice with a mixture of 2% rhamnose and M9, then spread 100 μL of the bacterial solution on the M9 plate and the plate with Apr and M9 and incubate overnight. Therefore, we use the M9 agar plates with and without Apr to conduct a preliminary phenotypic screening of the target strain.
[0169] 7. Identify whether the mrk plasmid has been knocked out and confirm the feasibility of pGGTOX to eliminate the drug-resistant plasmid of Enterobacter.
[0170] After overnight incubation, monoclonal colonies grew on the agar plate. We picked ten monoclonal colonies and synthesized primers Incx1F / Incx1R, mrkA-1F / mrk-locL 236 to identify the homologous arm interface, the fragment on the mrk plasmid, and the replicon. The results showed that only the fourth monoclonal colony among the ten colonies had no bands, proving that the fourth strain had lost the mrk plasmid. The results are as Figure 7 shown. We successfully knocked out the drug-resistant plasmid of Enterobacter with the pGGTOX plasmid using this method, proving the feasibility of this tool plasmid. The primer sequences are as follows:
[0171] Incx1F: TCCAGGTTGCCGTAATCAC; Incx1R: ATGGGCTGTATTCTGGCTGG; mrkA-1F: GGTAAACGTTCGCATCGCTG; mrk-locL: GCATTCTTTGACGCCGATAGC.
[0172] 8. Elimination of resistance genes and verification using pCP-oriT plasmid
[0173] Same as step 9 in Example 1.
[0174] Example 3
[0175] Use the pGGTOX tool plasmid to eliminate the TA gene sequence of Klebsiella pneumoniae. The TA gene series often exists in Salmonella, but our laboratory has discovered a strain of Klebsiella pneumoniae carrying the TA gene, which encodes its type III flagellar gene. We have entered it into the bacterial library and named it JNQH327 (the biological sample information of this strain has been uploaded to NCBI, BioSample: SAMN43766382, Sample name: JNQH327; it is currently stored in the Affiliated Hospital of Shandong First Medical University (Qianfoshan Hospital)). After that, we used the pGGTOX tool plasmid to knock out its TA gene and observed the phenotype and changes of the bacteria after losing the TA gene sequence, including the following steps:
[0176] 1. Selection and acquisition of homologous arms
[0177] Use the consensus sequence of 700 bases on both sides adjacent to the TA motif as the homologous arms for gene elimination; use artificially synthesized primers to amplify the target fragment of the homologous arms on both sides by PCR.
[0178]
[0179]
[0180] PCR reaction system for homologous arms on both sides
[0181] Left homologous arm (700bp)
[0182] Prime STAR Mix 25 μL JNQH327 strain template Diluted into bacterial solution and add 1 μL pGG-vap1F Final concentration 0.5 μM pGG-Vap1R Final concentration 0.5 μM <![CDATA[dd H 2 O]]> Adjust the volume of water according to the template concentration Total volume 50 μL
[0183] Right homologous arm (700bp)
[0184] Prime STAR Mix 25 μL JNQH327 strain template Diluted into bacterial solution and add 1 μL pGG-Vap2F Final concentration 0.5 μM pGG-Vap2R Final concentration 0.5 μM <![CDATA[dd H 2 O]]> Adjust the volume of water according to the template concentration Total volume 50 μL
[0185] The reaction conditions are:
[0186] Pre-denaturation: 95°C for 5 minutes; Denaturation: 95°C for 30 seconds; Annealing: 55°C for 30 seconds; Extension: 72°C for 40 seconds; Final extension: 72°C for 30 seconds; The denaturation, annealing, and extension steps were repeated 35 times.
[0187] 2. One-step construction of the tool plasmid pGGTOX-TA with homologous arms of the target gene
[0188] After agarose gel recovery of the gene sequences in Step 1, the concentration of the left homologous arm was 58 ng / μL and the concentration of the right homologous arm was 33 ng / μL. The concentration of the pGGTOX plasmid (5471 bp) was 50 ng / μL. Then it was ligated with pGGTOX: The homologous arm fragments of the DAPA gene sequence were inserted into the pGGTOX plasmid by restriction enzyme digestion and T4 ligation and the method of Golden Gate cloning.
[0189] Golden Gate cloning reaction system:
[0190] pGGTOX plasmid 100 ng Left homologous arm fragment 26 ng Right homologous arm fragment 26 ng NEB Golden Gate Mix 1 μL Buffer T4 DNA Ligase 2 μL (10X) Nuclease-free Water To 20 μL
[0191] The reaction conditions were:
[0192] (1) 42°C for 2 minutes; (2) 16°C for 2 minutes; (3) 60°C for 2 minutes; Steps (1) and (2) were repeated 60 cycles.
[0193] 3. Use chemical / electroporation to introduce it into the vector bacteria
[0194] We used WM3064 as the vector strain and electrotransformed or chemically transformed the constructed tool plasmid into WM3064. 100 μL of the bacterial solution was spread on the plate and cultured overnight.
[0195] 4. Identification of pGGTOX-TA
[0196] First, the phenotype can be identified using a fluorescence microscope. If there is obvious green fluorescence in the bacteria under the microscope, it can be initially proved that the pGGTOX-TA tool plasmid was constructed and successfully entered the vector bacteria WM3064. Then this strain was cultured and stored in the bacterial library.
[0197] 5. Conjugative transfer with Klebsiella pneumoniae carrying the TA gene sequence and knockout of the TA gene sequence using the principle of homologous recombination
[0198] Using WM3064 transformed with pGGTOX-TA as the donor, the recipient strain JNQH327 was subjected to conjugation transfer. It was pipetted onto an LB agar plate containing DAPA and 2% glucose at a donor:recipient ratio of 3:1 and cultured overnight. The pGGTOX-TA plasmid was transferred into the JNQH327 strain, and the TA gene sequence was knocked out by homologous recombination. The phenotype was observed under a fluorescence microscope. If the strain was observed to be green, it proved that one side of the homologous arm of the pGGTOX-TA plasmid was integrated with the JNQH327 strain, and a second induction was required for homologous recombination.
[0199] 6. Induce secondary homologous recombination.
[0200] As described in 5, after one side of the homologous arm of pGGTOX-TA was integrated with the JNQH327 strain after the first homologous recombination, we induced it to perform secondary homologous recombination. We induced it in LB broth supplemented with Apr and 2% glucose and shook the bacterial solution until the OD value reached 0.5 - 0.6. The bacterial solution was resuspended twice with a mixture of 2% rhamnose and M9. Given the experience obtained from Example 1, we placed 100 μL of the bacterial solution in a 4°C refrigerator overnight and then spread it on an Apr and M9 plate.
[0201] 7. Identify whether the target gene has been knocked out and confirm the feasibility of the pGGTOX plasmid.
[0202] After the secondary homologous recombination, two situations will occur. The first is the strain in which the target gene has been successfully knocked out, and the second is the strain that has reverted to the JNQH327 wild strain after secondary homologous recombination. The next day, multiple monoclonal colonies grew on the plate. We selected 16 monoclonal colonies and artificially synthesized primers COG-idF / COG-idR to perform PCR identification on the TA gene sequence. The results showed that half of the monoclonal colonies had successfully knocked out the TA gene sequence as Figure 8 shown. The primer sequences are as follows:
[0203] COG-idF: TCATACGCTCCTGTCTCGGA; COG-idR: ATCAATGAAGGCCTGGACGG.
[0204] The above shows and describes the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. What is described in the above embodiments and the specification only illustrates the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.
Claims
1. A plasmid system for traceless gene editing and drug-resistant plasmid removal in Enterobacteriaceae, characterized in that: The invention comprises a pGGTOX plasmid with gene editing and plasmid elimination and a pCP-oriT plasmid with resistance gene elimination, wherein the pGGTOX contains: mqsR gene, R6K replicon, rhaS gene, SFGFP gene and Apr gene connected in sequence; and the pCP-oriT contains: FLIP gene, λ-repressor protein gene, CmR gene, Rep101 gene, Hyg gene and oriT gene connected in sequence.
2. The plasmid system according to claim 1, characterized in that The Enterobacteriaceae bacteria include one or more of the genera Escherichia, Salmonella, Shigella, Klebsiella, Serratia, Yersinia, and Proteus. Preferably, the Enterobacteriaceae bacteria include Escherichia and Klebsiella.
3. The method for constructing a plasmid system according to any one of claims 1 to 2, characterized in that The following steps are involved: Construction of pGGTOX plasmid: R6K gene, Apr gene, MqsR gene, rhaS gene and SFGFP gene were amplified respectively to obtain target gene fragments; pGGAselsct plasmid was used as a template, primers pGGE1 and pGGE2 were used for amplification, and the amplified large gene fragment was phosphorylated and then cyclized using T4 enzyme to obtain pGGA plasmid; Apr gene was inserted into pGGA plasmid to obtain pGGB plasmid, and Apr gene with restriction sites on both sides was amplified using primers; R6K gene, Apr gene with restriction sites on both sides, MqsR gene, rhaS gene and SFGFP gene fragments were connected by a one-step method to obtain pGGTOX plasmid; Construction of pCP-oriT plasmid: amplification of FLIP gene, λ-repressor protein gene, CmR gene, Rep101 gene, Hyg gene and oriT gene were respectively carried out to obtain target gene fragments; FLIP gene, λ-repressor protein gene, CmR gene, Rep101 gene, Hyg gene and oriT gene were connected into a circle by seamless cloning technology to obtain pCP-oriT plasmid.
4. The construction method according to claim 3, characterized in that: In the step of constructing the pGGTOX plasmid, two pairs of BsmBI and BsaI restriction sites were introduced on both sides of the Apr gene.
5. A method for knocking out a gene in Enterobacteriaceae bacteria, characterized in that: Gene knockout is performed using the plasmid system described in any one of claims 1 to 2.
6. The gene knockout method according to claim 7, characterized in that: The following steps are involved: Determine the gene fragment to be knocked out in Enterobacteriaceae, and obtain the gene fragments of homologous arms on both sides of the gene to be knocked out by designing primers to amplify both sides of the gene to be knocked out; The gene fragments with homologous arms on both sides were inserted into the pGGTOX plasmid by a one-step method and transformed into the vector bacteria WM3064 as donor bacteria, and the Enterobacteriaceae bacteria as recipient bacteria; The donor bacteria are conjugated and transferred with the recipient bacteria, and the gene fragment to be knocked out is knocked out by using the principle of homologous recombination to obtain a recombinant strain; WM3064 transformed with pCP-oriT plasmid was used as donor bacteria, and the above-mentioned recombinant strain was used as recipient bacteria for conjugation transfer to eliminate the resistance gene fragment in the middle of the homologous arm gene, and the pCP-oriT plasmid was removed by increasing the culture temperature.
7. A method for removing drug-resistant plasmids from Enterobacteriaceae, characterized in that: The plasmid system according to any one of claims 1 to 2 is used to eliminate drug-resistant plasmids in Enterobacteriaceae.
8. The method for eliminating drug-resistant plasmids in Enterobacteriaceae according to claim 7, characterized in that: The following steps are involved: Determine the plasmid to be knocked out in the Enterobacteriaceae bacteria, and obtain the gene fragments with homologous arms on both sides by designing primers to amplify the gene sequence in the plasmid to be knocked out; The gene fragments with homologous arms on both sides were inserted into the pGGTOX plasmid by a one-step method and transformed into the vector bacteria WM3064 as donor bacteria, and the Enterobacteriaceae bacteria as recipient bacteria; The donor bacteria and the recipient bacteria are transferred by conjugation, and the pGGTOX plasmid and the plasmid to be knocked out are fused by the principle of homologous recombination to obtain a recombinant strain. The fusion plasmid is eliminated by inducing the expression of the MqsR toxin gene using rhamnose, thereby eliminating the drug-resistant plasmid.
9. Use of the plasmid system of claim 1 for gene editing and elimination of drug-resistant plasmids in Enterobacteriaceae.
10. The use according to claim 9, characterized in that The Enterobacteriaceae family includes one or more of the genera Escherichia, Salmonella, Shigella, Klebsiella, Serratia, Yersinia, and Proteus. Preferably, the Enterobacteriaceae family includes Escherichia and Klebsiella.