Inhibitors acting on the tdp1 target and uses thereof
By using Lawsone or SPI-112 as TDP1 target inhibitors, the activity of TDP1 protein was inhibited, which solved the problem of CTG trinucleotide repeat amplification in DM1 and reduced the number of CTG repeats, demonstrating both safety and effectiveness.
Patent Information
- Application Number
- CN202510307146.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-16
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-03-16
AI Technical Summary
Existing CRISPR/Cas9 gene editing technology faces challenges in sgRNA design, off-target effects, and the inability to distinguish normal alleles in the treatment of myotonic dystrophy type 1 (DM1). Furthermore, inserting PolyA signaling into the DMPK gene may lead to the silencing of repetitive amplified sequences or the generation of toxic peptides.
Lawsone or SPI-112 can be used as TDP1 target inhibitors to reduce CTG trinucleotide repeat amplification by inhibiting TDP1 protein activity, providing a safe target to address the repeat amplification problem in DM1.
It effectively reduces the number of CTG trinucleotide repeat amplifications in DM1 Drosophila and human cells, showing significant inhibition of TDP1 protein activity, and is safe and does not cause damage to normal cells.
Smart Images

Figure CN120131602B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to an inhibitor that acts on the TDP1 target and its application. Background Technology
[0002] Myotonic dystrophy type 1 (DM1) is the most common muscular dystrophy in adults, inherited in an autosomal dominant pattern. DM1 primarily affects muscles, manifesting as muscle rigidity, muscle atrophy, and progressive muscle weakness. It also affects the heart, eyes, central nervous system, endocrine system, digestive system, and respiratory system, presenting with symptoms such as arrhythmias, cataracts, cognitive impairment, and endocrine abnormalities. DM1 is caused by an abnormal amplification of the CTG trinucleotide repeat sequence in the 3'UTR (3' untranslated region) of the DMPK gene on chromosome 19. The number of CTG repeats in normal individuals is typically between 5 and 34, while in DM1 patients, the number can exceed 50, even reaching thousands. The number of repeats is closely related to the severity of the disease and the age of onset; the higher the number of repeats, the earlier and more severe the symptoms usually appear.
[0003] Addressing the repetitive sequence of the CTG within the 3'UTR (3' untranslated region) of the DMPK gene on chromosome 19 is a crucial approach for preventing or mitigating DM1. Current treatments targeting amplified repetitive sequences primarily rely on CRISPR / Cas9 gene editing technology. This involves either directly excising the amplified CTG repeat through gene editing or inserting a PolyA signal into the DMPK gene. Direct excision of the CTG repeat involves designing sgRNAs targeting the flanking regions of the CTG repeat sequence to directly remove the amplified CTG repeat, eliminating the repetition at the DNA level and blocking the transcription of toxic RNA. Inserting a PolyA signal into the DMPK gene, by inserting a PolyA signal between the CTG repeat and the gene, can induce early termination of RNA transcription, preventing the production of toxic RNA while preserving DMPK transcription.
[0004] Currently, direct excision of CTG repeats has several drawbacks, including challenges in sgRNA design, off-target effects, and the inability to distinguish normal alleles. The sgRNA design challenge requires balancing the distance between the sgRNA and the CTG repeat; too close a distance may affect editing efficiency due to abnormal repetitive sequences, while too far a distance may affect the transcription of the edited DMPK gene. Off-target effects include the possibility that CRISPR / Cas9 may mistakenly cut other regions of the genome, leading to unexpected mutations. The inability to distinguish between normal and amplified alleles means that editing may occur simultaneously on both normal and amplified repetitive alleles, causing insertion / deletion or repetition inversion problems. Inserting a PolyA signal into the DMPK gene has the disadvantage that the amplified repetitive sequence still exists in the genome and may silence the DMPK and adjacent SIX5 genes through methylation / heterochromatinization. Furthermore, the CAG repeat transcription on the DMPK antisense strand can be translated into toxic peptides via RAN. Therefore, developing a safe and effective method to directly target the CTG repeat sequence within the 3'UTR (3' untranslated region) of the DMPK gene is of great significance for DM1 disease research. Summary of the Invention
[0005] One of the objectives of this invention is to provide an inhibitor that acts on the TDP1 target. The TDP1 target is a safe target with redundant pathways for compensation. Knocking down or inhibiting the TDP1 target will not cause damage to cells. By inhibiting TDP1, the number of CTG trinucleotide repeat amplifications in DM1 can be reduced, thereby solving the problem of CTG trinucleotide repeat amplification in DM1.
[0006] A second objective of this invention is to provide the application of the inhibitor.
[0007] This invention provides an inhibitor that acts on the TDP1 target, wherein the active ingredient of the inhibitor includes Lawsone (2-hydroxy-1,4-naphthoquinone) or SPI-112.
[0008] Lawsone is an orally active naphthoquinone compound with antibacterial, antitumor, and antioxidant activities. Its molecular formula is C1. 10 H6O3, with a molecular weight of 174.16, has the following chemical structural formula:
[0009]
[0010] SPI-112 is a protein tyrosine phosphatase inhibitor with the molecular formula C1. 22 H 17 FN4O5S, with a molecular weight of 468.46, has the following chemical structural formula:
[0011]
[0012] The TDP1 is tyrosine-DNA phosphodiesterase 1, which affects the duplication or reduction of genes by regulating the DNA repair process.
[0013] The present invention also provides the application of the inhibitor in targeting CTG trinucleotide repeat amplification in DM1.
[0014] Furthermore, the application specifically involves using the inhibitor to suppress the activity of the TDP1 protein, thereby solving the problem of CTG trinucleotide repeat amplification in DM1.
[0015] Furthermore, the application is performed on DM1 fruit flies or DM1 human cell models.
[0016] When the target of the application is DM1 fruit flies, the process includes the following steps:
[0017] The inhibitor was dissolved in DMSO to obtain inhibitor solution 1;
[0018] The obtained inhibitor solution 1 was added to the food culture medium at the preset final concentration 1, and mixed well to obtain the drug-treated fruit fly culture medium.
[0019] The emerged DM1 fruit flies were placed in the obtained drug-treated fruit fly culture medium for cultivation, thus inhibiting the activity of the DM1 fruit fly TDP1 protein.
[0020] Preferably, the concentration of the inhibitor solution 1 is 2.5 mM to 10 mM; and the final concentration of the inhibitor in the drug-treated fruit fly culture medium is 0.5 μM to 2 μM.
[0021] Preferably, the DM1 Drosophila drug culture medium is cultured at a temperature of 25°C for 15–30 days.
[0022] When the application target is the DM1 human cell model, the process includes the following steps:
[0023] The inhibitors were dissolved in DMSO to obtain inhibitor solution 2.
[0024] The obtained inhibitor solution 2 was added to DEME complete cell culture medium at the preset final concentration 2, and mixed well to obtain the drug cell culture medium.
[0025] The obtained drug-containing cell culture medium was added to a 12-well plate containing a DM1 human cell model for culture, thereby inhibiting the activity of TDP1 protein in the DM1 human cell model.
[0026] Preferably, the inhibitor solution 2 is SPI-112 solution 2 or Lawsone solution 2; the concentration of SPI-112 solution 2 is 100mM to 150mM; the concentration of Lawsone solution 2 is 40mM to 100mM; in the drug cell culture medium, when the inhibitor solution added is SPI-112 solution 2, the final concentration of SPI-112 is 100μM to 150μM; when the inhibitor solution added is Lawsone solution 2, the final concentration of Lawsone is 40μM to 100μM.
[0027] Preferably, the specific conditions for culturing the drug-containing cell culture medium in a 12-well plate containing a DM1 human cell model are: culturing in a sterile incubator at 37°C for 7–10 days.
[0028] The present invention also provides the use of the inhibitor in the preparation of a medicament for myotonic dystrophy type 1.
[0029] The drug is for the prevention or treatment of myotonic dystrophy type 1.
[0030] The beneficial effects of this invention are:
[0031] (1) This invention provides a solution to the problem of CTG trinucleotide repeat amplification in DM1. It is the first to propose that the number of CTG trinucleotide repeat amplifications in DM1 be reduced by inhibiting the activity of TDP1 protein with an inhibitor, which is of great significance for medical research.
[0032] (2) The TDP1 target used in the application of the inhibitor provided by the present invention is a safe target. Its heterozygous mutation carriers have no phenotype. Inhibiting TDP1 will not cause serious damage to normal cells and has the characteristics of safety.
[0033] The two inhibitors disclosed in this invention, Lawsone and SPI-112, both showed significant inhibitory effects on TDP1 protein activity in both in vitro and in vivo experiments. Attached Figure Description
[0034] Figure 1 This is a graph showing the effect of genetic knockdown of TDP1 on the number of CTG repeats in DM1 Drosophila in Example 1; where, Figure 1 A shows the results of GC-PCR and capillary electrophoresis after DNA was extracted from DM1 fruit flies; Figure 1 B is a statistical graph of CTG repeat length in DM1 Drosophila;
[0035] Figure 2 This is a graph showing the effect of genetic knockdown of TDP1 on the number of CTG repeats in the DM1 human cell model in Example 2; where, Figure 2A shows the DNA microarray results after high-GC-PCR extraction of DNA from the DM1 human cell model. Figure 2 B is a statistical graph of CTG repeat length in the DM1 human cell model;
[0036] Figure 3 This is the result of verifying the efficacy of the TDP1 inhibitor in Example 3. Figure 3 A is a graph showing the inhibitory effect of the inhibitor on TDP1 protein in vitro. Figure 3 B is a graph showing the inhibitory effect of the inhibitor on TDP1 protein in Drosophila.
[0037] Figure 4 This is a graph showing the effect of Lawsone and SPI-112 on the number of CTG repeats in DM1 Drosophila in Example 4.
[0038] Figure 5 This is a graph showing the effect of Lawsone and SPI-112 on the number of CTG repeats in the DM1 human cell model in Example 5.
[0039] Figure 6 This is a graph showing the effect of Lawsone and SPI-112 on the number of CTG repeats in lymphocytes of DM1 patients in Example 6. Detailed Implementation
[0040] The present invention will be described in detail below with reference to embodiments. It should be noted that, unless otherwise specified, the embodiments and features in the embodiments of the present invention can be combined with each other.
[0041] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto.
[0042] The fruit fly strains used in these embodiments of the invention include: UAS-(CTG) 270 Drosophila and Mef2-Gal4 were purchased from the Bloomington Drosophila Stock Center; TDP1 RNAi were purchased from The Vienna Drosophila Resource Center.
[0043] The cell lines used in these embodiments of the invention include: a DM1 human cell model from Central South University with approximately 400 CTG replicates; and DM1 patient lymphocytes from Central South University with approximately 700 CTG replicates.
[0044] The primer sequences, siRNA sequences, and probe sequences used in this invention are as follows:
[0045] DM1-F:GTTGGAAGACTGAGTGCCCG、
[0046] DM1-R: CCTGGCCGAAAGAAAGAAATG,
[0047] pCDNA-F:GCAGTACATCAATGGGCGTG
[0048] pCDNA-R: CTAGAAGGCACAGTCGAGGC,
[0049] TDP1-siRNA (positive strand): GACCATATCTAGTAGTGAT,
[0050] TDP1 active substrate probe: FAM-AAAGCAGGCTTCAACGCAACTGTGAAGATCGCTTGGGTGCGTTGAAGCCTGCTTT-BHQ1
[0051] The experimental reagents used in the examples include:
[0052] Lawsone and SPI-112 were purchased from MCE.
[0053] AmpliTaq Gold DNA 360 polymerase was purchased from Applied Biosystems.
[0054] The genomic DNA extraction kit was purchased from Novizan.
[0055] Hi-Di Formamide and GeneScan TM The 1000ROX was purchased from AppliedBiosystems.
[0056] The high-sensitivity DNA chip was purchased from Agilent.
[0057] The 6% TBE-PAGE adhesive was purchased from Beyotime.
[0058] Ethanol, glacial acetic acid, silver nitrate, NaOH, and formaldehyde were purchased from Sinopharm Reagent. H2AvD was purchased from Abcam.
[0059] The instruments and equipment used in the examples include: a PCR instrument manufactured by Biorad, a 3500xL gene analyzer manufactured by Applied Biosystems, and a confocal microscope manufactured by Zeiss.
[0060] Example 1: Effect of TDP1 genetic knockdown on the number of CTG repeats in DM1 Drosophila
[0061] UAS-(CTG) 270Repeated amplification of Drosophila was performed by crossing it with Mef2-Gal4 Drosophila to obtain Mef2-Gal4>(CTG) specifically expressed in muscle. 270 DM1 genotype of fruit fly.
[0062] DM1 virgin flies and TDP1RNAi male flies from the Bloomington Drosophila bank were crossbred at an 8:3 ratio in Drosophila culture medium (formula: 189.6g glucose, 94.84g sucrose, 33.6g agar, 233.1g corn flour, 90g yeast extract, 4L water, with 10% preservative added). After 7 days of incubation at 25°C to obtain fertilized eggs, the parents were removed, and the offspring were cultured for another 10 days until emergence. Genotypes of Mef2-Gal4>CTG were collected. 270 Adults with +TDP1 RNAi.
[0063] The obtained Mef2-Gal4>(CTG) 270 +TDP1RNAi Drosophila and Mef2-Gal4>(CTG) 270 DNA was extracted from DM1 Drosophila using a DNA extraction kit. After high-resolution GC-PCR, changes in repeat fragment length were detected by capillary electrophoresis. The results are as follows: Figure 1 As shown.
[0064] The PCR system for high GC-PCR is shown in Table 1 below:
[0065] Table 1
[0066]
[0067] The specific PCR reaction conditions for the high GC-PCR are shown in Table 2 below:
[0068] Table 2
[0069]
[0070] The capillary electrophoresis specifically involves: mixing formamide and an internal standard (GeneScan) TM After mixing with 1000 ROX, add 2 μL of PCR product, 8.5 μL of formamide and 0.5 μL of internal standard, centrifuge (1000 rpm, 1 min), heat at 95℃ for 5 min and then quench on ice. Perform electrophoresis analysis using a 3500 x L gene analyzer.
[0071] like Figure 1 As shown, capillary electrophoresis results indicate that Mef2-Gal4 > (CTG). 270 The DM1 genotype of Drosophila exhibits only one product peak between 800-900 bp, Mef2-Gal4>(CTG). 270+TDP1 RNAi showed a diffusely shortened product peak before 900bp in Drosophila. The number of CTG repeats was counted, and the results showed that knocking down TDP1 in Drosophila DM1 could promote the reduction of CTG repeats, proving that TDP1 can be used as a target to reduce the number of CTG repeats in Drosophila DM1.
[0072] Example 2: Effect of TDP1 genetic knockdown on CTG repeat length in a DM1 human cell model
[0073] Dilute TDP1 siRNA to 50 μM with RNase-free water. Mix 1 μL of the diluted solution with 100 μL of Opti-MEM and let stand for 5 min. Separately, mix 1 μL of Lipo2000 transfection reagent with 100 μL of Opti-MEM and let stand for 5 min. Combine the two solutions and let stand for 30 min to form a complex. Then mix the complex with 800 μL of DMEM complete medium and add the mixture to DM1 cells in 12-well plates for transfection.
[0074] The DM1 human cell model (CTG) was tested separately. 400 and the transfected DM1 human cell model (CTG) 400 +TDP1 siRNA was used to extract cellular DNA, which was then subjected to high-resolution GC-PCR. Changes in repeat count were detected using a DNA microarray. Results are as follows: Figure 2 As shown.
[0075] like Figure 2 As shown, the DNA microarray results reveal the DM1 human cell model (CTG). 400 There was only a clear band at around 1300bp in the transfected DM1 human cell model (CTG). 400 +TDP1 siRNA showed significant shortening below 1300 bp. Counting the number of CTG repeats indicated that knockdown of TDP1 in the DM1 human cell model promoted CTG repeat reduction, demonstrating that TDP1 can serve as a target for addressing CTG repeat sequence issues in DM1 human cells.
[0076] Example 3: Validation of the efficacy of TDP1 inhibitor
[0077] The inhibitory effects of Lawsone and SPI-112 on TDP1 protein activity were determined in vitro using a TDP1 probe luminescence assay. Specifically:
[0078] An oligonucleotide probe was synthesized as a TDP1 substrate. The 5' and 3' ends of the probe were connected to a FAM fluorescent group and a BHQ1 quencher group, respectively, via phosphodiester bonds. At 37°C, the probe spontaneously paired to form a hairpin structure, with the fluorescent group and BHQ1 quencher group close together, and the probe did not emit light. However, upon the addition of TDP1 protein, the protein hydrolyzed the phosphodiester bonds, the fluorescent group and BHQ1 quencher group separated, and the system began to emit light. The rate of change in fluorescence intensity reflected the activity of the TDP1 protein.
[0079] Experimental results are as follows Figure 3 As shown in A, Figure 3 A (left) is an oligonucleotide probe. Figure 3 A (right) shows that Lawsone and SPI-112 exhibited significant inhibitory effects, reducing TDP1 protein activity to 47.67% and 48.33% of the DMSO control, respectively. In vitro experiments demonstrate that Lawsone and SPI-112 can effectively inhibit TDP1 protein activity.
[0080] To further verify their inhibitory effects, the inhibitory effects of Lawsone and SPI-112 on TDP1 were tested in W1118 (wild-type) Drosophila. DMSO was used as a negative control, and camptothecin (CPT) was used as a positive control.
[0081] CPT is a TOP1 inhibitor that binds to the TOP1-DNA complex, leading to DNA breaks and the formation of TOPcc. TDP1 has a certain repair effect on these DNA breaks. When TDP1 is inhibited, TOPcc cannot be repaired, thus exacerbating the accumulation of DNA breaks. DNA breaks in the cell nucleus are labeled by γ-H2AvD staining; the fluorescence intensity is proportional to the degree of DNA breakage. Dissecting the thorax muscle of adult Drosophila, fix the tissue overnight at 4°C in fixative (195 μL of 4% PFA, 5 μL of 1% PBST), permeabilize with 0.3% PBST for 20 min, and block with 5 μL of goat serum and 195 μL of 0.3% PBST for 1 h at room temperature. Dilute the primary antibody as required with blocking buffer and incubate overnight at 4°C. Wash three times with 0.3% PBST for 15 min each time. Add secondary antibody diluted with 0.3% PBST and incubate at room temperature for 4 h, washing three times with 0.3% PBST for 15 min each time. The slides were mounted with an anti-fluorescence quenching agent and photographed under a confocal microscope to count the fluorescence intensity of γ-H2AvD in the cell nucleus.
[0082] The above experiment was divided into four groups, namely:
[0083] W1118 Drosophila fed DMSO group: W1118 Drosophila were fed on the non-drug culture medium, male Drosophila were collected, γ-H2AvD stained and photographed by confocal microscopy.
[0084] W1118 Drosophila fed CPT group: W1118 Drosophila were fed on the CPT drug culture medium, male Drosophila were collected, and after γ-H2AvD staining, they were photographed by confocal microscopy.
[0085] W1118 Drosophila fed CPT+Lawsone group: W1118 Drosophila were fed on the CPT+Lawsone drug culture medium, and male Drosophila were collected, stained with γ-H2AvD and photographed by confocal microscopy.
[0086] W1118 Drosophila fed CPT+SPI-112 group: W1118 Drosophila were fed in the CPT+SPI-112 drug culture medium, male Drosophila were collected, and after γ-H2AvD staining, they were photographed by confocal microscopy.
[0087] Experimental results are as follows Figure 3 As shown in Figure B, no double-strand breaks were observed in the nuclei of Drosophila cells treated with DMSO, while a small number of double-strand breaks appeared in the nuclei of Drosophila cells treated with CPT, indicating that the TOP1 inhibitor promoted TOPcc production and DNA breakage. Compared to Drosophila treated with CPT alone, a large number of double-strand breaks appeared in the nuclei of Drosophila cells treated with CPT+Lawsone and CPT+SPI-112. This indicates that TDP1 cannot repair the TOPcc generated by CPT in a timely manner, leading to the accumulation of DNA double-strand breaks, and that Lawsone and SPI-112 can effectively inhibit TDP1 protein activity in vivo.
[0088] Example 4: Effects of Lawsone and SPI-112 on the number of CTG repeats in DM1 Drosophila
[0089] Lawsone was dissolved in DMSO. 1 μL of 2.5 mM Lawsone was added to 500 μL of food culture medium (final Lawsone concentration was 0.5 μM). The mixture was vortexed and stored at 4°C after cooling to prepare a Lawsone-containing Drosophila culture medium.
[0090] Dissolve SPI-112 in DMSO, add 1 μL of 5 mM SPI-112 to 500 μL of food medium (Lawsone final concentration is 1 μM), mix with a vortex mixer, cool and store at 4°C to prepare SPI-112 drug-containing Drosophila culture medium.
[0091] Mef2-Gal4>CTG 1 day after molting 270 DM1 fruit flies were placed in a drug-treated culture medium and fed at 25°C for 15 days. The experiment consisted of two experimental groups and one control group, as follows:
[0092] Mef2-Gal4>(CTG)270 +DMSO group: As a negative control, fruit flies were fed in a food medium containing DMSO for 15 days. After collecting male fruit flies, DNA was extracted, and the length of repeat fragments was detected by high-performance GC-PCR and PAGE silver staining.
[0093] Mef2-Gal4>(CTG) 270 +Lawsone group: As the experimental group, fruit flies were fed with food medium containing 0.5 μM Lawsone for 15 days. After collecting male fruit flies, DNA was extracted, and after high-performance GC-PCR, the changes in the length of repeat fragments were detected by PAGE silver staining.
[0094] Mef2-Gal4>(CTG) 270 +SPI-112 group: As the experimental group, fruit flies were fed in a food medium containing 1 μM Lawsone for 15 days. After collecting male fruit flies, DNA was extracted, and after high-performance GC-PCR, the changes in the length of repeat fragments were detected by PAGE silver staining.
[0095] The specific steps for the silver staining detection using the PAGE gel are as follows: Prepare a 6% TBE-PAGE gel (Beyotime reagent kit), and perform electrophoresis at a constant voltage of 60V for 180 min in 0.5×TBE buffer. Peel the gel, fix it for 10 min (9 mL water + 1 mL ethanol + 50 μL glacial acetic acid), and wash it 3 times with water. Stain for 10 min (0.01 g silver nitrate + 10 mL water), and wash it 3 times with water. Develop the stain until the bands are clear (10 mL water + 0.075 g NaOH + 0.054 mL formaldehyde), wash it with water, and then stop the staining for 10 min (0.3 mL glacial acetic acid + 9.7 mL water), followed by two more washes with water. Wash with stop solution II (1 mL ethanol + 9 mL water), transfer the gel to plastic wrap, and image it against a white background.
[0096] The final results obtained by the three groups are as follows: Figure 4 As shown.
[0097] like Figure 4 As shown in the PAGE silver staining results, DM1 fruit flies fed with DMSO exhibited only one product peak of approximately 800 bp. The two experimental groups supplemented with Lawsone and SPI-112 showed a shortened and diffused product peak before 800 bp. The number of CTG repeats was counted, indicating that both Lawsone and SPI-112 effectively reduced the number of CTG repeats in DM1 fruit flies.
[0098] Example 5: Effects of Lawsone and SPI-112 on the number of CTG repeats in a DM1 human cell model
[0099] Lawsone was dissolved in DMSO. 1 μL of 41 mM Lawsone was added to 1 mL of DEME complete cell culture medium (final Lawsone concentration was 41 μM). The mixture was vortexed and stored at 4°C after cooling to prepare a cell culture medium containing Lawsone.
[0100] Dissolve SPI-112 in DMSO, add 1 μL of 134 mM SPI-112 to 1 mL of DEME complete cell culture medium (Lawsone final concentration is 134 μM), mix with a vortex mixer, cool and store at 4°C to prepare SPI-112 drug-containing cell culture medium.
[0101] The drug-containing cell culture medium was added to a 12-well plate containing a DM1 human cell model and incubated at 37°C for 2 days. The experiment included two experimental groups and one control group, as follows:
[0102] (CTG) 400 +DMSO group: As a negative control, DM1 human cells were cultured in cell culture medium containing DMSO. Genomic DNA was extracted after 2 days and subjected to high-performance GC-PCR. The changes in the number of repeats were detected by DNA microarray.
[0103] (CTG) 400 +Lawsone group: As the experimental group, DM1 human cells were cultured in cell culture medium containing 42 μM Lawsone. Genomic DNA was extracted after 2 days and subjected to high-performance GC-PCR. The changes in the number of repeats were detected by DNA microarray.
[0104] (CTG) 400 +SPI-112 group: As the experimental group, DM1 human cells were cultured in cell culture medium containing 134 μM Lawsone. Genomic DNA was extracted after 2 days and subjected to high-GC-PCR. The changes in the number of repeats were detected by DNA microarray.
[0105] The results of the above experimental groups are as follows Figure 5 As shown in the DNA microarray results, the DM1 human cell model cultured in DMSO had only one clear band at around 1300 bp. The experimental group with added Lawsone and SPI-112 showed a shortened product peak below 1300 bp. The number of CTG repeats was counted, indicating that Lawsone and SPI-112 can effectively reduce the number of CTG repeats in the DM1 human cell model.
[0106] Example 6: Effects of Lawsone and SPI-112 on the number of CTG repeats in lymphocytes of DM1 patients
[0107] Lawsone was dissolved in DMSO. 1 μL of 41 mM Lawsone was added to 1 mL of DEME complete cell culture medium (final Lawsone concentration was 41 μM). The mixture was vortexed and stored at 4°C after cooling to prepare a cell culture medium containing Lawsone.
[0108] Dissolve SPI-112 in DMSO, add 1 μL of 134 mM SPI-112 to 1 mL of DEME complete cell culture medium (Lawsone final concentration is 134 μM), mix with a vortex mixer, cool and store at 4°C to prepare SPI-112 drug-containing cell culture medium.
[0109] The drug-containing cell culture medium was added to a 12-well plate containing a DM1 patient lymphocyte model and incubated at 37°C for 2 days. The experiment included two experimental groups and three control groups, as follows:
[0110] DM1 patient lymphocytes + DMSO group: As a negative control, DM1 human cells were cultured in cell culture medium containing DMSO. Genomic DNA was extracted after 2 days and subjected to high-performance GC-PCR. The changes in the number of repeats were detected by PAGE silver staining.
[0111] DM1 patient lymphocyte + CPT group: As the experimental group, DM1 human cells were cultured in cell culture medium containing 15 μM CPT. Genomic DNA was extracted after 2 days and subjected to high-performance GC-PCR. The changes in the number of repeats were detected by PAGE silver staining.
[0112] DM1 patient lymphocytes + Amikacin group: As the experimental group, DM1 human cells were cultured in cell culture medium containing 200 μM Amikacin. Genomic DNA was extracted after 2 days, and high-performance GC-PCR was performed. The changes in the number of repeats were detected by PAGE silver staining.
[0113] DM1 patient lymphocytes + Lawsone group: As the experimental group, DM1 human cells were cultured in cell culture medium containing 42 μM Lawsone. Genomic DNA was extracted after 2 days, and high-resolution GC-PCR was performed. The changes in the number of repeats were detected by PAGE silver staining.
[0114] DM1 patient lymphocytes + SPI-112 group: As the experimental group, DM1 human cells were cultured in cell culture medium containing 134 μM Lawsone. Genomic DNA was extracted after 2 days and subjected to high-performance GC-PCR. The changes in the number of repeats were detected by PAGE silver staining.
[0115] The CPT is a TOP1 inhibitor that can bind to the TOP1-DNA complex, leading to DNA breakage.
[0116] Amikacin is a broad-spectrum antibiotic that can non-specifically inhibit the activity of TDP1 protein.
[0117] The results of the above experiment are as follows Figure 6 As shown, the DMSO treatment group exhibited a clear amplified allele band around 2000 bp and a normal allele band around 700 bp, with no diffuse band between them. The CPT and Amikacin treatment groups were similar to the DMSO group, indicating that CPT and Amikacin did not reduce the number of CTG repeats in lymphocytes of DM1 patients. In contrast, the Lawsone and SPI-112 treatment groups showed diffuse fragments between the amplified and normal alleles, suggesting that they could reduce the number of CTG repeats in lymphocytes of DM1 patients.
[0118] As can be seen from the results of Examples 4-6, the inhibitors targeting TPD1 provided by the present invention can be applied to fruit fly and human cells to address the problem of CTG trinucleotide repeat amplification in DM1 and promote the shrinkage of its repeat amplification sequence.
Claims
1. Use of an inhibitor acting on the TDP1 target point for the preparation of a medicament against the type 1 myotonic dystrophy, characterized in that, The active ingredient of the inhibitor is Lawsone or SPI-112.
2. Use according to claim 1, characterized in that, The Lawsone is a naphthoquinone compound with oral activity, with antibacterial, antitumor and antioxidant activity, with the molecular formula of C 10 H6O3, a molecular weight of 174.16, and a chemical structural formula as shown in the following formula: 。 3. Use according to claim 1, characterized in that, The SPI-112 is a protein tyrosine phosphatase inhibitor, and its molecular formula is C 22 H 17 FN4O5S, with a molecular weight of 468.46, and its chemical structural formula is as follows: 。 4. Use according to claim 1, characterized in that, TDP1 is tyrosine-DNA phosphodiesterase 1, which contracts the number of CTG trinucleotide repeats in myotonic dystrophy type 1 by regulating the DNA repair process.
5. The use according to claim 1, characterized in that, The application is specifically to inhibit the activity of TDP1 protein using the inhibitor to solve the problem of CTG trinucleotide repeat expansion in myotonic dystrophy type 1.
6. Use according to claim 5, characterized in that, The application object is DM1 fruit fly or DM1 human cell model.
7. Use according to claim 6, characterized in that, When the application object is DM1 fruit fly, the use process includes the following steps: Dissolve the inhibitor in DMSO to obtain inhibitor solution 1; Add the obtained inhibitor solution 1 to the food medium according to the preset final concentration 1, mix well to obtain a drug fruit fly culture medium; Place the hatched DM1 fruit fly in the obtained drug fruit fly culture medium for culture to complete the inhibition of the activity of TDP1 protein in DM1 fruit fly; The concentration of the inhibitor solution 1 is 2.5 mM-10 mM; in the drug fruit fly culture medium, the final concentration of the inhibitor is 0.5 μM-2 μM; The temperature for culturing the hatched DM1 fruit fly in the drug fruit fly culture medium is 25℃, and the time is 15-30 days.
8. Use according to claim 6, characterized in that, When the application object is DM1 human cell model, the use process includes the following steps: Dissolve the inhibitor in DMSO respectively to obtain inhibitor solution 2; Add the obtained inhibitor solution 2 to the DEME cell complete culture medium according to the preset final concentration 2, mix well to obtain a drug cell culture medium; Add the obtained drug cell culture medium to the 12-well plate containing the DM1 human cell model for culture to complete the inhibition of the activity of TDP1 protein in the DM1 human cell model; The inhibitor solution 2 is SPI-112 solution 2 or Lawsone solution 2; the concentration of the SPI-112 solution 2 is 100 mM-150 mM; the concentration of the Lawsone solution 2 is 40 mM-100 mM; in the drug cell culture medium, when the added inhibitor solution is SPI-112 solution 2, the final concentration of SPI-112 is 100 μM-150 μM; when the added inhibitor solution is Lawsone solution 2, the final concentration of Lawsone is 40 μM-100 μM; The specific conditions for culturing the drug cell culture medium in the 12-well plate containing the DM1 human cell model are: cultured in a 37℃ sterile incubator for 7-10 days.
9. The use according to any one of claims 1 to 8, characterized in that, The drug is a drug for preventing or treating myotonic dystrophy type 1.
Citation Information
Patent Citations
Dye composition comprising combination of natural dyeing agents including extract of lawsonia inermis
CN113966366A
Compositions and Methods for the Prevention and Treatment of Osteolysis and Osteoporosis
US20150352131A1