Method for screening drugs for treating central nervous system, cell line and application thereof
By expressing the ion channel and fluorescent probe corresponding to the candidate drug in the cell line, and detecting the fluorescence signal intensity in combination with electrical stimulation, the low throughput and high cost of the central nervous system drug screening method in the prior art is solved, and efficient and accurate large-scale drug screening is achieved.
Patent Information
- Application Number
- CN202510587175.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-08-15
- Estimated Expiration
- 2045-05-08
AI Technical Summary
There is a lack of an efficient, accurate and economical method that can be applied on a large scale to the central nervous system drug screening, especially when detecting changes in ion channel activity, there are problems such as low flux, high cost and long cycles.
Cell lines expressing the targeted ion channels and fluorescent probes corresponding to the candidate drug are mixed with the candidate drug and subjected to electrical stimulation. The drug activity is characterized by detecting the intensity of the fluorescent signal. The genes of the cell line are connected in sequence by the first promoter, the genes of the fluorescent probe, the second promoter, the genes of the candidate drug corresponding to the targeted ion channels and reporter genes.
It realizes efficient and accurate large-scale drug screening, reduces detection costs, improves detection throughput and sensitivity, and is suitable for the screening of central nervous system drugs.
Smart Images

Figure CN120118972B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical engineering, and in particular to a method for screening drugs for treating the central nervous system, a cell line and applications thereof. Background Art
[0002] Central nervous system (CNS) diseases, including neurodegenerative diseases, neuropsychiatric disorders, and neurological dysfunction, are a major threat to global health, and their devastating impact on human health cannot be underestimated. While CNS disease research, particularly in drug development, is considered the second most sought-after field after cancer, the R&D process is fraught with challenges. For example, despite over $200 billion invested in drug development, the success rate of clinical trials for Alzheimer's disease (AD) remains exceptionally low, with a failure rate as high as 99.6%, far exceeding the clinical failure rate of oncology drugs (92%) (Int Rev Neurobiol, Germán Plascencia-Villa, 2020).
[0003] The current challenges facing CNS drug development stem primarily from the complexity of disease mechanisms and the lack of effective disease models. This results in drug development focused solely on disease characterization rather than directly targeting the disease process, increasing the difficulty and uncertainty of experimental design. The pathophysiology of CNS diseases is closely linked to the regulation of ion channel activity. The Nav1.7 subtype of voltage-gated sodium channels (VGSCs) plays a central role in electrical signaling in nociceptive sensory neurons, while the Nav1.8 subtype is a hot topic in pain research. Therefore, developing drug screening technologies that can efficiently and accurately detect changes in ion channel activity is crucial.
[0004] Current mainstream technologies used for evaluating new CNS drugs, such as patch-clamp electrophysiology, can screen cells expressing specific ion channels, but their throughput is extremely low, and the number of cells evaluated at a time is limited, typically less than 10. Furthermore, the high technical requirements for operation make large-scale application difficult. Furthermore, the CNS field involves a wide range of diseases, including but not limited to depression, anxiety, pain, epilepsy, and stroke. These diseases typically use animal models for behavioral experiments to evaluate drug efficacy, but this method is costly, time-consuming, and has low throughput. Furthermore, while electroencephalography (EEG) and electromyography (EMG) can be used to detect changes in brain chemicals and evaluate the efficacy of drugs such as sleep medications, anti-epileptic drugs, and anesthetics, their accuracy is limited, and due to the equipment requirements and long experimental cycles, the cost is also high.
[0005] Given the above limitations, there is an urgent need for a more efficient, accurate, economical and large-scale drug screening technology to accelerate the development of new drugs in the CNS field. Summary of the Invention
[0006] The main purpose of the present invention is to provide a method for screening drugs for treating the central nervous system, a cell line and its application, so as to solve the problem in the prior art of lacking a method that can be applied on a large scale to CNS drug screening.
[0007] In order to achieve the above-mentioned purpose, according to the first aspect of the present invention, a method for screening drugs for treating the central nervous system is provided, which method comprises: mixing a cell line expressing an ion channel and a fluorescent probe corresponding to the target of a candidate drug with the candidate drug to obtain a screening cell line; electrically stimulating the screening cell line and detecting the intensity of the fluorescent signal in the screening cell line; the intensity of the fluorescent signal indicates the activity of the candidate drug; wherein, in the genes of the cell line, from upstream to downstream, a first promoter, a gene of the fluorescent probe, a second promoter, a gene of the ion channel corresponding to the target of the candidate drug and a reporter gene are connected in sequence.
[0008] Furthermore, the ion channel includes one or more of a sodium ion channel, a potassium ion channel, a calcium ion channel, a chloride ion channel, a potassium-sodium ion channel or a magnesium ion channel.
[0009] Furthermore, the fluorescent probe includes one or more of a membrane potential probe, a neurotransmitter probe, a calcium ion probe or an ATP probe; the membrane potential probe includes one or more of Cepheid1b, pAce, ASAP, Voltron, Archon or somArchon.
[0010] Furthermore, in the above cell line, the nucleotide sequence of the fluorescent probe gene is SEQ ID NO: 1; the nucleotide sequence of the reporter gene is SEQ ID NO: 2; and the nucleotide sequence of the gene of the ion channel targeted by the candidate drug is SEQ ID NO: 3 or SEQ ID NO: 4.
[0011] Furthermore, electrical stimulation is performed by applying an external electric field to the screened cell line; the intensity of the electrical stimulation is 200-400 v / cm, the frequency of the electrical stimulation is 3-5 Hz, the number of electrical stimulations is 5-15 times, and the duration of a single electrical stimulation is 10-12 milliseconds.
[0012] To achieve the above-mentioned object, according to a second aspect of the present invention, a method for preparing a cell line for screening drugs for treating the central nervous system is provided, the preparation method comprising: transfecting a first plasmid into a first cell line to obtain a cell line for screening drugs for treating the central nervous system; in the cell line for screening drugs for treating the central nervous system, a first promoter, a gene for a fluorescent probe, a second promoter, a gene for an ion channel targeted by the candidate drug, and a reporter gene are sequentially connected from upstream to downstream; wherein the first cell line contains a recombinase; in the genes of the first cell line, the first promoter, a first recombination site, and a reporter gene are sequentially connected from upstream to downstream; in the genes of the first plasmid, the second recombination site, a second promoter, a gene for an ion channel targeted by the candidate drug, and a fluorescent probe gene are sequentially connected from upstream to downstream; the recombinase has a nucleotide sequence as shown in SEQ ID NO: 9; the first recombination site has a nucleotide sequence as shown in SEQ ID NO: 7; the second recombination site has a nucleotide sequence as shown in SEQ ID NO: 8; and the first cell line is a HEK293T cell line.
[0013] Furthermore, the ion channel includes one or more of a sodium ion channel, a potassium ion channel, a calcium ion channel, a chloride ion channel, a potassium-sodium ion channel or a magnesium ion channel.
[0014] Furthermore, the fluorescent probe includes one or more of a membrane potential probe, a neurotransmitter probe, a calcium ion probe or an ATP probe; the membrane potential probe includes one or more of Cepheid1b, pAce, ASAP, Voltron, Archon or somArchon.
[0015] Furthermore, in the above-mentioned cell line, the nucleotide sequence of the fluorescent probe gene is the nucleotide sequence shown in SEQ ID NO: 1; the nucleotide sequence of the reporter gene is the nucleotide sequence shown in SEQ ID NO: 2; and the nucleotide sequence of the gene of the ion channel targeted by the candidate drug is the gene with the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4.
[0016] To achieve the above object, according to a third aspect of the present invention, a cell line for screening drugs for treating the central nervous system is provided. The cell line is prepared from the above cell line for screening drugs for treating the central nervous system.
[0017] In order to achieve the above-mentioned purpose, according to the fourth aspect of the present invention, there is provided a cell line for detecting the activity of drugs for treating the central nervous system, a method for preparing the cell line for detecting the activity of drugs for treating the central nervous system, or the use of the detection method for detecting the activity of drugs for treating the central nervous system in detecting the activity of drugs for treating the central nervous system or evaluating or screening and evaluating drugs for treating central nervous system diseases.
[0018] By applying the technical solution of the present invention, a cell line expressing an ion channel and a fluorescent probe corresponding to the target of a candidate drug is mixed with the candidate drug, and after electrical stimulation, the intensity of the fluorescent signal in the screening cell line is detected. The activity of the candidate drug can be characterized by the change in the fluorescence signal intensity. Compared with the detection methods in the prior art, this method is more efficient and accurate, has a lower detection cost, and can be applied on a large scale to CNS drug screening, thereby promoting the research progress of CNS drugs. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] The accompanying drawings, which constitute part of this application, are intended to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are intended to explain the present invention and do not constitute an undue limitation of the present invention. In the accompanying drawings:
[0020] Figure 1 A schematic diagram of the cell line detection principle for detecting the activity of drugs for treating the central nervous system according to the present invention is shown.
[0021] Figure 2 The figure shows the fluorescence confocal imaging results of the Cepheid1b-Kir2.1-Nav1.5 cell line according to Example 1 of the present specification.
[0022] Figure 3 The diagram shows the changes in Cepheid1b-Kir2.1-Nav1.5 cell lines before and after treatment with lidocaine according to Example 1 of the present specification; Figure 3 Middle A shows cells with high sensitivity of Cepheid1b-Kir2.1-Nav1.5; Figure 3 Middle B is a graph showing the changes in the field stimulation response of the Cepheid1b-Kir2.1-Nav1.5 cell line after lidocaine treatment.
[0023] Figure 4 The figure shows the fluorescence confocal imaging results of the Cepheid1b-Nav1.5 cell line according to Example 2 of the present specification.
[0024] Figure 5 Graphs showing changes in Cepheid1b-Nav1.5 cell lines before and after lidocaine treatment according to Example 2 of the present specification are shown. Figure 5Middle A shows cells with high sensitivity to Cepheid1b-Nav1.5; Figure 5 Middle B is a graph showing the changes in the field stimulation response of the Cepheid1b-Nav1.5 cell line after lidocaine treatment.
[0025] Figure 6 The graph shows the changes of the Di-4-ANEPPS cell line before and after field stimulation according to Comparative Example 1 of the present invention. Figure 6 A in the middle is a cell with high sensitivity to Di-4-ANEPPS; Figure 6 Middle B is a comparative diagram of the field stimulation responses of Di-4-ANEPPS and Cepheid1b-Nav1.5 cell lines. DETAILED DESCRIPTION
[0026] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below with reference to the embodiments.
[0027] As mentioned in the background art, among the current mainstream technologies used for evaluating new CNS drugs, patch clamp electrophysiology has extremely low flux, while EEG and EMG have limited accuracy, long test cycles, high equipment requirements, and high testing costs. Therefore, the existing technology lacks a method that can be applied on a large scale to CNS drug screening. Based on this, in this application, the inventors attempt to develop a cell line for detecting the activity of drugs for treating the central nervous system. When used in detecting the activity of drugs for treating the central nervous system, this cell line can accurately, effectively, and quickly detect the activity of drugs, reducing the overall testing cost of such drugs, and thus propose a series of protection schemes for this application.
[0028] In a first typical embodiment of the present application, a method for screening drugs for treating the central nervous system is provided, the method comprising: mixing a cell line expressing an ion channel and a fluorescent probe targeted by a candidate drug with the candidate drug to obtain a screening cell line; electrically stimulating the screening cell line and detecting the intensity of the fluorescent signal in the screening cell line; the intensity of the fluorescent signal indicates the activity of the candidate drug; wherein, in the genes of the cell line, from upstream to downstream, a first promoter, a gene of the fluorescent probe, a second promoter, a gene of the ion channel targeted by the candidate drug, and a reporter gene are sequentially connected.
[0029] Fluorescence imaging offers higher spatial resolution and detection throughput than traditional detection techniques. For example, among all methods for recording cellular electrical signals, fluorescence membrane potential imaging offers significant advantages over traditional electrophysiological techniques such as patch clamping. Red fluorescent probes with emission wavelengths greater than 561 nm have enhanced tissue penetration and are suitable for multi-channel imaging observations, enabling integration with commonly used green calcium probes, neurotransmitter probes, and other techniques. Genetically encoded membrane-localized probes based on rhodopsin respond to membrane potential by covalently binding to the chromophore retinal molecule within the protein to form a Schiff base structure. The Schiff base is part of the retinal conjugated system, and its protonation level affects the chromophore's absorption spectrum. Changes in membrane potential alter the electrochemical potential of protons, thereby affecting the proton balance of the Schiff base. Specifically, when the cell depolarizes, the equilibrium shifts toward increased protonation, enhancing the rhodopsin absorption spectrum and decreasing it. This sensitively affects the fluorescence intensity of the membrane potential probe, thereby accurately reporting changes in the cell's membrane potential.
[0030] However, developing cell lines capable of stably expressing fluorescent probes for specific ion channels remains a difficult technical bottleneck. While hERG channel activity can be detected by adding fluorescent dyes, the specificity and sensitivity of detecting activity still need to be improved. Because the dynamic properties of ion channels are difficult to capture using traditional fluorescence imaging techniques, instability in cell line expression or a lack of specificity and sensitivity can make it difficult to accurately detect the activity of drug candidates, leading to misleading guidance during the candidate screening process.
[0031] The cell lines stably expressing ion channels and fluorescent probes in this application can specifically report the effects of candidate drugs (drugs related to ion channels) on specific ion channels. They offer high sensitivity and flexibility when performing CNS drug activity detection or screening, significantly improving the efficiency and accuracy of CNS drug screening for drugs closely related to ion channels. Compared to traditional screening and evaluation techniques for ion channel-related drugs, the present invention overcomes numerous methodological limitations, such as the low throughput and invasiveness of patch clamp technology, the non-cell selectivity and low accuracy of EEG and EMG techniques, and the high cost and long cycle times of behavioral animal model experiments. The cell lines described in this application are sustainable, stable, and high-throughput, making them suitable for large-scale application in CNS drug screening.
[0032] Preferably, the first promoter is CMV promoter (SEQ ID NO: 5) or CAG promoter.
[0033] SEQ ID NO: 5: gtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgtttt ggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct.
[0034] Preferably, the second promoter includes CMV promoter and / or EF1α promoter (SEQ ID NO: 6).
[0035] SEQ ID NO: 6: gggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacgggtgcctagagaaggtggcgcggggtaaactgggaaagtgat gtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacag.
[0036] The first promoter is the one that activates the fluorescent probe gene in the cell line, while the second promoter is used to activate the ion channel. If the cell line contains two or more ion channels, each ion channel is connected upstream to a corresponding promoter. For example, in a specific embodiment of the present application, the AttB-Cepheid1b-CMV-Kir2.1-EF1α-Nav1.5 plasmid contains two ion channels, Kir2. and Nav1.5, which are connected to their corresponding promoters. When this plasmid is transfected into the cell line, the cell line already has the first promoter. In this case, the connection order in the cell line is: first promoter (CMV / CAG) - AttR (first recombination site) - Cepheid1b-CMV (second promoter 1) - Kir2.1-EF1α (second promoter 2) - Nav1.5-attL (second recombination site) - EBEP2 (reporter gene).
[0037] Those skilled in the art can flexibly select any promoter constructed from a cell line according to actual needs to achieve the effects of the present application.
[0038] In a preferred embodiment, the ion channel comprises one or more of a sodium ion channel, a potassium ion channel, a calcium ion channel, a chloride ion channel, a potassium-sodium ion channel, or a magnesium ion channel, preferably a sodium ion channel, more preferably Nav1.5 and / or Kir2.1.
[0039] In a preferred embodiment, the fluorescent probe comprises one or more of a membrane potential probe, a neurotransmitter probe, a calcium ion probe, or an ATP probe; the membrane potential probe comprises one or more of Cepheid1b, pAce, ASAP, Voltron, Archon, or somArchon. Preferably, the membrane potential probe is Cepheid1b (SEQ ID NO: 1).
[0040] In a preferred embodiment, in the above-mentioned cell line, the nucleotide sequence of the fluorescent probe gene is SEQ ID NO: 1; the nucleotide sequence of the reporter gene is SEQ ID NO: 2; the nucleotide sequence of the gene of the ion channel targeted by the candidate drug is SEQ ID NO: 3 (Kir2.1) or SEQ ID NO: 4 (Nav1.5); the cell line is the LLP-HEK293T cell line, and the reporter gene is the EBFP2 gene.
[0041]
[0042] SEQ ID NO:2:gtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgaggggcgagggcgagggcgatgccaccaacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgagccacggcgtgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcacctacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcgtcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaacttcaacagccacaacatctatatcatggccgtcaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacgtggaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacagccactacctgagcacccagtccgtgctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttccgcaccgccgccgggatcactctcggcatggacgagctgtacaag。
[0043]
[0044]
[0045] In a preferred embodiment, the screening cell line is electrically stimulated by applying an external electric field; the intensity of the electrical stimulation is 200-400 v / cm (including but not limited to 200, 250, 300, 350 or 400 v / cm), the frequency of electrical stimulation is 3-5 Hz (including but not limited to 3, 3.5, 4, 4.5 or 5 Hz), the number of electrical stimulations is 5-15 times (including but not limited to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 times), and the duration of a single electrical stimulation is 10-12 milliseconds (including but not limited to 10, 10.10, 10.15, 10.18, 10.20, 10.25, 10.30, 10.35, 10.40, 10.45, 10.50, 10.55, 10.60, 10.80, 10.90, 10.95, 11.00, 11.50 or 12.00 milliseconds).
[0046] This application utilizes an external electric field to stimulate the aforementioned cell lines, and by controlling the parameters of the electrical stimulation within the aforementioned range, it is possible to induce corresponding ion channel responses without disrupting the balance of the cell lines. This application applies an external electric field to cause changes in ion channels, opening ion channels located on the cell membrane, thereby further affecting the signal of the fluorescent probe in the cell line. By detecting changes in the intensity of the fluorescent signal, the electrophysiological properties of the cell line can be studied, and the effects of candidate drugs on excitable cells (such as neurons and cardiomyocytes) can be evaluated.
[0047] In a second typical embodiment of the present application, a method for preparing a cell line for screening drugs for treating the central nervous system is provided, the preparation method comprising: transfecting a first plasmid into a first cell line to obtain a cell line for screening drugs for treating the central nervous system; in the cell line for screening drugs for treating the central nervous system, from upstream to downstream, a first promoter, a gene for a fluorescent probe, a second promoter, a gene for an ion channel targeted by the candidate drug, and a reporter gene are sequentially connected; wherein the first cell line contains a recombinase; in the genes of the first cell line, from upstream to downstream, the first promoter, a first recombination site, and a reporter gene are sequentially connected; in the genes of the first plasmid, from upstream to downstream, the second recombination site, the second promoter, the gene for an ion channel targeted by the candidate drug, and a fluorescent probe gene are sequentially connected; the recombinase has a nucleotide sequence as shown in SEQ ID NO: 9; the first recombination site has a nucleotide sequence as shown in SEQ ID NO: 7; the second recombination site has a nucleotide sequence as shown in SEQ ID NO: 8; and the first cell line is a HEK293T cell line.
[0048] SEQ ID NO:7:gggtttgtctggtcaaccaccgcggtctcagtggtgtacggtacaaacc。
[0049] SEQ ID NO:8:ccggcttgtcgacgacggcggtctccgtcgtcaggatcatcc。
[0050]
[0051] The aforementioned cell line used to screen drugs for the treatment of the central nervous system is the LLP-HEK293T cell line, which refers to a HEK293T cell line constructed based on the Lenti-Landing Pad. The Lenti-Landing Pad is a gene integration technology based on a lentivirus vector and a "landing pad" strategy. It is used to create specific "landing pads" in the genome of mammalian cells for the subsequent efficient and specific insertion of exogenous DNA fragments. Unlike traditional random integration, this technology provides a predetermined integration site for exogenous genes by pre-designing or inserting specific "landing pad" sequences into the host genome. This "landing site" can be a specific DNA sequence used to guide the integrase to insert the exogenous gene into a specific location.
[0052] The LLP-HEK293T cell line of the present application contains stably expressed Bxb1 recombinase (SEQ ID NO: 9), a first promoter (SEQ ID NO: 2), an attP recombination site (SEQ ID NO: 7), and a reporter gene EBFP2 (SEQ ID NO: 2). When a plasmid containing an attB site (SEQ ID NO: 8), a second promoter (SEQ ID NO: 6), an ion channel gene, and a fluorescent probe gene is transfected into the cell line, the second promoter, the ion channel gene, and the fluorescent probe gene can be stably inserted between the first promoter and the attP recombination site through the catalytic action of the Bxb1 recombinase, thereby silencing the expression of the reporter gene and forming the above-mentioned cell line capable of stably expressing the ion channel and fluorescent probe corresponding to the target of the candidate drug. When the cell line is mixed with a candidate drug targeting the ion channel and electrically stimulated, the expression of the ion channel changes, thereby changing the intensity of the reporter fluorescence signal. By detecting the intensity of the fluorescence signal, the activity of the candidate drug is characterized, providing a theoretical basis for the screening of new CNS drugs. This method is sustainable, stable, and high-throughput, and is suitable for large-scale application in CNS drug screening.
[0053] The cell line of the present invention is constructed by using a monoclonal amplified LLP (Lenti landing pad) HEK293T cell line, which stably expresses Bxb1 recombinase, attP recombination site and reporter gene EBFP2. After the plasmid containing the ion channel gene of attB and the fluorescent probe is transfected into the cell line, the expression of the reporter gene EBFP2 in the cell line can be silenced, and the specific ion channel gene and fluorescent probe are inserted into the fixed attP recombination site in the genome, thereby achieving stable expression of the ion channel and fluorescent probe. When the candidate drug is mixed with the cell line of the present application, the cell membrane surface potential of the cell line changes. The fluorescent signal is recorded and detected by a high-throughput optical recording system to characterize the effect of the candidate drug on the specific ion channel and its activity. The schematic diagram of the cell line detection principle of the present application is shown in the figure. Figure 1 As shown, "attR" and "attL" refer to the sites generated after attP and attB are recombined by the recombinase; "CMV / CAG" refers to the type of the first promoter.
[0054] After extensive screening by the inventors of the present application, it was found that the Bxb1 recombinase and attP recombination site are compatible with the LLP-HEK293T cell line and reporter gene of the present application, and can achieve efficient and stable integration of ion channel genes and fluorescent probes with the genes of the cell line of the present application, thereby reducing the randomness of gene insertion, improving the success rate of cell line construction, and avoiding the instability of gene expression and expression differences between cells in the subsequent detection process. The resulting cell line has high sensitivity and strong specificity, thereby enhancing the accuracy of drug screening.
[0055] Bxb1 recombinase catalyzes DNA recombination reactions and promotes genomic integration by recognizing specific sites, such as the attP site (SEQ ID NO: 7) and the attB site (SEQ ID NO: 8). These recombination sites are the "landing sites" in the LLP-HEK293T cell line described in this application. The attP site is located in the LLP-HEK293T cell line, while the attB site is located on a plasmid containing an ion channel and a fluorescent probe that express the target of the candidate drug. When the latter is transfected into the LLP-HEK293T cell line, Bxb1 recombinase recognizes and inserts them without affecting the expression of the components, ensuring stable expression and function during testing to detect the activity of the candidate drug. The reporter gene EBFP2 is used to monitor changes in the intracellular environment, including changes in cell membrane potential, providing immediate feedback on drug action. The use of EBFP2 makes drug screening more intuitive, enabling rapid assessment of drug effects on cell membrane potential and providing immediate data support for drug optimization.
[0056] The preparation method of the LLP-HEK293T cell line of the present application specifically includes:
[0057] Lentivirus was produced in HEK293T cells using the pCMV-dR8.91 / pVSV-G lentiviral packaging strategy. HEK293T cells were cultured. When the cell density in the cell culture system was ≥90% (referring to the area ratio of cells in the culture vessel), Lipo3000 was used for transfection. The expression plasmid (pLX304 plasmid, plx304-CAG (promoter SEQ ID NO: 10)-attP (recombination site SEQ ID NO: 7)-EBFP2 (reporter gene SEQ ID NO: 2)-P2A (self-cleavage polypeptide element for co-expression of multiple genes, SEQ ID NO: 11)-Bxb1 (recombinase SEQ ID NO: 9)-T2A (self-cleavage polypeptide element for co-expression of multiple genes, SEQ ID NO: 11)) was transfected at a molar ratio of 1:1:0.7. Transfection was performed using the following plasmids: (ID NO: 12)-BSD (a marker gene in the plasmid that encodes a protein that degrades puromycin, enabling cell survival in puromycin-selective medium; SEQ ID NO: 13); the first helper plasmid, pCMV-dR8.91 (https: / / www.addgene.org / vector-database / 2221 / ), a lentiviral packaging helper plasmid providing the structural and regulatory proteins required for viral particle assembly, ensuring normal viral replication and packaging); and the second helper plasmid, pCMV-VSV-G (Addgene #8454), a lentiviral packaging helper plasmid. VSV-G is a viral envelope protein that replaces the original viral envelope protein, improving viral infection efficiency. 4-8 hours after transfection, the medium was replaced with fresh DMEM + 10% FBS. After 40 hours, the viral suspension was collected and filtered through a 0.45μm filter. After filtration, aliquots were made, snap-frozen in liquid nitrogen, and stored at -80°C.
[0058] Before the virus infects cells, perform an infection test according to each gradient of 10-fold dilution, select a dilution ratio of approximately 0.1 and infect for 24–48 hours. The cell density must reach 60% before infection.
[0059] If single-cell clones are desired from the LLP-HEK293T cell line prepared using the above method, flow cytometry sorting is required. If only stable cell lines are desired, the medium should be changed to DMEM + 10% FBS supplemented with 5 μg / mL blasticidin for selection. Cell lines should be cultured in DMEM + 10% FBS supplemented with 2.5 μg / mL blasticidin (Selleck, S7419) to maintain positive rates.
[0060] The flow cytometric separation method involves preparing an ice box, digesting the plasmid-transfected LLP cell line, and resuspending it in HBSS (Gibco, C14175500BT) containing 2% FBS. The cells are then placed on ice in pre-chilled DMEM medium containing 10% FBS and 10% penicillin-streptomycin dual antibody (Beyotime, C0222). Following the protocol, cells positive for the PE channel and negative for the PB channel are collected using an AriaIII high-performance flow cytometer. The collected cells are then placed in DMEM medium containing 10% FBS and 10% penicillin-streptomycin dual antibody and cultured in a suitably sized culture dish. The resulting cell line is designated as the cell line for screening drugs for central nervous system therapies.
[0061] SEQ ID NO: 10: tggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccaccccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggcgcgcgccaggcggg gcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcg.
[0062] SEQ ID NO: 11: ggctctggagccaccaacttcagcctgctgaagcaggcaggcgacgtggaagagaaccctggccct.
[0063] SEQ ID NO: 12: cggtgacgtggaggagaatcccggccct.
[0064] SEQ ID NO: 13: gccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgcca gcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgc tgctgcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgccgacaggtgcttctcgat ctgcatcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtggggagggc.
[0065] Preferably, the first promoter is CMV (SEQ ID NO: 5) or CAG. Preferably, the second promoter includes CMV and / or EF1α promoter (SEQ ID NO: 6).
[0066] In a preferred embodiment, the ion channel comprises one or more of a sodium ion channel, a potassium ion channel, a calcium ion channel, a chloride ion channel, a potassium-sodium ion channel, or a magnesium ion channel, preferably a sodium ion channel, more preferably Nav1.5 or Kir2.1.
[0067] In a preferred embodiment, the fluorescent probe includes one or more of a membrane potential probe, a neurotransmitter probe, a calcium ion probe, or an ATP probe. The membrane potential probe includes one or more of Cepheid1b, pAce, ASAP, Voltron, Archon, or somArchon. Preferably, the membrane potential probe is Cepheid1b.
[0068] In a preferred embodiment, in the above cell line, the nucleotide sequence of the fluorescent probe gene is SEQ ID NO: 1; the nucleotide sequence of the reporter gene is SEQ ID NO: 2; and the nucleotide sequence of the gene of the ion channel targeted by the candidate drug is SEQ ID NO: 3 or SEQ ID NO: 4.
[0069] In a preferred embodiment, the transfection comprises liposome transfection.
[0070] In a preferred embodiment, liposome transfection includes transfection with Lipofectamin 3000. The above transfection methods include, but are not limited to, the transfection method of the present application. The effects of the present application can be achieved by using any transfection method known to those skilled in the art, and those skilled in the art can flexibly select the method according to actual circumstances.
[0071] In a third typical embodiment of the present application, a cell line for screening drugs for treating the central nervous system is provided. The cell line is prepared from the above-mentioned cell line for screening drugs for treating the central nervous system.
[0072] In a fourth typical embodiment of the present application, there is provided a cell line for detecting the activity of drugs for treating the central nervous system, a method for preparing the cell line for detecting the activity of drugs for treating the central nervous system, or the use of the detection method for detecting the activity of drugs for treating the central nervous system in detecting the activity of drugs for treating the central nervous system or in evaluating or screening and evaluating drugs for treating central nervous system diseases.
[0073] The beneficial effects of the present application will be further explained in detail below with reference to specific embodiments.
[0074] Example 1
[0075] Molecular cloning: The DNA fragment containing the target gene (EF1α-Nav1.5-Attb) and the expression vector fragment (Cepheid1b-CMV-Kir2.1) was mixed with Gibson recombinase (Lightening Cloning Kit, Biodragon, BDIT0014-100) to construct the plasmid AttB-Cepheid1b-CMV-Kir2.1-EF1α-Nav1.5. Successfully transformed single clones were verified by Sanger sequencing, and plasmids were extracted from the clones with correct sequencing results.
[0076] Preparation of LLP HEK293T cell line:
[0077] Lentivirus was produced using the pCMV-dR8.91 / pVSV-G lentiviral packaging strategy and produced in HEK293T cells.
[0078] When HEK293T cells reached a density of over 90%, transfect the expression plasmid (pLX304 plasmid), pCMV-dR8.91 (https: / / www.addgene.org / vector-database / 2221 / ), and pCMV-VSV-G (Addgene #8454) using Lipo3000 at a molar ratio of 1:1:0.7. Change the medium to fresh DMEM + 10% FBS 4-8 hours after transfection. After 40 hours, collect the viral suspension and filter through a 0.45 μm filter.
[0079] After filtration, aliquot, snap-freeze in liquid nitrogen, and store at -80°C. Before virus infection, perform an infection test at each 10-fold serial dilution. Select an MOI of approximately 0.1 and infect for 24–48 hours, reaching a cell density of 60% before infection. LLP cell line culture: LLP HEK 293T cells were seeded in 10 cm culture dishes (Thermo, 150466) in DMEM (Gibco, C11995500BT) supplemented with 10% v / v fetal bovine serum (FBS, Gibco, 10099141C). Cultured in a cell culture incubator at 37°C, 5% CO2, until the cells reached a density of 70–90% prior to transfection.
[0080] LLP cell line transfection: cells were transfected using Lipofectamine 3000 reagent (Gibco, L3000008) according to the manufacturer's instructions. The specific amount was 5500 ng of AttB-Cepheid1b-CMV-Kir2.1-EF1α-Nav1.5 plasmid, 16 μL Lipo3000, 11 μL P3000 and two 250 μL Opti-MEM medium (Gibco, 31985062). The transfection time was 6 hours.
[0081] Flow cytometry: Prepare an ice box. After plasmid transfection, digest the LLP cell line and resuspend it in HBSS (Gibco, C14175500BT) containing 2% FBS. Place the cell line on ice and pre-chill DMEM containing 10% FBS and 10% penicillin-streptomycin dual antibody (Beyotime, C0222). Cells that are positive for the PE channel and negative for the PB channel were collected using an Aria III high-performance flow cytometer according to the protocol. The collected cells were then placed in DMEM containing 10% FBS and 10% penicillin-streptomycin dual antibody and cultured in a suitably sized dish. The resulting cell line was designated the Cepheid1b-Kir2.1-Nav1.5 cell line.
[0082] Fluorescence confocal imaging: The Cepheid1b-Kir2.1-Nav1.5 cell line was imaged using a fluorescence confocal microscope. Figure 2 As shown, Figure 2 The middle left picture is a bright field picture. Figure 2 The middle right image shows fluorescence localization results, demonstrating good membrane localization of the genetically encoded membrane potential probe Cepheid1b, enabling subsequent field-stimulated voltage imaging. Confocal imaging was performed using a laser (Coherent OBIS 561 nm), a scientific CMOS camera (Hamamatsu ORCA-Flash 4.0 v2), and a spinning disk confocal module (Yokogawa CSU-X1). The filter parameters used in this example are: excitation light 561 nm (laser), 555 nm / 28 (LED), dichroic mirror ZET594rdc, and fluorescence filter ET630 / 75m.
[0083] To evaluate the efficacy of sodium channel inhibitors: different concentrations of lidocaine were mixed with the above-constructed cell lines, and then electrically stimulated five minutes after drug addition. The input corresponded to 10 field stimuli (intensity of 300 V / cm, frequency of 3.28 Hz, stimulation duration of 10.18 milliseconds, i.e. duty cycle of 3.33%). Cepheid1b was used to record changes in cell fluorescence signals (600 frames, sampling rate of 196.6 Hz, totaling 3.053 seconds).
[0084] Evaluation results such as Figure 3 As shown, Figure 3The left image in center A is a bright field image, and the right image is a result image of the responding fluorescent cells. The fluorescently labeled cells shown in the right image are highly sensitive Cepheid1b-Kir2.1-Nav1.5 responding cells. The scale bar is 100 μm. Figure 3 Middle B is a graph showing the changes in the field stimulation response of the Cepheid1b-Kir2.1-Nav1.5 cell line after lidocaine treatment, where the red short line marks the period of electrical stimulation.
[0085] Depend on Figure 3 It can be seen that the Cepheid1b-Kir2.1-Nav1.5 cell line can burst "action potentials" when electrically stimulated (stimulation period marked in red). When different concentrations of lidocaine (L129221) are added, the sodium ion channels are inhibited, thereby affecting the frequency and amplitude of its potential changes.
[0086] Example 2
[0087] Construction of Cepheid1b-Nav1.5 cell line: Gibson recombinase was used to construct the AttB-Cepheid1b-EF1α-Nav1.5 plasmid. The plasmid in this example did not contain "CMV-Kir2.1", and all other steps were the same as in Example 1.
[0088] The fluorescence confocal imaging results of the cell lines in this example are as follows Figure 4 As shown, Figure 4 The middle left picture is a bright field picture. Figure 4 The fluorescence localization result diagram on the middle right shows that the membrane potential probe Cepheid1b, which is genetically encoded, is well localized in the membrane in the Cepheid1b-Nav1.5 cell line.
[0089] The field stimulation high-throughput optical recording results of this embodiment are as follows Figure 5 As shown, Figure 5 The left image in center A is a bright field image, and the right image is a result image of the responding fluorescent cells. The fluorescently labeled cells shown in the right image are highly sensitive Cepheid1b-Nav1.5 cells that respond. The scale bar is 100 μm. Figure 5 Middle B is a graph showing the changes in the field stimulation response of the Cepheid1b-Nav1.5 cell line after lidocaine treatment, indicating that the Cepheid1b-Nav1.5 cell line can burst out "action potentials" when electrically stimulated (stimulation period marked in red), and can also characterize the inhibitory effect of lidocaine on sodium ion channels.
[0090] Comparative Example 1
[0091] The cell line used in this comparative example differed from that in Example 1 only in that it contained the membrane potential dye Di-4-ANEPPS (d1199, 3 μM, treated for 5 minutes) instead of a fluorescent probe. Treatment of the cell line with the membrane potential dye involved diluting a 3 mM Di-4-ANEPPS stock solution to 3 μM with DMEM (C11995500BT). The cell culture medium was then replaced and the cell line was labeled for 5 minutes before imaging in Tyrode's solution (CC018).
[0092] The cell lines in this comparative example and the cell lines in Example 1 were electrically stimulated. The field stimulation high-throughput optical recording results of this comparative example are shown in FIG. Figure 6 As shown, Figure 6 The left image in center A is a bright field image, and the right image is a result image of the responding fluorescent cells. The scale bar is 100 μm. Figure 6 Middle B is a schematic diagram comparing the sensitivity of the Kir2.1-NaV1.5 cell line labeled with Di-4-ANEPPS membrane potential dye and the Cepheid1b cell line.
[0093] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: the cell line used in the present application to detect the activity of drugs for treating the central nervous system can stably express specific ion channels related to candidate drugs, as well as fluorescent probes. When the candidate drug acts on the ion channel in the cell line of the present application, the reporter gene can respond in a timely manner and change the intensity of the fluorescent signal. By detecting the membrane potential signal of the cell line, the activity of the candidate drug and its effect on the ion channel can be characterized. Compared with the prior art method for evaluating CNS drugs, the method of detecting the activity of CNS drugs using the above cell line in the present application overcomes the problems of low throughput, invasiveness, cell non-selectivity and low accuracy, and is more suitable for large-scale application in the screening and evaluation of CNS drugs, thereby promoting the development of the field of CNS research.
[0094] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.
Claims
1. A method for screening drugs for treating central nervous system diseases, characterized in that: The method comprises: mixing a cell line expressing an ion channel and a fluorescent probe targeted by a candidate drug with the candidate drug to obtain a screening cell line; electrically stimulating the screened cell line and detecting the intensity of the fluorescent signal in the screened cell line; The intensity of the fluorescent signal indicates the activity of the candidate drug; Wherein, in the genes of the cell line, from upstream to downstream, a first promoter, a gene of the fluorescent probe, a second promoter, a gene of the ion channel targeted by the candidate drug, and a reporter gene are sequentially connected; The nucleotide sequence of the reporter gene is SEQ ID NO: 2; The nucleotide sequence of the gene of the ion channel targeted by the candidate drug is SEQ ID NO: 3 or SEQ ID NO:
4.
2. The method according to claim 1, characterized in that The fluorescent probe is a membrane potential probe.
3. The method according to claim 2, characterized in that The membrane potential probe is Cepheid1b, pAce, ASAP, Voltron, Archon or somArchon.
4. The method according to claim 3, characterized in that In the cell line, the nucleotide sequence of the gene of the fluorescent probe is SEQ ID NO:
1.
5. The method according to claim 1, characterized in that performing the electrical stimulation by applying an external electric field to the screened cell line; The intensity of the electrical stimulation is 200-400 v / cm, the frequency of the electrical stimulation is 3-5 Hz, the number of electrical stimulations is 5-15 times, and the duration of a single electrical stimulation is 10-12 milliseconds.
6. A method for preparing a cell line for screening drugs for treating the central nervous system, characterized in that: The preparation method comprises: transfecting the first plasmid into the first cell line to obtain the cell line for screening drugs for treating the central nervous system; In the cell line for screening drugs for treating the central nervous system, from upstream to downstream, a first promoter, a fluorescent probe gene, a second promoter, a gene of an ion channel targeted by the candidate drug, and a reporter gene are sequentially connected; wherein the first cell line contains a recombinase; In the genes of the first cell line, the first promoter, the first recombination site and the reporter gene are connected in sequence from upstream to downstream; In the genes of the first plasmid, from upstream to downstream, the second recombination site, the second promoter, the gene of the ion channel targeted by the candidate drug, and the gene of the fluorescent probe are sequentially connected; The nucleotide sequence of the recombinase is SEQ ID NO: 9; The nucleotide sequence of the first recombination site is SEQ ID NO: 7; The nucleotide sequence of the second recombination site is SEQ ID NO: 8; The first cell line is a HEK293T cell line; The nucleotide sequence of the reporter gene is SEQ ID NO: 2; The nucleotide sequence of the gene of the ion channel targeted by the candidate drug is SEQ ID NO: 3 or SEQ ID NO:
4.
7. The preparation method according to claim 6, characterized in that The fluorescent probe is a membrane potential probe.
8. The preparation method according to claim 7, characterized in that The membrane potential probe is Cepheid1b, pAce, ASAP, Voltron, Archon or somArchon.
9. The preparation method according to claim 8, characterized in that In the cell line, the nucleotide sequence of the fluorescent probe gene is the nucleotide sequence shown in SEQ ID NO:
1.
10. A cell line for screening drugs for treating the central nervous system, characterized in that: The cell line is obtained by the cell line preparation method for screening drugs for treating the central nervous system according to any one of claims 6 to 9.
Citation Information
Patent Citations
Heterologous stimulus-gated ion channels and methods of using same
US20040023203A1
Cell engineering compositions and methods using fluorogenic oligonucleotide signaling probes and flow cytometry
US20240117417A1