SERS (Surface Enhanced Raman Scattering) detection system and detection method for staphylococcus aureus enterotoxin B

Abstract

The invention discloses an SERS (Surface Enhanced Raman Scattering) detection system and an SERS detection method for staphylococcus aureus enterotoxin B, and belongs to the technical field of food safety detection. The SERS detection system of the staphylococcus aureus enterotoxin B comprises an Au (at) Ag / 4 / ATP-CH2 signal probe, an Au / Ag FL (at) PDMS-CH1 signal amplification platform and a complementary double-stranded Apt-cDNA (complementary double-stranded cDNA). Specific probes CH1 and CH2 are designed through a catalytic stem-loop self-assembly (CHA) technology, and corresponding CHA reaction trigger cDNA is designed according to an SEB specific aptamer sequence, so that stable quantitative detection of SEs is effectively realized.

Description

Technical Field

[0001] The present invention relates to the technical field of food safety detection, and particularly to a SERS detection system and method for Staphylococcus aureus enterotoxin B. Background Art

[0002] Staphylococcus aureus can easily produce some toxic metabolites in a nutrient-rich environment. Among them, Staphylococcus aureus enterotoxin (SEs) is considered to be the main cause of gastrointestinal symptoms such as diarrhea and vomiting after people consume food contaminated with Staphylococcus aureus. SEs are toxic proteins secreted by Staphylococcus aureus. The molecular weight of SEs is between 28 - 30 kDa, and it has stability within a wide range of pH values and temperatures and has the characteristics of anti-enzymolysis. As a metabolite of Staphylococcus aureus, it is considered to be the main cause of food poisoning caused by bacterial toxins. Therefore, sensitive SEs detection methods are extremely important in both food safety and clinical diagnosis.

[0003] Currently, the conventional detection methods for SEs include sandwich enzyme-linked immunosorbent assay (ELISA) and lateral flow assay. These methods are effective but have limited sensitivity. To overcome this limitation, biosensors such as quartz crystal microbalance sensors, electrochemical sensors, and fluorescence resonance energy transfer sensors have been developed. However, they are somewhat complex to use and costly. Therefore, it is crucial to develop new detection methods for SEs. Summary of the Invention

[0004] The purpose of the present invention is to provide a SERS detection system and method for Staphylococcus aureus enterotoxin B to solve the problems existing in the above-mentioned prior art.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] One of the technical solutions of the present invention is a SERS detection system for Staphylococcus aureus enterotoxin B, including an Au@Ag / 4 / ATP-CH2 signal probe, an Au / Ag FL@PDMS-CH1 signal amplification platform, and a complementary double-stranded Apt-cDNA.

[0007] Another technical solution of the present invention is the application of the SERS detection system in the detection of Staphylococcus aureus enterotoxin B.

[0008] Another technical solution of the present invention is the application of the SERS detection system in the preparation of products for detecting Staphylococcus aureus enterotoxin B.

[0009] Another technical solution of the present invention is a product for detecting Staphylococcus aureus enterotoxin B, including the SERS detection system.

[0010] The fifth technical solution of the present invention is a detection method for detecting Staphylococcus aureus enterotoxin B, which uses the SERS detection system or the product to detect Staphylococcus aureus enterotoxin B in a sample to be tested.

[0011] Based on the above technical solutions, the present invention has the following technical effects:

[0012] 1. The present invention discloses a SERS detection method for Staphylococcus aureus metabolites based on catalytic stem-loop self-assembly assistance, which combines the CHA technology and the SERS technology based on a flexible SERS substrate (Au / Ag FL@PDMS) to achieve highly sensitive detection of SEs.

[0013] 2. The present invention designs specific probes CH1 and CH2 through the catalytic stem-loop self-assembly technology (CHA), and designs corresponding CHA reaction triggers cDNA according to the SEB-specific aptamer sequence to effectively achieve stable quantitative detection of SEs.

[0014] 3. The present invention develops a new type of flexible SERS substrate, which improves the sensitivity and stability of SEs detection. Description of the Drawings

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0016] Figure 1 It is a characterization diagram of the prepared Au / AgNPs; among them, A is the TEM diagram of Au / AgNPs; B is the SAED analysis of Au / AgNPs; C is the EDS diagram of Au / Ag NPs.

[0017] Figure 2 It is the characterization data of the SERS signal probe; among them, A is the optimization of the 4-ATP incubation time; B is the comparison of the UV-Vis spectra of Au@Ag / 4-ATP before and after binding to CH2; C is the comparison of the SERS spectra of Au@Ag / 4-ATP before and after binding to CH2.

[0018] Figure 3 It is the characterization diagram of Au / Ag FL@PDMS; among them, A is the PDMS blank membrane; B-D are the SEM results of the PDMS membranes loaded with 100 μL, 200 μL and 300 μL of Au / Ag FL; E-H are the EDS mapping results of Au / Ag FL@PDMS. Detailed implementation mode

[0019] The various exemplary implementation modes of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0020] It should be understood that the terms described in the present invention are only for describing specific implementation modes and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0022] Without departing from the scope or spirit of the present invention, various improvements and variations can be made to the specific implementation modes of the present invention specification, which are obvious to those skilled in the art. Other implementation modes obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of this application are only exemplary.

[0023] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0024] The technical solutions described in the present invention are all conventional solutions in the art unless otherwise specified. The reagents or raw materials used are all purchased from commercial channels or have been made public unless otherwise specified.

[0025] The embodiment of the present invention provides a SERS detection system for Staphylococcus aureus enterotoxin B, including an Au@Ag / 4 / ATP-CH2 signal probe, an Au / Ag FL@PDMS-CH1 signal amplification platform, and a complementary double-stranded Apt-cDNA.

[0026] In some specific implementation schemes, the preparation method of the Au@Ag / 4 / ATP-CH2 signal probe is: mixing the Au@Ag / 4-ATP and CH2 solutions for reaction to obtain the Au@Ag / 4 / ATP-CH2 signal probe.

[0027] In some specific embodiments, the concentration of Au@Ag / 4-ATP is 0.25 - 2.25 mM; the sequence of CH2 is as shown in SEQ ID NO.2; the concentration of the CH2 solution is 1 - 10 μM; the volume ratio of the Au@Ag / 4-ATP and the CH2 solution is 10:1.

[0028] In some specific embodiments, the preparation method of the Au@Ag / 4-ATP is: mixing a 4-ATP solution with an Au@AgNPs solution and then performing a binding reaction to obtain the Au@Ag / 4-ATP;

[0029] The concentration of the 4-ATP solution is 1 - 5 μM; the concentration of the Au@Ag NPs solution is 0.25 - 2.25 mM; the volume ratio of the 4-ATP solution to the Au@AgNPs solution is 1:10; the time of the binding reaction is 1 h.

[0030] In some specific embodiments, the preparation method of the Au@Ag NPs solution is: heating HAuCl 4 to boiling and refluxing after adding Na 3 Cit. The color of the mixture gradually turns wine red, indicating the formation of Au NPs seeds. Mixing the seeds with Na 3 Cit, and then dropwise adding AgNO 3 in a boiling environment until an orange-yellow color appears.

[0031] In some specific embodiments, the volume ratio of the HAuCl 4 , Na 3 Cit solution is 100:1.5; the concentration range of the HAuCl 4 is 0.2 - 5 mM, the mass fraction of Na 3 CIT is 1%; the temperature for heating to boiling is 95 - 100 °C, and the concentration range of the AgNO 3 is 1 - 5 mM.

[0032] In some specific embodiments, the preparation method of the Au / Ag FL@PDMS-CH1 signal amplification platform is: immersing an aminated PDMS film in an Au / Ag FL solution and incubating overnight to form an Au / Ag FL@PDMS film; mixing and reacting the Au / Ag FL@PDMS film with a CH1 solution to obtain the Au / Ag FL@PDMS-CH1 signal amplification platform.

[0033] In some specific embodiments, the preparation method of the aminated PDMS film is as follows: Mix the main agent (polydimethylsiloxane prepolymer) with the auxiliary agent (curing agent) to prepare a PDMS film; the mass ratio of the main agent to the auxiliary agent is 10:1; evacuate at room temperature until the bubbles in the colloid disappear; then keep the mixture in an oven at 50 - 80 °C overnight to solidify. Cut samples (0.5 cm × 0.5 cm) from the solidified polymer to obtain the prepared PDMS film; soak the prepared PDMS film in piranha solution (H 2 SO 4 :H 2 O 2 = 3:1, v / v) for 60 s, immediately rinse 3 times with ultrapure water, and then dry with nitrogen to obtain the hydroxylated PDMS film; subsequently, transfer the hydroxylated PDMS film to a centrifuge tube, add an ethanol solution of 3-aminopropyltriethoxysilane (APTES) (2% - 10%, v / v), react at 70 °C for 3 hours, take out small pieces of the prepared sample, rinse with a large amount of ultrapure water, and then dry with nitrogen to obtain the aminated PDMS film.

[0034] In some specific embodiments, the preparation method of the Au / Ag FL solution is as follows: Mix a hydroxylamine solution (1 mL, 0.06 M) and a NaOH solution (1 mL, 0.05 M) for 5 minutes under vigorous stirring. Then add an AgNO 3 solution (18 mL, 0.4 M) to the resulting reaction mixture in the dark. Stir the mixture for another 5 minutes, then heat at 100 °C for 5 minutes while adding HAuCl 4 ·3H 2 O (10 mL, 0.8 mM) and a Na 3 CIT solution (200 μL, 1%, w / v). After that, centrifuge the solution twice at 6000 rpm for 20 minutes to remove excess reagents and redisperse in 5 mL of deionized water to obtain Au / Ag FL.

[0035] In some specific embodiments, the sequence of CH1 is as shown in SEQ ID NO.1; the concentration of the Au / Ag FL solution is 1 - 3 mM; the concentration of the CH1 solution is 0.5 - 2 μM.

[0036] In some specific embodiments, the method for preparing the complementary double-stranded Apt-cDNA is as follows: Mix the SEB aptamer (50 μL, 1 - 10 μM, SEQ ID NO.4: GGTATTGAGGGTCGCATCCACTGGTCGT TGTTGTCTGTTGTCTGTTATGTTGTTTCGTGATGGCTCTAACTCTCCTCT) and the complementary strand cDNA (50 μL, 1 - 10 μM) and react for 10 - 30 min to obtain the complementary double-stranded Apt-cDNA; the sequence of the complementary strand cDNA is as shown in SEQ ID NO.3.

[0037] The embodiments of the present invention also provide the application of the SERS detection system in detecting Staphylococcus aureus enterotoxin B.

[0038] The embodiments of the present invention also provide the application of the SERS detection system in the preparation of products for detecting Staphylococcus aureus enterotoxin B.

[0039] The embodiments of the present invention also provide a product for detecting Staphylococcus aureus enterotoxin B, including the SERS detection system.

[0040] The embodiments of the present invention also provide a detection method for Staphylococcus aureus enterotoxin B, using the SERS detection system or the product to detect Staphylococcus aureus enterotoxin B in a sample to be tested.

[0041] Example 1

[0042] The DNA sequences used in the embodiments of the present invention are shown in Table 1.

[0043] Table 1

[0044]

[0045] Step S1: Under continuous stirring, heat 100 mL of HAuCl 4 (0.25 mM) to boiling and reflux for 30 minutes after adding 1.5 mL of a 1% (mass fraction) Na 3 Cit solution. The color of the mixture gradually turns wine red, indicating the formation of Au NPs seeds. Mix 25 mL of the Au NPs seeds with 1 mL of a 1% (mass fraction) Na 3 Cit solution, and then dropwise add AgNO 3 (4.0 mL, 1.07 mM) in a boiling environment until an orange-yellow color appears to obtain Au@Ag NPs.

[0046] Figure 1In A, the Au@Ag NPs are shown to be spherical, and it can be seen from its HETEM (inset) that it has an obvious core-shell structure; in B, it is shown to have a polycrystalline structure; in C, EDS elemental analysis shows that it is composed of two elements, Au and Ag.

[0047] Step S2: Add freshly prepared 4-ATP solution (500 μL, 1 μM) to 5 mL of 1 mM Au@Ag NPs to obtain Au@Ag / 4-ATP through covalent bonds (Ag-SH). To fabricate the final Au@Ag / 4-ATP type SERS signal probe, stir the above solution for 30 min, then centrifuge twice at 8000 rpm for 8 min each time to discard unreacted chemicals, and then redisperse in 5 mL of ultrapure water. Mix 200 μL of Au@Ag / 4-ATP and 20 μL of CH2 (5 μM) primer and react at 4 °C for 12 h, then centrifuge and redisperse in 200 μL of PBS buffer to obtain the Au@Ag / 4 / ATP-CH2 signal probe.

[0048] Figure 2 In A, it is shown that when the binding time of 4-ATP on Au@Ag NPs is 1 h, the best SERS signal can be achieved; in B, the UV-Vis spectrum shows that the modification of 4-ATP on the surface of Au@Ag NPs has little effect on the UV absorption peak of Au@Ag NPs, and when CH2 binds to the surface of Au@Ag / 4-ATP, an obvious characteristic peak of DNA will appear at about 260 nm; in C, it is shown that when CH2 binds, the overall signal intensity of Au@Ag / 4-ATP-CH2 does not change significantly.

[0049] Step S3: Mix the main agent (polydimethylsiloxane prepolymer) with the auxiliary agent (curing agent) to prepare the PDMS film; the mass ratio of the main agent to the auxiliary agent is 10:1. Evacuate at room temperature for 1 hour in a ratio of 10:1 until the bubbles in the colloid disappear. Then the mixture is left overnight in an oven at 70 °C to solidify. Cut samples (0.5 cm × 0.5 cm) from the cured polymer, and place the prepared PDMS film in a piranha solution (H 2 SO 4 :H 2 O 2It was immersed in a 3 - mercaptopropionic acid ethanol solution (3:1, v / v) for 60 s, immediately rinsed 3 times with ultrapure water, and then dried with nitrogen to obtain a hydroxylated PDMS membrane. Subsequently, the hydroxylated PDMS membrane was transferred to a centrifuge tube. A triaminopropyltriethoxysilane (APTES) ethanol solution (5%, v / v) was added, and the reaction was carried out at 70 °C for 3 hours. The prepared small sample pieces were taken out, rinsed with a large amount of ultrapure water, and then dried with nitrogen to obtain an aminated PDMS membrane. The aminated PDMS was immersed in a concentrated Au / Ag FL solution and incubated overnight to form an Au / Ag FL@PDMS thin film. The Au / Ag FL@PDMS and 200 μL (the volume was based on submerging the Au / Ag FL@PDMS) of CH1 (0.5 μM) primer were mixed and reacted at 4 °C for 12 h, and then taken out and washed with ultrapure water to obtain an Au / Ag FL@PDMS - CH1 signal amplification platform.

[0050] Figure 3 In A - D, the loading amount of Au / Ag FL on the PDMS surface was optimized. By comparing the SEM results of the blank PDMS membrane and the PDMS membranes loaded with 100 μL, 200 μL, and 300 μL of Au / Ag FL, it can be seen from the comparison that the color becomes darker and darker. The loading amount of 300 μL of Au / Ag FL can obtain a dense layer of Au / Ag FL on the PDMS membrane; the EDS mapping results in E - H prove that it is composed of two elements, Au and Ag.

[0051] Step S4: Mix the SEB aptamer (50 μL, 5 μM, GGTATTGAGGGTCGCATCCACTGG TCGTTGTTGTCTGTTGTCTGTTATGTTGTTTCGTGATGGCTCTAACTCTCCTCT) and the partially complementary strand cDNA (50 μL, 5 μM) and react for 30 min to obtain a complementary double - strand Apt - cDNA. Then, add Staphylococcus enterotoxin B (SEB) solutions with different concentrations (0.001 - 1000 ng / mL) to be detected and continue to react for 30 min. Then, sequentially add Au / Ag FL@PDMS - CH1 and Au@Ag / 4 - ATP - CH2, take out the composite substrate after reacting at 37 °C for 2 h, wash it with ultrapure water, and perform SERS analysis using 785 nm laser incident light.

[0052] Experimental Example

[0053] In this example, the sample to be detected was milk.

[0054] Milk samples purchased from a supermarket were centrifuged at 7000 rpm for 15 minutes at 10 °C to remove the upper fat layer. Then, they were diluted tenfold with ultrapure water and different concentrations of SEB solution were added. The samples were analyzed by the proposed method and the ELISA method. SERS detection was performed using the method of step S4. A linear correlation fitting y = 3109x + 7085.2 was obtained in the concentration range of 0.01 - 100 ng / mL, where R 2 = 0.9885. In addition, the LOD was calculated to be 0.22 pg / mL. This work demonstrated for the first time the use of CHA-assisted SERS technology to achieve highly sensitive detection of SEB in food matrices, which can be used to promote food safety assurance.

[0055] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, rather than limiting the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation manners here. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the claims of the present invention.

Claims

1. A SERS detection system for Staphylococcus aureus enterotoxin B, characterized in that: It includes Au@Ag / 4 / ATP-CH2 signal probe, Au / Ag FL@PDMS-CH1 signal amplification platform and complementary double-stranded Apt-cDNA.

2. The SERS detection system according to claim 1, characterized in that: The preparation method of the Au@Ag / 4 / ATP-CH2 signal probe is as follows: Au@Ag / 4-ATP and CH2 solution are mixed and reacted to obtain the Au@Ag / 4 / ATP-CH2 signal probe.

3. The SERS detection system according to claim 2, characterized in that: The concentration of the Au@Ag / 4-ATP is 0.25-2.25 mM; the sequence of the CH2 is shown in SEQ ID NO.2; the concentration of the CH2 solution is 1-10 μM; the volume ratio of the Au@Ag / 4-ATP and CH2 solution is 10:

1.

4. The SERS detection system according to claim 2, characterized in that: The preparation method of the Au@Ag / 4-ATP is as follows: a 4-ATP solution is mixed with an Au@Ag NPs solution, and then a combination reaction is performed to obtain the Au@Ag / 4-ATP; The concentration of the 4-ATP solution is 1-5 μM; the concentration of the Au@Ag NPs solution is 0.25-2.25 mM; the volume ratio of the 4-ATP solution to the Au@AgNPs solution is 1:10; and the binding reaction time is 1 hour.

5. The SERS detection system according to claim 1, characterized in that: The preparation method of the Au / Ag FL@PDMS-CH1 signal amplification platform is as follows: immersing an aminated PDMS film in an Au / Ag FL solution and incubating overnight to form an Au / Ag FL@PDMS film; and mixing the Au / Ag FL@PDMS film and the CH1 solution to react to obtain the Au / Ag FL@PDMS-CH1 signal amplification platform.

6. The SERS detection system according to claim 5, characterized in that: The sequence of the CH1 is shown in SEQ ID NO.1; the concentration of the Au / Ag FL solution is 1-3 mM; the concentration of the CH1 solution is 0.5-2 μM.

7. Use of the SERS detection system as claimed in claim 1 in detecting Staphylococcus aureus enterotoxin B.

8. Use of the SERS detection system as claimed in claim 1 in preparing a product for detecting Staphylococcus aureus enterotoxin B.

9. A product for detecting Staphylococcus aureus enterotoxin B, characterized in that: Comprising the SERS detection system as claimed in claim 1.

10. A method for detecting Staphylococcus aureus enterotoxin B, characterized in that: The SERS detection system of claim 1 or the product of claim 9 is used to detect Staphylococcus aureus enterotoxin B in the sample to be tested.

Images