Vector for overexpressing SLC31A1 gene as well as preparation method and application thereof

By providing a vector that overexpresses the SLC31A1 gene and its preparation method, the problems of fibrosis, apoptosis and mitochondrial metabolism regulation are solved, effective overexpression of the SLC31A1 gene and regulation of related gene expression are achieved, and new drug development and disease treatment directions are provided.

CN120118952APending Publication Date: 2025-06-10HENAN NORMAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510285113.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-11
Publication Date
2025-06-10

AI Technical Summary

Technical Problem

The prior art is difficult to effectively regulate fibrosis, apoptosis and mitochondrial metabolism, and the SLC31A1 gene function is unknown and there is a lack of effective overexpression methods.

Method used

A vector for overexpressing the SLC31A1 gene and its preparation method are provided. The overexpression of the SLC31A1 gene is achieved by transfecting the host cell and is applied to regulate cell mitochondrial metabolism, apoptosis and fibrosis-related gene expression.

Benefits of technology

The stable and effective overexpression of the SLC31A1 gene was achieved, and the expression levels of genes related to cell mitochondrial metabolism, apoptosis and fibrosis were regulated, providing new drug development and disease treatment directions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118952A_ABST
    Figure CN120118952A_ABST
Patent Text Reader

Abstract

The invention discloses a carrier for overexpressing an SLC31A1 gene as well as a preparation method and application of the carrier, and relates to the technical field of molecular biotechnology and genetic engineering. The invention provides a vector capable of stably and effectively overexpressing an SLC31A1 gene, the base sequence of the vector is as shown in SEQ ID No.1, and after the plasmid vector is transfected into a host cell, the mitochondrial activity, cell apoptosis, fibrosis and the like of the cell can be further influenced; the compound has a very high application value in preparation of drugs for regulating and controlling mitochondrial metabolism, apoptosis and fibrosis of cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biotechnology and genetic engineering technology, and specifically relates to a vector for overexpressing the SLC31A1 gene, a preparation method thereof, and an application thereof. Background Art

[0002] Fibrosis can occur in multiple organs. The main pathological change is the increase of fibrous connective tissue in the organ tissue, the reduction of parenchymal cells, and continuous progression can lead to the destruction of organ structure and the decline of function, and even failure, seriously threatening human health and life. Regulating fibrosis or enriching the means of regulation is of great significance for the treatment of various diseases and the development of new drugs.

[0003] The full length of the SLC31A1 gene is 42,949 bp, containing 5 exons. The full length of its mRNA is 4,762 bp, of which the CDS region is 573 bp, encoding a total of 190 amino acids. This gene is an important member of the cuproptosis gene family. The protein encoded by this gene is a high-affinity copper transporter found in the cell membrane and affects the absorption of dietary copper as a trimer. Nowadays, SLC31A1 is still a gene with unknown function. Summary of the Invention

[0004] The purpose of the present invention is to provide a vector for overexpressing the SLC31A1 gene, a preparation method thereof, and an application thereof.

[0005] The present invention adopts the following technical solutions to achieve the above purpose:

[0006] The present invention provides a vector for overexpressing the SLC31A1 gene, and its base sequence is as shown in SEQ ID No.1.

[0007] The vector for overexpressing the SLC31A1 gene provided by the present invention can achieve the purpose of overexpressing the SLC31A1 gene and studying the function of the SLC31A1 gene.

[0008] The present invention provides an application of the vector for overexpressing the SLC31A1 gene in the preparation of a drug for regulating cell mitochondrial metabolism or / and the expression of its related genes.

[0009] The present invention provides an application of the vector for overexpressing the SLC31A1 gene in the preparation of a drug for regulating apoptosis or / and the expression of its related genes.

[0010] Preferably, regulating apoptosis specifically means promoting apoptosis.

[0011] The present invention provides an application of the vector for overexpressing the SLC31A1 gene in the preparation of a drug for regulating fibrosis or / and the expression of its related genes.

[0012] Preferably, the fibrosis is at least one of pulmonary fibrosis, liver fibrosis, renal fibrosis, splenic fibrosis, and ocular muscle fibrosis; the related gene is at least one of the E-cadherin gene and the Vimentin gene; regulating the expression of the fibrosis-related gene specifically includes at least one of reducing the expression level of the E-cadherin gene and promoting the expression level of the Vimentin gene.

[0013] The present invention provides a host cell containing the vector overexpressing the SLC31A1 gene as described above.

[0014] The present invention provides a method for preparing the host cell as described above, and the process includes transfecting the vector overexpressing the SLC31A1 gene as described above into the host cell.

[0015] Preferably, the specific process of transfection is: mixing the solution containing the vector overexpressing the SLC31A1 gene with the transfection reagent, and then introducing the mixed product into the host cell and culturing for transfection at 35-38 °C for 24-48 h.

[0016] Preferably, the volume ratio of the solution containing the vector overexpressing the SLC31A1 gene to the transfection reagent is 1:2.

[0017] The present invention provides a method for preparing a vector overexpressing the SLC31A1 gene, and the process includes culturing the host cell as described above.

[0018] Preferably, when culturing, the content of the host cell is 4×10 5 ~6×10 5 cells / mL; the specific process of culturing is: culturing the cells with a culture plate, when the cells grow to cover 70%-80% of the bottom area of the plate, aspirate the culture medium, and wash the culture plate with serum-free DMEM medium 1-3 times; then add serum-free medium and the transfection reagent-plasmid vector complex solution and mix well; perform transfection culture under the conditions of 37 °C, 5% (volume fraction) CO 2 , and saturated humidity.

[0019] The present invention provides a drug, which includes the vector overexpressing the SLC31A1 gene as described above and / or the host cell as described above.

[0020] The present invention has the following advantages and beneficial effects compared with the prior art: The present invention provides a vector capable of stably and effectively overexpressing the SLC31A1 gene, and it is found that the vector overexpressing the SLC31A1 gene can regulate the metabolic capacity of cell mitochondria, and can effectively regulate the expression levels of cell apoptosis and fibrosis or / and their related genes. Furthermore, it can be applied to the preparation of drugs for regulating processes such as cell mitochondrial metabolism, cell apoptosis, and fibrosis, providing more directions for the treatment and research of related diseases, and having high practical application value. Brief Description of the Drawings

[0021] Figure 1 It is the result diagram of double digestion of the plasmid vector overexpressing the SLC31A1 gene; where VE: empty plasmid, OE: overexpressing plasmid, Digestion: enzyme digestion experimental group.

[0022] Figure 2 It is the result diagram of the relative gene expression level of the plasmid vector overexpressing the SLC31A1 gene; where VE: empty plasmid, OE: overexpressing plasmid; ****p < 0.0001.

[0023] Figure 3 It is the Western blot diagram of the protein expression of the plasmid vector overexpressing the SLC31A1 protein; where VE: empty plasmid, OE: overexpressing plasmid.

[0024] Figure 4 It is the ATP result diagram of A549 cells transfected with the plasmid vector; where VE: empty plasmid, OE: overexpressing plasmid; *p < 0.05.

[0025] Figure 5 It is the result diagram of mitochondrial complexes I and III of A549 cells transfected with the plasmid vector; where VE: empty plasmid, OE: overexpressing plasmid; **p < 0.01.

[0026] Figure 6 It is the ROS detection result diagram of A549 cells transfected with the plasmid vector; where VE: empty plasmid, OE: overexpressing plasmid; Scale bar: 100 μm.

[0027] Figure 7 It is the result diagram of apoptosis flow cytometry detection of A549 cells transfected with the plasmid vector; where VE: empty plasmid, OE: overexpressing plasmid; ***p < 0.001.

[0028] Figure 8 It is the result diagram of the detection of the relative expression levels of EMT-related genes in A549 cells transfected with the plasmid vector; where VE: empty plasmid, OE: overexpressing plasmid; **p < 0.01.

[0029] Figure 9Detection results of relative expression levels of EMT-related proteins in A549 cells transfected with plasmid vectors; where VE: empty plasmid, OE: overexpression plasmid. Detailed implementation manners

[0030] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments whose manufacturers are not indicated, they are all conventional products that can be obtained through commercial purchase.

[0031] The embodiment of the present invention provides a base sequence of a vector overexpressing the SLC31A1 gene as shown in SEQ ID No.1, and the vector defined by this sequence can more effectively and stably achieve the overexpression of the SLC31A1 gene.

[0032] The embodiment of the present invention provides the application of a vector overexpressing the SLC31A1 gene in the preparation of a drug for regulating mitochondrial activity or / and the expression of its related genes. Without limitation, as long as a vector overexpressing the SLC31A1 gene is used in the preparation of a drug for regulating mitochondrial activity or / and the expression of its related genes, it falls within the protection scope of this patent application.

[0033] The embodiment of the present invention provides the application of a vector overexpressing the SLC31A1 gene in the preparation of a drug for regulating apoptosis or / and the expression of its related genes. Without limitation, as long as a vector overexpressing the SLC31A1 gene is used in the preparation of a drug for regulating apoptosis or / and the expression of its related genes, it falls within the protection scope of this patent application.

[0034] Preferably, regulating apoptosis means promoting apoptosis.

[0035] The embodiment of the present invention provides the application of a vector overexpressing the SLC31A1 gene in the preparation of a drug for regulating fibrosis or / and the expression of its related genes. Without limitation, as long as a vector overexpressing the SLC31A1 gene is used in the preparation of a drug for regulating fibrosis or / and the expression of its related genes, it falls within the protection scope of this patent application.

[0036] "Fibrosis" herein can occur in multiple organs. The main pathological change is the increase of fibrous connective tissue in organ tissues, the decrease of parenchymal cells, and continuous progression can lead to the destruction of organ structure and the decline of function, and even failure, seriously threatening human health and life. The tissues with fibrosis include, but are not limited to, any one of the lung, cardiovascular system, liver, pancreas, kidney, spleen, and eyes.

[0037] "Regulating fibrosis" in this text may refer to treating or improving fibrosis, and "regulating the expression of fibrosis-related genes" refers to enhancing the expression level of fibrosis-related genes and reducing the expression level of fibrosis-related genes.

[0038] "Expression of a gene" in this text refers to at least one of the expression level of mRNA and the expression level of protein.

[0039] Preferably, the related gene is at least one of the E-cadherin gene and the Vimentin gene; specifically, regulating the expression of fibrosis-related genes is at least one of reducing the expression level of the E-cadherin gene and promoting the expression level of the Vimentin gene; fibrosis is at least one of pulmonary fibrosis, splenic fibrosis, renal fibrosis, hepatic fibrosis, and ocular muscle fibrosis, preferably pulmonary fibrosis.

[0040] The embodiments of the present invention also provide a host cell containing a vector overexpressing the SLC31A1 gene as described above, and its preparation process includes transfecting the vector overexpressing the SLC31A1 gene as described above into the host cell.

[0041] Preferably, the specific transfection process is: mixing the solution containing the vector overexpressing the SLC31A1 gene with a transfection reagent, and then introducing the mixed product into the host cell and culturing for transfection at 35-38 °C for 24-48 h; the volume ratio of the solution containing the vector overexpressing the SLC31A1 gene to the transfection reagent is 1:2.

[0042] Preferably, the transfection process further includes allowing the host cell transfected with the vector containing the overexpressed SLC31A1 gene to stand at room temperature for 5-15 min. The transfection reagent (Beijing Bomed) serves as a carrier for transporting substances inside and outside the cell, and through the fluidity of the cell membrane, it transports the plasmid vector into the cell by means of membrane fusion; then standing for 5-15 min is beneficial for the combination of the plasmid vector and the target gene. The standing time can specifically be any one or the range between any two of 5 min, 7 min, 9 min, 11 min, 13 min, and 15 min, and room temperature can be understood as 5-30 °C, or any one or the range between any two of 5 °C, 10 °C, 15 °C, 20 °C, 25 °C, and 30 °C.

[0043] The embodiments of the present invention also provide a method for preparing a vector overexpressing the SLC31A1 gene, and its process includes culturing the host cell as described above.

[0044] Preferably, when culturing, the content of the host cell is 4×10 5 ~6×10 5cells / mL. Within this range, the transformation ratio and transformation efficiency of the transfection reagent can be ensured. The specific steps of the culture are as follows: culture the cells in a culture plate. When the cells grow to cover 70%-80% of the bottom area of the plate, aspirate and discard the culture medium, and wash the culture plate 1-3 times with serum-free DMEM medium; then add serum-free medium and the transfection reagent-plasmid vector complex solution and mix well; perform transfection culture under the conditions of 37°C, 5% (volume fraction) CO 2 , saturated humidity.

[0045] In addition, the embodiment of the present invention also provides a drug, which comprises the vector or / and host cell overexpressing the SLC31A1 gene as described above.

[0046] The features and performance of the present invention will be further described in detail below in conjunction with the embodiments.

[0047] Example 1

[0048] This example provides a vector overexpressing the SLC31A1 gene. The vector includes the PCDNA.5-HA (XhoI / HindIII) tag and restriction enzyme sites, and its base sequence is shown in SEQ ID NO.1 as follows (5'-3'): ATGGATCATTCCCACCATATGGGGATGAGCTATATGGACTCCAACAGTACCATGCAACCTTCTCACCATCACCCAACCACTTCAGCCTCACACTCCCATGGTGGAGGAGACAGCAGCATGATGATGATGCCTATGACCTTCTACTTTGGCTTTAAGAATGTGGAACTACTGTTTTCCGGTTTGGTGATCAATACAGCTGGAGAAATGGCTGGAGCTTTTGTGGCAGTGTTTTTACTAGCAATGTTCTATGAAGGACTCAAGATAGCCCGAGAGAGCCTGCTGCGTAAGTCACAAGTCAGCATTCGCTACAATTCCATGCCTGTCCCAGGACCAAATGGAACCATCCTTATGGAGACACACAAAACTGTTGGGCAACAGATGCTGAGCTTTCCTCACCTCCTGCAAACAGTGCTGCACATCATCCAGGTGGTCATAAGCTACTTCCTCATGCTCATCTTCATGACCTACAACGGGTACCTCTGCATTGCAGTAGCAGCAGGGGCCGGTACAGGATACTTCCTCTTCAGCTGGAAGAAGGCAGTGGTAGTGGATATCACAGAGCATTGCCATTGA。

[0049] Example 2

[0050] This example presents a method for overexpressing the SLC31A1 gene, and the steps are as follows:

[0051] 1.1 Dilute the vector overexpressing the SLC31A1 gene (provided in Example 1) with 0.01 M PBS to prepare a plasmid vector solution;

[0052] 1.2 Dilute the transfection reagent with 0.01 M PBS to prepare a transfection reagent solution;

[0053] 1.3 Mix the plasmid vector solution and the transfection reagent solution according to a volume ratio of 1:2 to prepare a transfection reagent and plasmid vector complex solution, and let it stand at room temperature for 5 - 15 min;

[0054] 1.4 Add complete medium to a 6-well culture plate at 2 mL / well, and culture A549 cells. The cell concentration in each culture well is 4×10 5 cells / mL;

[0055] 1.5 Carry out cell culture under the conditions of 37 °C, 5% (v / v) CO 2 , and saturated humidity until the cultured cells cover 70% - 80% of the bottom area of the plate;

[0056] 1.6 Aspirate and discard the medium in the culture well, and wash the cells 1 - 2 times with 0.01 M PBS;

[0057] 1.7 After washing, add the transfection reagent and plasmid vector complex solution and carry out cell transfection and culture for 24 h under the conditions of 37 °C, 5% (v / v) CO 2 , and saturated humidity;

[0058] 1.8 Collect the cells and detect the expression level of the SLC31A1 gene.

[0059] Example 3

[0060] This example presents a method for overexpressing the SLC31A1 gene, and the steps are as follows:

[0061] 1.1 Dilute the vector for overexpressing the SLC31A1 gene (provided in Example 1) with 0.01 M PBS to prepare a plasmid vector solution;

[0062] 1.2 Dilute the transfection reagent with 0.01 M PBS to prepare a transfection reagent solution;

[0063] 1.3 Mix the plasmid vector solution and the transfection reagent solution at a volume ratio of 1:2 to prepare a transfection reagent and plasmid vector complex solution, and let it stand at room temperature for 5 - 15 min;

[0064] 1.4 Add complete medium to a 6-well culture plate at 2 mL / well, and culture A549 cells. The cell concentration in each culture well is 4×10 5 cells / mL;

[0065] 1.5 Carry out cell culture under the conditions of 37 °C, 5% (v / v) CO 2 , and saturated humidity until the cultured cells cover 70% - 80% of the bottom area of the plate;

[0066] 1.6 Aspirate and discard the medium in the culture well, and wash the cells 1 - 2 times with 0.01 M PBS;

[0067] 1.7 After washing, add the transfection reagent and plasmid vector complex solution and2 Perform cell transfection and culture for 48 h under saturated humidity conditions;

[0068] 1.8 Collect the cells and detect the expression level of the SLC31A1 gene.

[0069] Experimental Example 4

[0070] Verification of plasmid vector:

[0071] After constructing the expression plasmid, use the restriction endonucleases (XhoI, HindIII) corresponding to the restriction sites at both ends of the target gene for digestion and then perform agarose gel electrophoresis. For the results, please refer to Figure 1 , from Figure 1 it can be known that a band appears at 573 kd in the plasmid vector digestion, indicating that the plasmid construction is successful and the overexpression fragment has been successfully introduced into the vector.

[0072] Culture of A549 cells:

[0073] The culture medium is DMEM-F12 medium, and cell culture is carried out at 37 °C and a volume fraction of 5% CO 2 , under saturated humidity conditions.

[0074] Cell transfection:

[0075] Digest the A549 cells in the logarithmic growth phase with 0.25 wt% trypsin, and inoculate the cells into the culture wells of a 6-well culture plate at a concentration of 4×10 5 cells / well, and continue to culture at 37 °C and a volume fraction of 5% CO 2 until 70% - 80% of the bottom area of the culture plate is covered. Perform cell transfection according to the operating steps in the instruction manual of the transfection reagent (Beijing Bomed). Add 2 μg of plasmid vector and 4 μL of transfection reagent to 0.01 M PBS respectively, mix well to obtain the diluted plasmid vector solution and transfection reagent solution, and let it stand at room temperature for 5 - 15 min. Then, add them to the cells in the complete medium and incubate at 37 °C, a volume fraction of 5% CO 2 , under saturated humidity conditions for 48 h. Set 3 replicates for each experimental group, and repeat the experiment 3 times. At the same time, set up blank control and negative control.

[0076] Digest the A549 cells in the logarithmic growth phase with 0.25 wt% trypsin, and inoculate the cells into the culture wells of a 96-well culture plate at a concentration of 8×10 3 cells / well, and culture at 37 °C, a volume fraction of 5% CO 2Continue to culture under the above conditions until 70%-80% of the bottom area of the culture plate is covered, and perform cell transfection according to the operation steps in the instruction manual of the transfection reagent (Beijing Bomed). Add 0.1 μg plasmid vector and 0.2 μL transfection reagent to 0.01 M PBS respectively, mix well to obtain the diluted plasmid vector solution and transfection reagent solution, and let it stand at room temperature for 5-15 min. Then add it to the cells in the complete medium and incubate at 37 °C and 5% CO 2 2, saturated humidity conditions for 48 h. Set 3 replicates for each experimental group, and repeat the experiment 3 times. At the same time, set blank control and negative control.

[0077] 1. Effects on the expression of SLC31A1 gene and protein

[0078] Collect cells 48 h after transfection, extract total RNA according to the operation instructions of Trizol reagent. The ratio of 28S:18S bands of Total RNA is 2:1, and the OD260:280 of the extracted RNA is in the range of 1.9-2.1. Detect the normal expression of SLC31A1 gene by qRT-PCR, and detect the expression level of SLC31A1 protein by western blot method.

[0079] The experimental method for extracting total RNA is as follows:

[0080] First step, discard the medium, add 1 mL of Trizol reagent and digest at room temperature for 5 min;

[0081] Second step, centrifuge at 12000 rpm for 5 min and take the supernatant;

[0082] Third step, add 200 μL of chloroform, mix well by shaking and let it stand at room temperature for 15 min;

[0083] Fourth step, centrifuge at 4 °C and 12000 rpm for 5 min, take the supernatant to another RNase free EP tube;

[0084] Fifth step, add 500 μL of isopropanol to the EP tube, mix well and let it stand at room temperature for 5-10 min;

[0085] Sixth step, centrifuge at 4 °C and 12000 rpm for 10 min, discard the supernatant;

[0086] Seventh step, add 1 mL of 75% ethanol by volume, shake the centrifuge tube to suspend the precipitate;

[0087] Eighth step, centrifuge at 4 °C and 12000 rpm for 10 min, discard the supernatant and air dry at room temperature;

[0088] Ninth step, add 50 μL ddH 2O was dissolved to obtain total RNA.

[0089] The reaction for fluorescence quantitative PCR was detected using Roche Light Cycler 480 II and TransStart qPCR Super Mix. The reaction system is shown in Table 1, the reaction conditions are shown in Table 2, and the detection primers are shown in Table 5.

[0090] Table 1 Reaction system (20 μL)

[0091] Component Volume cDNAtemplate 1 μL Primer (10 μM) 0.4 μL each 2× mix 10 μL Dye (50×) 0.4 μL <![CDATA[ddH 2 O]]> 7.8 μL

[0092] Table 2 Reaction system

[0093] Temperature Reaction time 94℃ 30s 94℃ 5s 60℃ 34 s for 40 cycles

[0094] The experimental method of Western blot is as follows:

[0095] Prepare 10% separating gel and 5% stacking gel according to the formulations in Table 3 and Table 4.

[0096] Table 3 10% separating gel (10 mL)

[0097] <![CDATA[ddH 2 O]]> 4.0 mL 30 wt% Acrylamide 3.3 mL 1.5 M Tris-HCl (pH 8.8) 2.5 mL 10 wt% SDS 0.1 mL 10 wt% APS 0.1 mL TEMED 0.004 mL

[0098] Table 4 5% stacking gel (4 mL)

[0099] <![CDATA[ddH 2 O]]> 2.7 mL 30 wt% Acrylamide 0.67 mL 1 M Tris-HCl (pH 6.8) 0.5 mL 10 wt% SDS 0.04 mL 10 wt% APS 0.04 mL TEMED 0.004 mL

[0100] Immediately pour the separating gel between two glass plates after adding TEMED, and cover a layer of ddH 2 O on the gel surface, keep the gel surface level, and let it stand until the gel completely solidifies. Pour out the ddH 2 O, dry it with filter paper, and prepare the stacking gel.

[0101] Immediately pour the stacking gel between two glass plates after adding TEMED, insert the sample comb, and let it stand until the gel solidifies.

[0102] Electrophoresis detection:

[0103] 1.1 Treatment of protein samples: Take an appropriate amount of protein samples, add 5× Loading buffer (sample: Loading buffer = 4:1), mix well, denature at 100 °C for 10 min, and then store at 4 °C for later use;

[0104] 1.2 Install the electrophoresis device, load the samples, electrophorese at 80 V until the bromophenol blue enters the separating gel, increase the voltage to 120 V, and electrophorese until the bromophenol blue just runs out of the separating gel;

[0105] 1.3 Cut the PVDF membrane to the same size as the gel, soak it in methanol for 30 s, and then transfer it to the transfer buffer for equilibration for 10 min. At the same time, soak the sponge, filter paper, and PAGE gel in the transfer buffer for equilibration.

[0106] 1.4 Arrange the black splint, sponge, filter paper, gel, membrane, filter paper, sponge, and white splint in sequence. Ensure there are no air bubbles between the gel and the membrane. Clamp the device and place the splint into the transfer tank in the direction of the electrode. Add the transfer buffer.

[0107] 1.5 Insert the electrodes and transfer at a constant current of 200 mA for 1 h. The device will heat up during the transfer process. Place it in an ice box for cooling.

[0108] 1.6 Remove the device. Rinse the PVDF membrane with the transfer buffer and add the blocking solution to block it at room temperature for 1 h.

[0109] 1.7 Discard the blocking solution and add 3 mL of the blocking solution + 1 μL of the primary antibody (volume ratio 1:3000) to bind at room temperature for 90 min.

[0110] 1.8 Wash the membrane 3 times with TBST buffer, 10 min each time.

[0111] 1.9 Add TBST buffer + 1 μL of the secondary antibody (volume ratio 1:10000) and gently shake at room temperature for 1 h.

[0112] 1.10 Wash the membrane 3 times with TBST buffer, 10 min each time.

[0113] 1.11 Add the chromogenic solution and shake to develop color for 10 min. Pour out the chromogenic solution and add ddH 2 O to terminate the reaction and observe and photograph for recording.

[0114] For the results of gene and protein expression levels, please refer to Figure 2 and Figure 3 . The results show that compared with the control group, the gene and protein expression levels in the experimental group are significantly increased.

[0115] 2. Effects on mitochondrial activity

[0116] Seed A549 cells into 96-well plates and 6-well plates respectively. Seeding density: 2×10 4 cells / well for 96-well plates and 2×10 5 cells / well for 6-well plates. The 96-well plates are used to measure ATP and ROS, and the 6-well plates are used to measure mitochondrial complexes I and III. After seeding for 24 h, transfect the plasmid vector into A549 cells. After transfection for 24 h, perform detections according to the operation instructions of the ATP kit, mitochondrial complex I and III kits, and ROS kit.

[0117] The results are as Figures 4 - 6As shown, compared with the control group, the expression levels of ATP, mitochondrial complex I and III in the experimental group were significantly decreased, and the ROS content was significantly increased.

[0118] 3. Effects on apoptosis

[0119] A549 cells were seeded in 6-well plates. When the cells grew to 70%-80%, the plasmid vector was transfected into A549 cells. After 48 hours of transfection, the cells were harvested and stained with an apoptosis detection kit, and the apoptosis of the cells was detected by flow cytometry.

[0120] The results are shown in Figure 7 . Flow cytometry detection found that after transfection with the SLC31A1 plasmid, early and late apoptosis of the cells increased, indicating that overexpression of the SLC31A1 gene could promote the apoptosis of A549 cells.

[0121] 4. Effects on the expression of fibrosis-related genes and proteins.

[0122] The experimental method used the real-time fluorescence quantitative PCR technique described above to detect the gene expression level and the western blot technique to detect the protein expression level. The detection primers are shown in Table 5, and the results are shown in Figure 8 and Figure 9 . Compared with the control group, after overexpression of SLC31A1, the expression of the fibrosis-related gene E-cadherin decreased, and the expression of Vimentin increased. The protein level expression was consistent with the gene level. It shows that overexpression of SLC31A1 may be involved in the EMT (epithelial-mesenchymal transition) process in fibrosis to induce the fibrosis process.

[0123] Table 5 Primers for qRT-PCR detection

[0124]

[0125] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

[0126] SEQUENCE LISTING

[0127] <110>Henan Normal University

[0128] <120>A vector for overexpressing the SLC31A1 gene, its preparation method and application

[0129] <160>9

[0130] <170>PatentIn version 3.3

[0131] <210>SEQ ID NO:1

[0132] <211>573

[0133] <212>DNA

[0134] <213>Artificial sequence

[0135] <400>SEQ ID NO:1

[0136] Atggatcattcccaccatatggggatgagctatatggactccaacagtaccatgcaaccttctcaccatcacccaaccacttcagcctcacactcccatggtggaggagacagcagcatgatgatgatgcctatgaccttctactttggctttaagaatgtggaactactgttttccggtttggtgatcaatacagctggagaaatggctggagcttttgtggcagtgtttttactagcaatgttctatgaaggactcaagatagcccgagagagcctgctgcgtaagtcacaagtcagcattcgctacaattccatgcctgtcccaggaccaaatggaaccatccttatggagacacacaaaactgttgggcaacagatgctgagctttcctcacctcctgcaaacagtgctgcacatcatccaggtggtcataagctacttcctcatgctcatcttcatgacctacaacgggtacctctgcattgcagtagcagcaggggccggtacaggatacttcctcttcagctggaagaaggcagtggtagtggatatcacagagcattgccattga 573

[0137] <210>SEQ ID NO:2

[0138] <211>22

[0139] <212>DNA

[0140] <213>Artificial sequence

[0141] <400>SEQ ID NO:2

[0142] ccaggaccaaatggaaccatcc 22

[0143] <210>SEQ ID NO:3

[0144] <211>22

[0145] <212>DNA

[0146] <213>Artificial sequence

[0147] <400>SEQ ID NO:3

[0148] accacctggatgatgtgcagca 22

[0149] <210>SEQ ID NO:4

[0150] <211>20

[0151] <212>DNA

[0152] <213>Artificial sequence

[0153] <400>SEQ ID NO:4

[0154] cgagagctacacgttcacgg 20

[0155] <210>SEQ ID NO:5

[0156] <211>21

[0157] <212>DNA

[0158] <213>Artificial sequence

[0159] <400>SEQ ID NO:5

[0160] gggtgtcgagggaaaaatagg 21

[0161] <210>SEQ ID NO:6

[0162] <211>24

[0163] <212>DNA

[0164] <213>Artificial sequence

[0165] <400>SEQ ID NO:6

[0166] ttgccgttgaagctgctaactacc 24

[0167] <210>SEQ ID NO:7

[0168] <211>22

[0169] <212>DNA

[0170] <213>Artificial sequence

[0171] <400>SEQ ID NO:7

[0172] aatcctgctctcctcgccttcc 22

[0173] <210>SEQ ID NO:8

[0174] <211>22

[0175] <212>DNA

[0176] <213>Artificial sequence

[0177] <400>SEQ ID NO:8

[0178] gtctcctctgacttcaacagcg 22

[0179] <210>SEQ ID NO:9

[0180] <211>22

[0181] <212>DNA

[0182] <213>Artificial sequence

[0183] <400>SEQ ID NO:9

[0184] accaccctgttgctgtagccaa 22

Claims

1. Overexpression SLC31A1 A gene vector, characterized in that: The overexpression SLC31A1 The base sequence of the gene vector is shown in SEQ ID No.

1.

2. The overexpression according to claim 1 SLC31A1 The application of gene vectors in the preparation of drugs for regulating cell mitochondrial metabolism and / or expression of related genes.

3. The overexpression according to claim 1 SLC31A1 The invention relates to the use of gene vectors in the preparation of drugs for regulating cell apoptosis and / or the expression of genes related thereto.

4. The overexpression according to claim 1 SLC31A1 Use of a gene vector in the preparation of a drug for regulating fibrosis or / and the expression of its related genes, wherein the fibrosis is at least one of pulmonary fibrosis, liver fibrosis, kidney fibrosis, spleen fibrosis and eye muscle fibrosis; the related gene is E-cadherin Genes and Vimentin At least one of the genes; regulating the expression of fibrosis-related genes is specifically to reduce E-cadherin Gene expression levels and promotion Vimentin At least one of the expression levels of genes.

5. A host cell, characterized in that: The host cell contains the overexpression SLC31A1 Gene vector.

6. A method for preparing the host cell according to claim 5, characterized in that The preparation process comprises the overexpression of claim 1 SLC31A1 The gene vector is transfected into the host cell.

7. The method for preparing a host cell according to claim 6, characterized in that The specific process of transfection is: SLC31A1 The solution of the gene vector is mixed with the transfection reagent, and the mixed product is then introduced into the host cells and cultured at 35-38°C for 24-48 hours; SLC31A1 The volume ratio of the gene vector solution to the transfection reagent is 1:

2.

8. An overexpression SLC31A1 A method for preparing a gene vector, characterized in that The preparation process comprises culturing the host cell according to claim 5.

9. The overexpression according to claim 8 SLC31A1 A method for preparing a gene vector, characterized in that The specific process of culture is as follows: culture cells on a culture plate. When the cells grow to cover 70% to 80% of the bottom of the plate, discard the culture medium and wash the culture plate 1 to 3 times with serum-free DMEM medium; then add serum-free medium and transfection reagent-plasmid vector complex solution and mix well; perform transfection culture at 37°C, 5% CO2, and saturated humidity; during culture, the host cell content is 4×10 5 ~6×10 5 Pieces / mL.

10. A drug, characterized in that Comprising the overexpression described in claim 1 SLC31A1 A gene vector and / or a host cell as claimed in claim 5.

Citation Information

Patent Citations

  • Tumor marker transmembrane protein SLC31A1 and application thereof

    CN116859048A

  • Copper transporter SLC31A1 and application of promoter thereof in preparation of medicine for treating leukemia

    CN117018163A