Method for screening medicine for treating central nervous system, cell line and application thereof

By mixing cell lines expressing the targeted ion channels and fluorescent probes of the candidate drugs with the candidate drugs and performing electrical stimulation to detect the intensity of the fluorescence signal in the screening cell lines, the problems of low efficiency, poor accuracy and high cost in the CNS drug screening in the prior art are solved, and efficient, accurate and economical drug screening effects are achieved.

CN120118972AActive Publication Date: 2025-06-10PEKING UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510587175.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-08
Publication Date
2025-06-10
Estimated Expiration
2045-05-08

AI Technical Summary

Technical Problem

There is a lack of a method that can be applied to the screening of central nervous system (CNS) drugs on a large scale, resulting in low efficiency, poor accuracy and high cost in the development of CNS drugs.

Method used

The fluorescence signal intensity in the screened cell lines were detected to characterize the activity of the candidate drug by mixing the cell lines that express the corresponding targeted ion channels and fluorescent probes with the candidate drug and performing electrical stimulation.

Benefits of technology

It has achieved high efficiency, accuracy and low cost for the detection of CNS drug activity, and can be applied to CNS drug screening on a large scale, promoting the development process of CNS drug.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118972A_ABST
    Figure CN120118972A_ABST
Patent Text Reader

Abstract

The invention provides a method for screening drugs for treating a central nervous system, a cell line and application of the cell line. The method comprises the following steps: mixing a cell line for expressing a targeted ion channel and a fluorescent probe corresponding to a candidate drug with the candidate drug to obtain a screened cell line; performing electrical stimulation on the screened cell line, and detecting the intensity of a fluorescence signal in the screened cell line; the intensity of the fluorescence signal represents the activity of the candidate drug; wherein in the genes of the cell line, from upstream to downstream, the first promoter, the gene of the fluorescent probe, the second promoter, the gene of the ion channel correspondingly targeted by the candidate drug, and the reporter gene are connected in sequence. The problem that in the prior art, a method capable of being applied to CNS drug screening on a large scale is lacked can be solved, and the method is suitable for the field of biomedical engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical engineering, and in particular, to a method for screening drugs for treating the central nervous system, a cell line, and their applications. Background Art

[0002] Central nervous system (CNS) diseases, including neurodegenerative diseases, neuropsychiatric disorders, and neurological dysfunctions, are one of the major threats to global health, and their destructive power to human health cannot be underestimated. In the research field of CNS diseases, especially in drug development, although it is considered the second most popular field after oncology, its R & D process is full of challenges. Taking Alzheimer's disease (AD) as an example, despite investing more than $200 billion in drug development, its clinical trial success rate is extremely low, with a failure rate as high as 99.6%, far exceeding the clinical failure rate of anti-tumor drugs (92%) (Int Rev Neurobiol, Germán Plascencia-Villa, 2020).

[0003] The current problems faced in CNS drug R & D mainly stem from the complexity of the disease mechanism and the lack of effective disease models, which result in drug R & D being targeted at disease manifestations rather than directly acting on the disease process, thereby increasing the difficulty and uncertainty of experimental design. The pathophysiological process of CNS diseases is closely related to the regulation of ion channel activity. Among them, the Nav1.7 subtype of voltage-gated sodium channels (VGSCs) plays a core role in the electrical signal conduction of nociceptive sensory neurons, while the Nav1.8 subtype is a hot spot in pain research. Therefore, it is particularly important to develop a drug screening technology that can efficiently and accurately detect changes in ion channel activity.

[0004] The current mainstream technologies for CNS new drug evaluation, such as patch clamp electrophysiology, can screen cells expressing specific ion channels, but their throughput is extremely low, the number of cells evaluated each time is limited, usually less than 10, and in addition, the operation technical requirements are high, making it difficult to achieve large-scale applications. In addition, the diseases involved in the CNS field are extensive, including but not limited to depression, anxiety, pain, epilepsy, and stroke. These diseases usually use animal models for behavioral experiments to evaluate the efficacy of drugs. However, this method is costly, time-consuming, and has low throughput. Moreover, although electroencephalography (EEG) and electromyography (EMG) can be used to detect changes in brain chemicals and evaluate the efficacy of drugs such as sleep drugs, anti-epileptic drugs, and anesthetic drugs, their accuracy is limited, and due to the high equipment requirements and long experimental cycle, the cost is also high.

[0005] In view of the above limitations, there is an urgent need for a more efficient, accurate, economical and large-scale applicable drug screening technology to accelerate the R & D process of new drugs in the CNS field. Summary of the Invention

[0006] The main object of the present invention is to provide a method, a cell line and their applications for screening drugs for treating the central nervous system, so as to solve the problem in the prior art that there is a lack of a method that can be applied to CNS drug screening on a large scale.

[0007] To achieve the above object, according to the first aspect of the present invention, there is provided a method for screening drugs for treating the central nervous system, the method comprising: mixing a cell line expressing an ion channel and a fluorescent probe corresponding to a candidate drug with the candidate drug to obtain a screening cell line; applying an electrical stimulation to the screening cell line and detecting the intensity of the fluorescent signal in the screening cell line; the intensity of the fluorescent signal represents the activity of the candidate drug; wherein, in the gene of the cell line, from upstream to downstream, a first promoter, the gene of the fluorescent probe, a second promoter, the gene of the ion channel corresponding to the candidate drug and a reporter gene are sequentially connected.

[0008] Further, the ion channel includes one or more of a sodium ion channel, a potassium ion channel, a calcium ion channel, a chloride ion channel, a potassium-sodium ion channel or a magnesium ion channel.

[0009] Further, the fluorescent probe includes one or more of a membrane potential probe, a neurotransmitter probe, a calcium ion probe or an ATP probe; the membrane potential probe includes one or more of Cepheid1b, pAce, ASAP, Voltron, Archon or somArchon.

[0010] Further, in the above cell line, the nucleotide sequence of the gene of the fluorescent probe is SEQ ID NO: 1; the nucleotide sequence of the reporter gene is SEQ ID NO: 2; the nucleotide sequence of the gene of the ion channel corresponding to the candidate drug is SEQ ID NO: 3 or SEQ ID NO: 4.

[0011] Further, the electrical stimulation is applied to the screening cell line by applying an external electric field; the intensity of the electrical stimulation is 200 - 400 v / cm, the frequency of the electrical stimulation is 3 - 5 Hz, the number of times of the electrical stimulation is 5 - 15 times, and the duration of a single electrical stimulation is 10 - 12 milliseconds.

[0012] To achieve the above object, according to the second aspect of the present invention, there is provided a method for preparing a cell line for screening drugs for treating the central nervous system. The preparation method includes: transfecting a first plasmid into a first cell line to obtain a cell line for screening drugs for treating the central nervous system; in the cell line for screening drugs for treating the central nervous system, from upstream to downstream, a first promoter, a gene of a fluorescent probe, a second promoter, a gene of an ion channel targeted by a candidate drug, and a reporter gene are sequentially connected; wherein, the first cell line contains a recombinase; in the genes of the first cell line, from upstream to downstream, a first promoter, a first recombination site, and a reporter gene are sequentially connected; in the genes of the first plasmid, from upstream to downstream, a second recombination site, a second promoter, a gene of an ion channel targeted by a candidate drug, and a gene of a fluorescent probe are sequentially connected; the recombinase has a nucleotide sequence as shown in SEQ ID NO: 9; the first recombination site has a nucleotide sequence as shown in SEQ ID NO: 7; the second recombination site has a nucleotide sequence as shown in SEQ ID NO: 8; the first cell line is a HEK293T cell line.

[0013] Further, the ion channel includes one or more of a sodium ion channel, a potassium ion channel, a calcium ion channel, a chloride ion channel, a potassium-sodium ion channel, or a magnesium ion channel.

[0014] Further, the fluorescent probe includes one or more of a membrane potential probe, a neurotransmitter probe, a calcium ion probe, or an ATP probe; the membrane potential probe includes one or more of Cepheid1b, pAce, ASAP, Voltron, Archon, or somArchon.

[0015] Further, in the above cell line, the nucleotide sequence of the gene of the fluorescent probe is a nucleotide sequence as shown in SEQ ID NO: 1; the nucleotide sequence of the reporter gene is a nucleotide sequence as shown in SEQ ID NO: 2; the nucleotide sequence of the gene of the ion channel targeted by the candidate drug is a gene with a nucleotide sequence as shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0016] To achieve the above object, according to the third aspect of the present invention, there is provided a cell line for screening drugs for treating the central nervous system, which is obtained by preparing with the above cell line for screening drugs for treating the central nervous system.

[0017] To achieve the above object, according to the fourth aspect of the present invention, there is provided an application of the above cell line for detecting the activity of drugs for treating the central nervous system, the preparation method of the above cell line for detecting the activity of drugs for treating the central nervous system, or the above detection method for detecting the activity of drugs for treating the central nervous system in detecting the activity of central nervous system drugs or evaluating or screening and evaluating drugs for treating central nervous system diseases.

[0018] By applying the technical solution of the present invention, after mixing a cell line expressing an ion channel and a fluorescent probe corresponding to a candidate drug with the candidate drug and performing electrical stimulation, the intensity of the fluorescent signal in the screening cell line is detected, and the activity of the candidate drug can be characterized by the change in the intensity of the fluorescent signal. Compared with the detection methods of the prior art, it is more efficient, accurate, has a lower detection cost, can be widely applied to the drug screening of the CNS, and promotes the research process of CNS drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The specification drawings forming a part of this application are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0020] Figure 1 The schematic diagram of the detection principle of the cell line for detecting the activity of drugs for treating the central nervous system according to the present invention is shown.

[0021] Figure 2 The fluorescence confocal imaging result diagram of the Cepheid1b-Kir2.1-Nav1.5 cell line according to Example 1 of the specification of the present invention is shown.

[0022] Figure 3 The change diagram of the Cepheid1b-Kir2.1-Nav1.5 cell line before and after treatment with lidocaine according to Example 1 of the specification of the present invention is shown; Figure 3 In which A is the cell of high-sensitivity Cepheid1b-Kir2.1-Nav1.5; Figure 3 In which B is the change diagram of the field stimulation response of the Cepheid1b-Kir2.1-Nav1.5 cell line after treatment with lidocaine.

[0023] Figure 4 The fluorescence confocal imaging result diagram of the Cepheid1b-Nav1.5 cell line according to Example 2 of the specification of the present invention is shown.

[0024] Figure 5 The change diagram of the Cepheid1b-Nav1.5 cell line before and after treatment with lidocaine according to Example 2 of the specification of the present invention is shown. Figure 5In A, the cells are highly sensitive Cepheid1b-Nav1.5 cells; Figure 5 In B, it is a graph showing the change in the field stimulation response of the Cepheid1b-Nav1.5 cell line after lidocaine treatment.

[0025] Figure 6 It shows a graph of the change in the Di-4-ANEPPS cell line of Comparative Example 1 according to the description of the present invention before and after field stimulation. Figure 6 In A, the cells are highly sensitive Di-4-ANEPPS cells; Figure 6 In B, it is a comparative change graph of the field stimulation responses of the Di-4-ANEPPS and Cepheid1b-Nav1.5 cell lines. Detailed implementation manners

[0026] It should be noted that, without conflict, the embodiments in this application and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0027] As mentioned in the background art, in the current mainstream technologies for the evaluation of new CNS drugs, the throughput of patch clamp electrophysiology is extremely low, while the accuracy of EEG and EMG is limited, the test cycle is long, the requirements for equipment are high, and the detection cost is high. Therefore, there is a lack of a method that can be widely applied to the screening of CNS drugs in the prior art. Based on this, in this application, the inventors attempt to develop a cell line for detecting the activity of drugs for treating the central nervous system. When applied to the detection of the activity of drugs for treating the central nervous system, it can accurately, effectively, and quickly detect the activity of drugs, reducing the overall detection cost of such drugs. Therefore, a series of protection schemes of this application are proposed.

[0028] In a first typical implementation manner of this application, a method for screening drugs for treating the central nervous system is provided. The method includes: mixing a cell line expressing an ion channel and a fluorescent probe corresponding to a candidate drug with the candidate drug to obtain a screening cell line; performing electrical stimulation on the screening cell line and detecting the intensity of the fluorescent signal in the screening cell line; the intensity of the fluorescent signal represents the activity of the candidate drug; wherein, in the gene of the cell line, from upstream to downstream, a first promoter, the gene of the fluorescent probe, a second promoter, the gene of the ion channel corresponding to the candidate drug, and a reporter gene are sequentially connected.

[0029] Fluorescence imaging technology has higher spatial resolution and detection throughput compared to traditional detection technologies. For example, among all methods for recording cell electrical signals, fluorescence membrane potential imaging has obvious advantages compared to traditional electrophysiological technologies such as patch clamp. Red fluorescent probes with emission wavelengths greater than 561 nm have stronger tissue penetration ability and are suitable for multi-channel imaging observation, and can be used in combination with common green calcium probes, neurotransmitter probes and other technologies. Among them, the mechanism of the rhodopsin-based genetically encoded membrane localization probe responding to membrane potential is as follows: Lysine residues inside the protein are covalently bound to the chromophore retinal molecule to form a Schiff base structure. The Schiff base is part of the retinal conjugated system, and its protonation level affects the absorption spectrum of the chromophore. The change in membrane potential changes the electrochemical potential of protons, thereby affecting the proton balance of the Schiff base. Specifically, when the cell depolarizes, the equilibrium moves in the direction of increasing protonation, and the absorption spectrum of rhodopsin increases, and vice versa, which sensitively affects the fluorescence intensity of the membrane potential probe, thereby accurately reporting the change in cell membrane potential.

[0030] However, developing a cell line that can stably characterize specific ion channels with fluorescent probes is a technical bottleneck that is difficult to break through in the prior art. For the detection of hERG channel activity in the prior art, although it can be achieved by adding fluorescent dyes, its specificity and sensitivity during activity detection still need to be improved. Because the dynamic characteristics of ion channels are difficult to capture by traditional fluorescence imaging technology, if the cell line expression is unstable, or there are deficiencies in specificity and sensitivity, it is difficult to accurately detect the activity of candidate drugs, resulting in incorrect guidance during the screening process of candidate drugs.

[0031] The cell line stably expressing ion channels and fluorescent probes in this application can specifically report the effect of candidate drugs (drugs related to ion channels) on specific ion channels. When performing CNS drug activity detection or screening, it has high sensitivity and flexibility, significantly improving the efficiency and accuracy of CNS drug screening closely related to ion channels. Compared with traditional technologies for screening and evaluating drugs related to ion channels, the present invention breaks through many methodological limitations, such as the low throughput and invasiveness in patch clamp technology, the non-cell selectivity and low accuracy in EEG and EMG technologies, and the high cost and long cycle in animal model behavioral experiments. The cell line of this application has sustainability, stability and high throughput, and is suitable for large-scale application in CNS drug screening.

[0032] Preferably, the above-mentioned first promoter is CMV promoter (SEQ ID NO: 5) or CAG promoter.

[0033] SEQ ID NO: 5: gtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct。

[0034] Preferably, the above-mentioned second promoter includes the CMV promoter and / or the EF1α promoter (SEQ ID NO: 6).

[0035] SEQ ID NO: 6: gggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacgggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacag。

[0036] The first promoter is the promoter that initiates the fluorescent probe gene in the cell line, while the second promoter is used to initiate the ion channel. If there are two or more ion channels in the cell line, then upstream of each ion channel corresponds to a connection with a promoter. For example, in a specific embodiment of the present application, the AttB-Cepheid1b-CMV-Kir2.1-EF1α-Nav1.5 plasmid contains two ion channels, namely Kir2. and Nav1.5, which are respectively connected to their corresponding promoters. When this plasmid is transfected into the cell line, the cell line itself has the above-mentioned first promoter. At this time, the connection order in the cell line is: the first promoter (CMV / CAG) - AttR (the first recombination site) - Cepheid1b - CMV (the second promoter 1) - Kir2.1 - EF1α (the second promoter 2) - Nav1.5 - attL (the second recombination site) - EBEP2 (the reporter gene).

[0037] Those skilled in the art can flexibly select any promoter for constructing the cell line according to actual needs to achieve the effects of the present application.

[0038] In a preferred embodiment, the ion channel comprises one or more of a sodium ion channel, a potassium ion channel, a calcium ion channel, a chloride ion channel, a potassium-sodium ion channel, or a magnesium ion channel. Preferably, it is a sodium ion channel, and more preferably Nav1.5 and / or Kir2.1.

[0039] In a preferred embodiment, the fluorescent probe comprises one or more of a membrane potential probe, a neurotransmitter probe, a calcium probe, or an ATP probe; the membrane potential probe comprises one or more of Cepheid1b, pAce, ASAP, Voltron, Archon, or somArchon. Preferably, the membrane potential probe is Cepheid1b (SEQ ID NO: 1).

[0040] In a preferred embodiment, in the above cell line, the nucleotide sequence of the gene of the fluorescent probe is SEQ ID NO: 1; the nucleotide sequence of the reporter gene is SEQ ID NO: 2; the nucleotide sequence of the gene of the ion channel targeted by the candidate drug is SEQ ID NO: 3 (Kir2.1) or SEQ ID NO: 4 (Nav1.5); the cell line is the LLP-HEK293T cell line. The above reporter gene is the EBFP2 gene.

[0041]

[0042] SEQ ID NO: 2: gtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgaggggcgagggcgagggcgatgccaccaacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgagccacggcgtgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcacctacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcgtcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaacttcaacagccacaacatctatatcatggccgtcaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacgtggaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacagccactacctgagcacccagtccgtgctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttccgcaccgccgccgggatcactctcggcatggacgagctgtacaag。

[0043]

[0044]

[0045] In a preferred embodiment, the screening cell line is subjected to electrical stimulation by applying an external electric field; the intensity of the electrical stimulation is 200-400 v / cm (including but not limited to 200, 250, 300, 350 or 400 v / cm), the frequency of the electrical stimulation is 3-5 Hz (including but not limited to 3, 3.5, 4, 4.5 or 5 Hz), the number of times of the electrical stimulation is 5-15 times (including but not limited to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 times), and the duration of a single electrical stimulation is 10-12 milliseconds (including but not limited to 10, 10.10, 10.15, 10.18, 10.20, 10.25, 10.30, 10.35, 10.40, 10.45, 10.50, 10.55, 10.60, 10.80, 10.90, 10.95, 11.00, 11.50 or 12.00 milliseconds).

[0046] This application uses an external electric field to stimulate the above-mentioned cell line and controls the parameters of the electrical stimulation within the above range, which can prompt the corresponding ion channels to respond and does not disrupt the balance of the cell line. By applying an external electric field in this application, the ion channels change, and the ion channels located on the cell membrane open, thereby further affecting the signal of the fluorescent probe in the cell line. By detecting the change in the intensity of the fluorescent signal, the electrophysiological properties of the cell line are studied to evaluate the effects of candidate drugs on excitable cells (such as nerve cells and cardiomyocytes).

[0047] In the second typical embodiment of this application, a method for preparing a cell line for screening drugs for treating the central nervous system is provided. The preparation method includes: transfecting a first plasmid into a first cell line to obtain a cell line for screening drugs for treating the central nervous system; in the cell line for screening drugs for treating the central nervous system, from upstream to downstream, a first promoter, a gene of a fluorescent probe, a second promoter, a gene of an ion channel corresponding to a candidate drug, and a reporter gene are sequentially connected; wherein, the first cell line contains a recombinase; in the gene of the first cell line, from upstream to downstream, a first promoter, a first recombination site, and a reporter gene are sequentially connected; in the gene of the first plasmid, from upstream to downstream, a second recombination site, the second promoter, the gene of the ion channel corresponding to the candidate drug, and the gene of the fluorescent probe are sequentially connected; the recombinase has a nucleotide sequence as shown in SEQ ID NO: 9; the first recombination site has a nucleotide sequence as shown in SEQ ID NO: 7; the second recombination site has a nucleotide sequence as shown in SEQ ID NO: 8; the first cell line is a HEK293T cell line.

[0048] SEQ ID NO: 7: gggtttgtctggtcaaccaccgcggtctcagtggtgtacggtacaaacc。

[0049] SEQ ID NO: 8: ccggcttgtcgacgacggcggtctccgtcgtcaggatcatcc。

[0050]

[0051] The cell line for screening drugs for treating the central nervous system mentioned above, the LLP-HEK293T cell line, refers to the HEK293T cell line constructed based on the Lenti-Landing Pad. Lenti-Landing Pad is a gene integration technology based on the lentivirus vector and the "landing pad" strategy, which is used to create specific "landing pads" in the mammalian cell genome to facilitate the subsequent efficient and specific insertion of foreign DNA fragments. Different from traditional random integration, this technology provides a predetermined integration site for foreign genes by pre-designing or inserting specific "landing pad" sequences in the host genome. Such "landing pads" can be specific DNA sequences used to guide integrase to insert foreign genes into specific positions.

[0052] The LLP-HEK293T cell line in this application contains stably expressed Bxb1 recombinase (SEQ ID NO: 9), a first promoter (SEQ ID NO: 2), an attP recombination site (SEQ ID NO: 7), and a reporter gene EBFP2 (SEQ ID NO: 2). When a plasmid containing an attB site (SEQ ID NO: 8), a second promoter (SEQ ID NO: 6), a gene of an ion channel, and a gene of a fluorescent probe is transfected into the cell line, through the catalytic action of Bxb1 recombinase, the second promoter, the gene of the ion channel, and the gene of the fluorescent probe can be stably inserted between the first promoter and the attP recombination site, silencing the expression of the reporter gene, and forming the above-mentioned cell line that can stably express the ion channel and fluorescent probe corresponding to the candidate drug. Mixing this cell line with a candidate drug targeting this ion channel and applying electrical stimulation, the expression of the ion channel changes, thus causing a change in the intensity of the fluorescence signal. By detecting the intensity of the fluorescence signal, the activity of the candidate drug is characterized, providing a theoretical basis for the screening of new CNS drugs, and having sustainability, stability, and high throughput, being suitable for large-scale application in CNS drug screening.

[0053] For the construction of the cell line of the present invention, a monoclonal expanded LLP (Lenti landing pad) HEK293T cell line is used. In this cell line, Bxb1 recombinase, attP recombination site and reporter gene EBFP2 are stably expressed. After transfecting the plasmid containing the ion channel gene with attB and the fluorescent probe into this cell line, the expression of the reporter gene EBFP2 in the cell line can be silenced, and the specific ion channel gene and the fluorescent probe are inserted into the fixed attP recombination site in the genome, thus realizing the stable expression of the ion channel and the fluorescent probe. When the candidate drug is mixed with the cell line of the present application, the cell membrane surface potential of the cell line changes. By using a high-throughput optical recording system to record and detect the fluorescence signal, the effect and activity of the candidate drug on the specific ion channel are characterized. The schematic diagram of the detection principle of the cell line of the present application is as Figure 1 shown, where "attR" and "attL" refer to the sites generated after the recombination of attP and attB by the recombinase; "CMV / CAG" refers to the type of the first promoter.

[0054] Through a large number of screenings by the inventors of the present application, it is found that Bxb1 recombinase and attP recombination site can be adapted to the LLP-HEK293T cell line and the reporter gene of the present application, can realize the efficient and stable integration of the ion channel gene and the fluorescent probe with the cell line gene of the present application, reduce the randomness of gene insertion, improve the success rate of cell line construction, and can avoid the instability of gene expression and the expression difference between cells during the subsequent detection process. Finally, a cell line with high sensitivity and strong specificity is constructed, enhancing the accuracy of drug screening.

[0055] Bxb1 recombinase can catalyze the DNA molecule recombination reaction, can promote the integration of the genome by recognizing specific sites, such as attP site (SEQ ID NO: 7) and attB site (SEQ ID NO: 8). The recombination site in the cell line is the "landing point" in the LLP-HEK293T cell line of the present application. The attP site is located in the LLP-HEK293T cell line, and the attB site is on the plasmid containing the ion channel and fluorescent probe corresponding to the target of the candidate drug. When the latter is transfected into the LLP-HEK293T cell line, Bxb1 recombinase can recognize and insert it, and does not affect the expression of each element, so that it can still stably express its function during detection to detect the activity of the candidate drug. The reporter gene EBFP2 is used to monitor the changes in the intracellular environment, including the change of cell membrane potential, and provides immediate feedback on the drug action. The use of EBFP2 makes the drug screening process more intuitive, can quickly evaluate the effect of the drug on the cell membrane potential, and provides immediate data support for drug optimization.

[0056] The preparation method of the LLP-HEK293T cell line of the present application specifically includes:

[0057] Adopt the pCMV-dR8.91 / pVSV-G lentiviral packaging strategy. Lentiviruses are produced in HEK293T cells. Cultivate HEK293T cells. When the cell density in the cell culture system ≥ 90% (referring to the area occupancy of cells in the culture container), use Lipo3000 for transfection. Transfect the expression plasmid (pLX304 plasmid, plx304-CAG (promoter SEQ ID NO: 10)-attP (recombination site SEQ ID NO: 7)-EBFP2 (reporter gene SEQ ID NO: 2)-P2A (self-cleaving polypeptide element for co-expression of multiple genes, SEQ ID NO: 11)-Bxb1 (recombinase SEQ ID NO: 9)-T2A (self-cleaving polypeptide element for co-expression of multiple genes, SEQ ID NO: 12)-BSD (marker gene in the plasmid, encoding a protein that can degrade puromycinase, enabling cells to survive in the selection medium containing puromycin, SEQ ID NO: 13)), the first auxiliary plasmid pCMV-dR8.91 (https: / / www.addgene.org / vector-database / 2221 / , lentiviral packaging auxiliary plasmid, providing the structural and regulatory proteins required for viral particle assembly, ensuring normal replication and packaging of the virus), and the second auxiliary plasmid pCMV-VSV-G (addgene #8454, lentiviral packaging auxiliary plasmid, VSV-G is a viral envelope protein that can replace the envelope protein in the original virus, improving the infection efficiency of the virus) according to the molar ratio of 1:1:0.7. After 4 - 8 hours of transfection, change the medium to fresh DMEM + 10% FBS. After 40 hours, collect the virus suspension and filter it through a 0.45 μm filter membrane. After filtration, aliquot, quickly freeze in liquid nitrogen and store at -80 °C.

[0058] Before virus infects cells, conduct an infection test with a 10-fold dilution for each gradient, select a dilution ratio with an MOI of approximately 0.1 to infect for 24 - 48 hours, and the cell density before infection needs to reach 60%.

[0059] If a single-cell clone needs to be obtained from the LLP-HEK293T cell line prepared according to the above preparation method, flow sorting is required. If only a stable transfected cell line is needed, change the medium to DMEM + 10% FBS containing 5 μg / mL blasticidin for selection. The cell line is cultured in DMEM + 10% FBS containing 2.5 μg / mL blasticidin (Selleck, S7419) to maintain the positive rate.

[0060] The above-mentioned flow sorting method includes: preparing an ice box, digesting the LLP cell line transfected with plasmid, resuspending it with HBSS solution containing 2% FBS (Gibco, C14175500BT), then placing it in the ice box, and pre-cooling DMEM medium containing 10% FBS and 10% Penicillin-streptomycin double antibody (Beyotime, C0222). Collect the cells that are positive in the PE channel and negative in the PB channel according to the procedure using an AriaIII high-performance flow cytometer; place the collected cells in DMEM medium containing 10% FBS and 10% Penicillin-streptomycin double antibody, and then transfer them to a culture dish of appropriate size for culture. The newly obtained cell line is recorded as the cell line for screening drugs for treating the central nervous system.

[0061] SEQ ID NO: 10: tggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcg。

[0062] SEQ ID NO: 11: ggctctggagccaccaacttcagcctgctgaagcaggcaggcgacgtggaagagaaccctggccct。

[0063] SEQ ID NO: 12: cggtgacgtggaggagaatcccggccct。

[0064] SEQ ID NO: 13: gcc aag cct ttg tct caa gaa gaat cca ccc tca ttg aaa gag caa cgg cta caa tca aca gca tcc cca tct ctg aag act aca gcg tcg cca gcg cag ctg ctg ctg cgg cag ctg gca acc tga ctt gta tcg tcg cga tcg gaa atg aga aca ggg gca tct tga gcc cct gcg gac ggt gcc gac agg tgc ttc tcg atc tgc atc ctg gga tca aag cca tag tga agg aca gt gat gga cag ccg acg gc agt tgg gatt cgt gaa ttg ctg ccc tct ggt tat gtg tgg gag ggc。

[0065] Preferably, the first promoter is CMV (SEQ ID NO: 5) or CAG. Preferably, the second promoter includes CMV and / or EF1α promoter (SEQ ID NO: 6).

[0066] In a preferred embodiment, the ion channel includes one or more of a sodium ion channel, a potassium ion channel, a calcium ion channel, a chloride ion channel, a potassium-sodium ion channel, or a magnesium ion channel. Preferably, it is a sodium ion channel, and more preferably Nav1.5 or Kir2.1.

[0067] In a preferred embodiment, the fluorescent probe includes one or more of a membrane potential probe, a neurotransmitter probe, a calcium ion probe, or an ATP probe. The membrane potential probe includes one or more of Cepheid1b, pAce, ASAP, Voltron, Archon, or somArchon. Preferably, the membrane potential probe is Cepheid1b.

[0068] In a preferred embodiment, in the above cell line, the nucleotide sequence of the gene of the fluorescent probe is SEQ ID NO: 1; the nucleotide sequence of the reporter gene is SEQ ID NO: 2; the nucleotide sequence of the gene of the ion channel targeted by the candidate drug is SEQ ID NO: 3 or SEQ ID NO: 4.

[0069] In a preferred embodiment, the above transfection includes liposome transfection.

[0070] In a preferred embodiment, liposome transfection includes Lipofectamin 3000 transfection. The above transfection methods include but are not limited to the transfection methods of the present application. By using transfection means known to those skilled in the art, the effects of the present application can be achieved, and those skilled in the art can flexibly select according to the actual situation.

[0071] In the third typical embodiment of the present application, a cell line for screening drugs for treating the central nervous system is provided, and this cell line is obtained by preparing from the above cell line for screening drugs for treating the central nervous system.

[0072] In the fourth typical embodiment of the present application, there is provided an application of the above cell line for detecting the activity of drugs for treating the central nervous system, the preparation method of the above cell line for detecting the activity of drugs for treating the central nervous system, or the detection method of the above cell line for detecting the activity of drugs for treating the central nervous system in detecting the activity of central nervous system drugs or evaluating or screening and evaluating drugs for treating central nervous system diseases.

[0073] The beneficial effects of the present application will be further explained in detail below with specific embodiments.

[0074] Example 1

[0075] Molecular cloning: Mix the DNA fragment (EF1α-Nav1.5-Attb) linked with the target gene and the DNA fragment of the expression vector (Cepheid1b-CMV-Kir2.1) with Gibson recombinase (Lightening Cloning Kit, Biodragon, BDIT0014-100) to construct the plasmid AttB-Cepheid1b-CMV-Kir2.1-EF1α-Nav1.5. Verify the successfully transformed monoclonal by Sanger sequencing, and extract the plasmid from the correctly sequenced clone.

[0076] Preparation of the LLP HEK293T cell line:

[0077] Lentivirus production adopts the pCMV-dR8.91 / pVSV-G lentivirus packaging strategy, and lentivirus is produced in HEK293T cells.

[0078] When the density of HEK293T cells reaches over 90%, transfect the expression plasmid (pLX304 plasmid), pCMV-dR8.91 (https: / / www.addgene.org / vector-database / 2221 / ), and pCMV-VSV-G (addgene #8454) using Lipo3000 at a molar ratio of 1:1:0.7. After 4 - 8 hours of transfection, change the medium to fresh DMEM + 10% FBS. After 40 hours, collect the virus suspension and filter it through a 0.45 μm filter membrane.

[0079] After filtration, aliquot the virus suspension, quickly freeze it in liquid nitrogen, and store it at -80 °C. Before infecting cells, perform an infection test with a 10-fold dilution for each gradient. Select a dilution ratio with an MOI of approximately 0.1 to infect cells for 24 - 48 hours, with the cell density reaching 60% before infection. LLC cell line culture: Inoculate the LLC HEK 293T cell line into a 10 cm culture dish (Thermo, 150466) and add DMEM medium (Gibco, C11995500BT) containing 10% v / v fetal bovine serum (FBS, Gibco, 10099141C). Incubate the cells in a cell culture incubator at 37 °C and 5% CO 2 2 environment until the cell density reaches 70 - 90% for transfection.

[0080] LLC cell line transfection: Transfect the cells with Lipofectamine 3000 reagent (Gibco, L3000008) according to the manufacturer's instructions. The specific amounts used are 5500 ng of AttB-Cepheid1b-CMV-Kir2.1-EF1α-Nav1.5 plasmid, 16 μL of Lipo3000, 11 μL of P3000, and two portions of 250 μL of Opti-MEM medium (Gibco, 31985062). The transfection duration is 6 hours.

[0081] Flow sorting: Prepare an ice box. After digesting the LLP cell line transfected with the plasmid, resuspend it with HBSS solution containing 2% FBS (Gibco, C14175500BT), then place it in the ice box, and pre-cool the DMEM medium containing 10% FBS and 10% Penicillin-streptomycin double antibody (Beyotime, C0222). Collect the cells with positive PE channel and negative PB channel using the AriaIII high-performance flow cytometer according to the procedure. The collected cells are placed in the DMEM medium containing 10% FBS and 10% Penicillin-streptomycin double antibody, and then transferred to a culture dish of appropriate size for culture. The newly obtained cell line is denoted as the Cepheid1b-Kir2.1-Nav1.5 cell line.

[0082] Fluorescence confocal imaging: Image the obtained Cepheid1b-Kir2.1-Nav1.5 cell line using a fluorescence confocal microscope. The results are as Figure 2 shown. Figure 2 The left figure in the middle is the bright-field image, Figure 2 and the right figure in the middle is the fluorescence localization result image. The results show that the membrane localization of the gene-encoded membrane potential probe Cepheid1b is good and can be used for subsequent field stimulation voltage imaging tests. In the confocal imaging experiment, a laser (Coherent OBIS 561 nm) and a scientific CMOS camera (Hamamatsu ORCA-Flash 4.0 v2) were used, and a spinning disk confocal module (Yokogawa CSU-X1) was used. The filter parameters used in this example are as follows: excitation light 561nm (Laser) 555nm / 28 (LED), dichroic mirror ZET594rdc, fluorescence filter ET630 / 75m.

[0083] Evaluate the efficacy of sodium channel inhibitors: Mix different concentrations of lidocaine with the above constructed cell line respectively, and then perform electrical stimulation five minutes after adding the drug. Input corresponding to 10 field stimulations (intensity 300V / cm, frequency 3.28 Hz, stimulation duration 10.18 milliseconds, i.e., duty cycle 3.33%), and use Cepheid1b to record the change of cell fluorescence signal (600 frames, sampling rate 196.6 Hz. Total 3.053 seconds).

[0084] The evaluation results are as Figure 3 shown, where Figure 3The left figure of A is a bright-field image, and the right figure is the corresponding fluorescence cell result image. The fluorescently labeled cells shown in the right figure are the cells of highly sensitive Cepheid1b-Kir2.1-Nav1.5 that have responded. The scale bar is 100 μm; Figure 3 Figure B shows the change in the field stimulation response of the Cepheid1b-Kir2.1-Nav1.5 cell line after lidocaine treatment. Among them, the red short lines mark the periods of electrical stimulation.

[0085] It can be seen from Figure 3 that the Cepheid1b-Kir2.1-Nav1.5 cell line can generate "action potentials" when stimulated electrically (the stimulation periods marked in red). When lidocaine (L129221) with different concentrations is added, it will inhibit the sodium channels, thus affecting the frequency and amplitude of its potential changes.

[0086] Example 2

[0087] Construct the Cepheid1b-Nav1.5 cell line: Use Gibson recombinase to construct the AttB-Cepheid1b-EF1α-Nav1.5 plasmid. The plasmid in this example does not contain "CMV-Kir2.1", and all other steps are the same as in Example 1.

[0088] The fluorescence confocal imaging results of the cell line in this example are as Figure 4 shown. Figure 4 The left figure in is a bright-field image, Figure 4 and the right figure is the fluorescence localization result image. It can be seen that the membrane localization of the gene-encoded membrane potential probe Cepheid1b in the Cepheid1b-Nav1.5 cell line is good.

[0089] The results of high-throughput optical recording of field stimulation in this example are as Figure 5 shown. Figure 5 The left figure of A in is a bright-field image, and the right figure is the corresponding fluorescence cell result image. The fluorescently labeled cells shown in the right figure are the cells of highly sensitive Cepheid1b-Nav1.5 that have responded. The scale bar is 100 μm; Figure 5 Figure B in shows the change in the field stimulation response of the Cepheid1b-Nav1.5 cell line after lidocaine treatment, indicating that the Cepheid1b-Nav1.5 cell line can generate "action potentials" when stimulated electrically (the stimulation periods marked in red), and at the same time can characterize the inhibitory effect of lidocaine on sodium channels.

[0090] Comparative Example 1

[0091] The difference between the cell line of this comparative example and that of Example 1 is that the cell line in this comparative example does not contain a fluorescent probe, but instead contains the membrane potential dye Di-4-ANEPPS (d1199, concentration 3 μM, treatment time 5 min). The procedure for treating the cell line with the membrane potential dye is to dilute the 3 mM Di-4-ANEPPS stock solution to 3 μM with DMEM medium (C11995500BT), then replace the cell culture medium and label for 5 minutes, and then place it in Tyrode's solution (CC018) for imaging.

[0092] Electrical stimulation was applied to the cell line of this comparative example and the cell line of Example 1. The high-throughput optical recording results of the field stimulation in this comparative example are as Figure 6 shown, where Figure 6 for A in it, the left figure is the bright-field image and the right figure is the fluorescence cell result image of the response, and the scale bar is 100 μm; Figure 6 for B in it, it is a schematic diagram comparing the sensitivity of the Kir2.1-NaV1.5 cell line labeled with the Di-4-ANEPPS membrane potential dye with that of the Cepheid1b cell line.

[0093] From the above description, it can be seen that the above embodiments of the present invention have achieved the following technical effects: The cell line used in this application for detecting the activity of drugs for treating the central nervous system can stably express specific ion channels related to the candidate drug, as well as a fluorescent probe. When the candidate drug acts on the ion channels in the cell line of this application, the reporter gene can respond in a timely manner and change the intensity of the fluorescence signal. By detecting the membrane potential signal of the cell line, the activity of the candidate drug and its effect on the ion channel can be characterized. Compared with the existing methods for evaluating CNS drugs, the method for detecting the activity of CNS drugs using the above cell line in this application overcomes the problems of low throughput, invasiveness, cell non-selectivity, and low accuracy, and is more suitable for large-scale application in the screening and evaluation of CNS drugs, promoting the development of the CNS research field.

[0094] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for screening drugs for treating the central nervous system, characterized in that: The method comprises: Mixing a cell line expressing an ion channel and a fluorescent probe corresponding to the target of a candidate drug with the candidate drug to obtain a screening cell line; electrically stimulating the screened cell line, and detecting the intensity of the fluorescent signal in the screened cell line; The intensity of the fluorescent signal indicates the activity of the candidate drug; Wherein, in the genes of the cell line, from upstream to downstream, the first promoter, the gene of the fluorescent probe, the second promoter, the gene of the ion channel targeted by the candidate drug, and the reporter gene are connected in sequence; The nucleotide sequence of the reporter gene is SEQ ID NO: 2; The nucleotide sequence of the gene of the ion channel targeted by the candidate drug is SEQ ID NO: 3 or SEQ ID NO:

4.

2. The method according to claim 1, characterized in that: The fluorescent probe includes a membrane potential probe.

3. The method according to claim 2, characterized in that The membrane potential probe includes one or more of Cepheid1b, pAce, ASAP, Voltron, Archon or somArchon.

4. The method according to claim 3, characterized in that In the cell line, the nucleotide sequence of the gene of the fluorescent probe is SEQ ID NO:

1.

5. The method according to claim 1, characterized in that The electrical stimulation is performed by applying an external electric field to the screened cell line; The intensity of the electrical stimulation is 200-400 v / cm, the frequency of the electrical stimulation is 3-5 Hz, the number of electrical stimulations is 5-15 times, and the duration of a single electrical stimulation is 10-12 milliseconds.

6. A method for preparing a cell line for screening drugs for treating the central nervous system, characterized in that: The preparation method comprises: transfecting the first plasmid into the first cell line to obtain the cell line for screening drugs for treating the central nervous system; In the cell line for screening drugs for treating the central nervous system, from upstream to downstream, a first promoter, a gene of the fluorescent probe, a second promoter, a gene of the ion channel targeted by the candidate drug, and a reporter gene are sequentially connected; wherein the first cell line contains a recombinase; In the genes of the first cell line, the first promoter, the first recombination site and the reporter gene are connected in sequence from upstream to downstream; In the genes of the first plasmid, from upstream to downstream, the second recombination site, the second promoter, the gene of the ion channel targeted by the candidate drug, and the gene of the fluorescent probe are connected in sequence; The nucleotide sequence of the recombinase is SEQ ID NO: 9; The nucleotide sequence of the first recombination site is SEQ ID NO: 7; The nucleotide sequence of the second recombination site is SEQ ID NO: 8; The first cell line is a HEK293T cell line; The nucleotide sequence of the reporter gene is SEQ ID NO: 2; The nucleotide sequence of the gene of the ion channel targeted by the candidate drug is SEQ ID NO: 3 or SEQ ID NO:

4.

7. The cell line according to claim 6, characterized in that The fluorescent probe includes a membrane potential probe.

8. The cell line according to claim 7, characterized in that The membrane potential probe includes one or more of Cepheid1b, pAce, ASAP, Voltron, Archon or somArchon.

9. The cell line according to claim 8, characterized in that In the cell line, the nucleotide sequence of the gene of the fluorescent probe is the nucleotide sequence shown in SEQ ID NO:

1.

10. A cell line for screening drugs for treating the central nervous system, characterized in that: The cell line is prepared by the cell line for screening drugs for treating the central nervous system according to any one of claims 6 to 9.

Citation Information

Patent Citations

  • Preparation method of heterodimer membrane protein ion channel cell model

    CN117363580A

  • Heterologous stimulus-gated ion channels and methods of using same

    US20040023203A1

  • Fluorescent protein voltage sensors for measuring membrane potential and imaging high-frequency neuronal electrical activity

    US20150132774A1

  • Receptors for cyclic dinucleotides and methods for screening agonists or inhibitors thereof

    US20240019418A1

  • Cell engineering compositions and methods using fluorogenic oligonucleotide signaling probes and flow cytometry

    US20240117417A1