High-yield AAV packaging plasmid and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and discloses a high-yield AAV packaging plasmid and application thereof. The invention provides a high-yield AAV packaging plasmid, a recombinant sequence is inserted into a skeleton plasmid of the high-yield AAV packaging plasmid, and the recombinant sequence sequentially comprises a Rep expression cassette, a Cap expression cassette and at least one DA'sequence from 5'to 3 '. The packaging plasmid is applied in the aspect of improving the production capacity of the recombinant adeno-associated virus, a new method is provided for production of the adeno-associated virus, and the production cost of rAAV (recombinant adeno-associated virus) can be reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a packaging plasmid for high-yield AAV and its application. Background Art

[0002] Adeno-associated virus (AAV) has many advantages, making it a favored gene therapy delivery vector. First, the replication of AAV requires the participation of a helper virus, so it is considered non-pathogenic. Second, after AAV enters the cell, its genome wrapped by the ITR structure can circularize to form an episomal structure, reducing the probability of recombination with the genome and thus reducing genomic toxicity. In addition, AAV has 12 different serotypes and hundreds of variants derived therefrom, greatly expanding its application range.

[0003] Based on rAAV vectors can target both dividing and non-dividing cells, including the retina, liver, heart, muscle, and central nervous system (CNS), to achieve long-term expression of therapeutic genes. To date, more than 200 clinical trials have been conducted for the treatment of various diseases, such as hemophilia A and B, Parkinson's disease, wet age-related macular degeneration, mucopolysaccharidosis (MPS), Batten disease, etc. Although rAAV-based gene therapy has been successful in clinical trials, due to low yields and high-dose requirements for certain disease indications, high manufacturing costs remain a bottleneck in the field of gene therapy, thus limiting patients' access to these promising products. This, in turn, has increased the demand for reducing the production cost of AAV and establishing a flexible and GMP-compliant AAV production system.

[0004] Therefore, the yield bottleneck of AAV needs to be broken urgently. Transient transfection of plasmid into human embryonic kidney (HEK) 293 cells is a common strategy for the preparation of adeno-associated virus (AAV) vectors, which has the main advantages of short production cycle, easy operation, and strong flexibility. The three-plasmid transfection method is the most commonly used method for rAAV production. This method uses three plasmids to co-transfect HEK293 cells: an auxiliary plasmid pADhelper, which provides adenovirus E2A, E4, and VA RNA elements; a packaging plasmid pRC, which provides the Rep and Cap protein coding sequences of AAV. The Rep protein is responsible for the replication of the AAV genome and assisting in the assembly of AAV genome particles, and the Cap protein forms the AAV capsid; a plasmid including the target sequence, which can be abbreviated as pGOI, with a 5' ITR and a 3' ITR sequence from the natural AAV genome upstream and downstream of the target sequence. Improving and innovating in the upstream of production to increase the AAV yield is one of the key points for reducing the production cost of gene therapy currently. Summary of the Invention

[0005] The object of the present invention is to overcome the deficiencies of the prior art and provide a packaging plasmid for high-yield AAV and its application.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a packaging plasmid for highly productive AAV, in which a recombinant sequence is inserted into a backbone plasmid, and the recombinant sequence sequentially includes a Rep expression cassette, a Cap expression cassette, and at least one DA' sequence from 5' to 3'.

[0008] As a preferred embodiment of the packaging plasmid for highly productive AAV of the present invention, the recombinant sequence sequentially includes any one of the following sequences from 5' to 3':

[0009] i. Rep protein coding sequence, Cap protein coding sequence, DA' sequence, promoter sequence;

[0010] ii. Rep protein coding sequence, Cap protein coding sequence, WPRE sequence, SV40 ployA sequence, DA' sequence, promoter sequence;

[0011] iii. Rep protein coding sequence, first promoter sequence, Intron sequence, Cap protein coding sequence, WPRE sequence, SV40 ployA sequence, DA' sequence, second promoter sequence;

[0012] iv. Rep truncated sequence, first promoter sequence, Intron sequence, Cap protein coding sequence, WPRE sequence, SV40 ployA sequence, DA' sequence, second promoter sequence.

[0013] As a preferred embodiment of the packaging plasmid for highly productive AAV of the present invention, the Rep truncated sequence is as shown in SEQ ID No. 7.

[0014] In a second aspect, the present invention provides a plasmid group for highly productive AAV, including an auxiliary plasmid, an AAV plasmid, and the packaging plasmid for highly productive AAV described above.

[0015] As a preferred embodiment of the plasmid group for highly productive AAV of the present invention, the auxiliary plasmid is pAdHelper; the AAV plasmid is the AAV plasmid pAAV.CAG.EGFP vector of a fluorescent protein driven by a CAG promoter.

[0016] In a third aspect, the present invention provides a reagent for highly productive AAV, including the plasmid group for highly productive AAV described above.

[0017] In a fourth aspect, the present invention provides a cell for highly productive AAV, including the plasmid group for highly productive AAV described above.

[0018] As a preferred embodiment of the cells for producing high-yield AAV of the present invention, the cells include at least one of HeLa, HEK293, and insect Sf9 cells.

[0019] In a fifth aspect, the present invention provides a kit for producing high-yield AAV, including the reagent or the cells described above.

[0020] In a sixth aspect, the present invention provides a method for producing high-yield AAV, which comprises transforming the plasmid group into a host cell and then culturing the host cell; or culturing the cells described above.

[0021] In a seventh aspect, the present invention applies the packaging plasmid for producing high-yield AAV, the plasmid group, the reagent, the cells, and the kit in the production of recombinant adeno-associated virus.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] The present invention proposes a new packaging plasmid encoding Rep / Cap (including all its serotypes), and replacing the promoter of the Cap expression cassette with the CMV-p40-intron dual promoter can increase the yield of rAAV virus and significantly improve the AAV yield of single cells. It provides a new method for the production of adeno-associated virus and can reduce the production cost of rAAV. Description of the Drawings

[0024] Figure 1 It is a schematic diagram of the design of the packaging plasmid in the example.

[0025] Figure 2 It is a schematic diagram of the structural elements of the plasmid backbone in the example.

[0026] Figure 3 It is a statistical comparison chart of the virus titers of the lysates of each group of packaging plasmids detected in the example and the control vector. Detailed Embodiments

[0027] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0028] Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels.

[0029] Example 1: Construction of Packaging Plasmid pRC

[0030] By designing combinations containing various Rep promoters, Rep protein expression cassettes, Cap promoters, Intron sequences, Cap protein expression cassettes, and DA' sequences, different candidate packaging plasmids were constructed based on the backbone vector sequence through conventional molecular cloning methods (see Figure 1 ), and then the AAV packaging titers of each packaging plasmid were compared in parallel in a common three-plasmid transfection system.

[0031] Among them, the plasmid backbone (as shown in Figure 2 ) has the sequence shown in SEQ ID No.1; the P5 promoter sequence has the sequence shown in SEQ ID No.2; the CMV-p40 promoter sequence has the sequence shown in SEQ ID No.3; the Intron sequence has the sequence shown in SEQ ID No.4; the DA' sequence has the sequence shown in SEQ ID No.5; Rep is from adeno-associated virus type 2, and its sequence is shown in SEQ ID No.6; the truncated Rep is from adeno-associated virus type 2, and its sequence is shown in SEQ ID No.7; Cap is from adeno-associated virus type 9, and its sequence is shown in SEQ ID No.8. The WPRE sequence is from woodchuck hepatitis virus, and its sequence is shown in SEQ ID No.9. The SV40 polyA sequence is from simian vacuolating virus 40, and its sequence is shown in SEQ ID No.10.

[0032] The specific steps for plasmid construction are as follows:

[0033] (1) Using the plasmid containing the RepCap gene as a template, the Rep gene sequence, Cap gene sequence, Intron sequence, DA' sequence, P5 promoter sequence, and p40 promoter sequence were obtained by PCR amplification or digestion. Using the plasmid containing the CMV promoter as a template, the CMV promoter sequence was amplified. Using the plasmid containing the WPRE SV40 polyA sequence as a template, the WPRE SV40 polyA sequence was amplified.

[0034] The PCR reaction system is shown in Table 1:

[0035] Table 1 PCR reaction system

[0036]

[0037] The digestion reaction system is shown in Table 2:

[0038] Table 2 Digestion reaction system

[0039] Reaction components Volume (μL) 10×FastDigest Green Buffer 5 FastDigest enzyme 1×n DNA 2 μg Nuclease-free water to 50 μL

[0040] The primers used for the plasmid are as follows:

[0041] Forward primer 1: ccccctcgatcgaggtcgacggtatcgggggagctaggtcctgtattagaggtcacgtg;

[0042] Reverse primer 1: caatctcgtaaaaccccggcatggcggctgcgcgttcaaacc;

[0043] Forward primer 2: cgtaatctgtaattgcctgttaatcaataaaccggtaattccgctcgagataatcaacc;

[0044] Reverse primer 2: ggggttccttgcaggtttaaacgcggccgctttaaaaaacctccc;

[0045] Forward primer 3: aaatcaggtatggctgccgatggttatcttccagattggctcgaggacactctctctgaggtctca;

[0046] Reverse primer 3: ctcatgagacctcagagagagtgtcctcgagccaatctggaagataaccatcggcagccatacctgattt;

[0047] Forward primer 4: gcggtctcatgaggtttaaaccgccatcgataagcttggga;

[0048] Reverse primer 4: ccttaattaaggcaattacagattacgagtcagg;

[0049] Forward primer 5: agcgagacgaaatacgcgat;

[0050] Reverse primer 5: cgcggaactcccaagcttatttattgttcaaagatgcagtcatcca;

[0051] The PCR reaction conditions are shown in Table 3:

[0052] Table 3 PCR reaction conditions

[0053]

[0054] The digestion reaction conditions are shown in Table 4:

[0055] Table 4 Digestion reaction conditions

[0056] Reaction steps Reaction temperature Reaction time Digestion 37℃ 30 min Hold 8℃

[0057] (2) Detect the PCR amplification bands by agarose gel electrophoresis, and use a gel extraction kit to recover the target fragment.

[0058] (3) Use a seamless cloning kit for multi-fragment ligation. Use T4 ligase for restriction enzyme ligation.

[0059] The seamless cloning reaction system is shown in Table 5:

[0060] Table 5 Reaction System

[0061] Reaction components Volume (μL) 2×Assembly Mix 5 Linearized vector 1 Inserts n Nuclease-free Water to 10

[0062] The reaction conditions are: 50°C for 1 h.

[0063] The T4 ligation reaction system is shown in Table 6:

[0064] Table 6 Reaction System

[0065]

[0066]

[0067] The reaction conditions are: room temperature for 1 h.

[0068] Transform the reaction product into Escherichia coli, spread it on a plate containing antibiotics, pick colonies for colony PCR identification the next day, send the positive colonies to Guangzhou Genewiz for sequencing, and select the required correct plasmids.

[0069] Example 2: Production of AAV by triple plasmid transfection

[0070] (1) Seed about 3E+05 293T cells (293T, derived from CRL-3216TM) into a 6-well plate, use high-glucose DMEM medium containing 10% newborn bovine serum and 1% Penicillin / Streptomycin, and culture in a 37°C, 5% CO 2 cell incubator for about 48 h. The cell density at the time of transfection is about 60%-70%;

[0071] (2) Add the five packaging plasmids A - E (pRC), the helper plasmid (pAdHelper), and the AAV plasmid pAAV.CAG.EGFP vector of the fluorescent protein driven by the CAG promoter constructed in Example 1 into 0.5 mL of DMEM medium at a ratio of 0.5 μg:0.5 μg:0.5 μg respectively. Then add 3 μL of PEI (1 μg / μL), vortex and mix well. After standing at room temperature for 10 minutes, add it to 1.5 mL of transfection medium and vortex to mix well. Aspirate the medium in the 6 - well plate, add the transfection - mixed medium, and then put it back into the 37 °C cell culture incubator (5% CO 2 concentration) for culture.

[0072] (3) After culturing for 72 hours, add 15 μL of cell lysate, collect the cells and the supernatant into a 2 - mL centrifuge tube, shake and lyse at 250 rpm on a 37 °C shaker for 1 h, and centrifuge at 10000 g for 10 minutes. The supernatant is the crude AAV extract.

[0073] Example 3: Determine the AAV titer

[0074] Determine the titers of the AAVs produced in each group in Example 2. The specific method is as follows:

[0075] Use the primers FWD WPRE (5‘-TGCTTCCCGTATGGCTTTCA) and REV WPRE (5’-ACGGAATTGTCAGTGCCCAA) to specifically detect the sequences of WPRE of all types of AAV vectors.

[0076] The group settings are shown in Table 7:

[0077] Table 7 Group settings

[0078]

[0079]

[0080] (1) DNase I digestion of the sample

[0081] The components of the reaction system are shown in Table 8:

[0082] Table 8 Reaction system

[0083] Reagent X1 Nuclease-free Water 15.8 μL 10×Reaction Buffer 2 μL DNase I, RNase free (70 U / μL) 0.2 μL Sample 2 μL

[0084] Take 5 μL of the sample and dilute it 20-fold. Take an appropriate number of PCR tubes, add 18 μL of digestion solution to each tube, and add 2 μL of the diluted sample and 2 μL of the plasmid standard for making the standard curve (containing 4E+08 AAV copies (Genome Copies, GC), as the DNase I digestion control) respectively, which is equivalent to a 10-fold dilution, and incubate at 37 °C for 30 min. After digestion, take 5 μL of the sample and add it to 95 μL of water, and perform two consecutive dilutions, with a total dilution of 80,000-fold. The Ref AAV (plasmid standard) is diluted 4,000-fold in total.

[0085] (2) SYBR Green qPCR

[0086] Standard preparation: Take the plasmid standard containing 2E+08 AAV copies / μL, and perform 6 consecutive dilutions with 8 μL + 72 μL of water. Then the first gradient concentration is 2E+08 GC / μL, and its concentration is set to 8E+14 GC / mL in the software to reflect the dilution gradient of the sample. The subsequent series of gradients are 8E+13 GC / mL, 8E+12 GC / mL, 8E+11 GC / mL, 8E+10 GC / mL, and 8E+09 GC / mL in turn.

[0087] The components of the reaction system are shown in Table 9:

[0088] Table 9 Reaction system

[0089] Reagent Vol. per reaction SYBR PCR reagent (2×) 10 μL ROX (50×) 0.4 μL FWD WPRE (50 μM) 0.1 μL REV WPRE (50 μM) 0.1 μL Nuclease-free water 4.4 μL Sample DNA 5 μL

[0090] Calculated by making 3 replicate wells for each sample, prepare the mixture with the corresponding volume, dispense 18 μL into each well, and then add 2 μL of the sample to each well respectively.

[0091] The conditions for SYBR Green qPCR are: Pre-denaturation: 95 °C for 10 min; Cycling: 40 cycles: 95 °C for 15 sec; 60 °C for 1 min.

[0092] After converting all the titer detection results into the multiple relationship with the control packaging vector p5+Rep+Cap, as Figure 3 shown. The results show that compared with the conventional packaging vector, replacing the Cap expression cassette promoter with the CMV-p40-intron dual promoter has the effect of increasing the rAAV virus yield, and can increase the rAAV virus yield by about 4.5 times.

[0093] In the examples, the packaging plasmid of a specific serotype (Rep2Cap9) was used. Those skilled in the art should understand that the present invention is not limited to this specific serotype, but can be implemented using other serotype packaging plasmids that are currently known and may continue to be discovered in the future.

[0094] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A high-yield AAV packaging plasmid, characterized in that: A recombinant sequence is inserted into the backbone plasmid, and the recombinant sequence includes a Rep expression box, a Cap expression box and at least one DA' sequence in sequence from 5' to 3'.

2. The high-yield AAV packaging plasmid according to claim 1, characterized in that The recombinant sequence includes any of the following sequences from 5' to 3': i. Rep protein coding sequence, Cap protein coding sequence, DA' sequence, promoter sequence; ii. Rep protein coding sequence, Cap protein coding sequence, WPRE sequence, SV40 polyA sequence, DA' sequence, promoter sequence; iii. Rep protein coding sequence, first promoter sequence, Intron sequence, Cap protein coding sequence, WPRE sequence, SV40 polyA sequence, DA' sequence, second promoter sequence; iv. Rep truncated sequence, first promoter sequence, Intron sequence, Cap protein coding sequence, WPRE sequence, SV40 polyA sequence, DA' sequence, second promoter sequence.

3. The high-yield AAV packaging plasmid according to claim 2, characterized in that The Rep truncated sequence is shown as SEQ ID No.

7.

4. A plasmid set for high-yield AAV, characterized in that: It comprises an auxiliary plasmid, an AAV plasmid and a packaging plasmid for high-yield AAV according to any one of claims 1 to 3.

5. A reagent for high-yield AAV, characterized in that: A plasmid set comprising the high-yield AAV as described in claim 4.

6. A cell that produces high levels of AAV, characterized in that: A plasmid set comprising the high-yield AAV as described in claim 4.

7. The high-producing AAV cell according to claim 6, characterized in that The cells include at least one of HeLa, HEK293, and insect Sf9 cells.

8. A kit for high-yield AAV, characterized in that: Comprising the reagent of claim 5 or the cell of claim 6 or 7.

9. A method for high-yield AAV, characterized in that: Transform host cells with the plasmid set described in claim 4, and then culture the host cells; or culture the cells described in claim 6 or 7.

10. Use of the high-yield AAV packaging plasmid according to any one of claims 1 to 3, the plasmid set according to claim 4, the reagent according to claim 5, the cell according to claim 6 or 7, and the kit according to claim 8 in the production of recombinant adeno-associated virus.

Images