WNT5B dental differentiation promoting biological product and application thereof

Abstract

The invention provides a WNT5B dental differentiation promoting biological product and application thereof. Compared with the prior art, the application has the following advantages: by integrating human embryo tooth embryo space transcriptome sequencing data and epithelial cell and interstitial cell exocrine proteome sequencing data, signal molecules WNT5B and CTNNB1 secreted in the tooth embryo epithelial development process are screened out, the important effect of the WNT5B protein in tooth embryo development is confirmed for the first time, and the application has a wide application prospect. Compared with other WNT family members, the WNT5B has higher capability of promoting the tooth formation of the odontogenic stem cells; the onset concentration of the WNT5B is low, and the onset concentration is the optimal concentration of the WNT5B for promoting the odontogenic stem cells to form teeth when the onset concentration is 10ng / ml; the effects of the WNT5B and the CTNNB1 in tooth embryo epithelial cell exocrine and the synergistic effect of the WNT5B and the CTNNB1 in promoting tooth embryo mesenchymal cell odontogenic differentiation are further determined, namely the combined low-concentration use effect of the WNT5B and the CTNNB1 is superior to that of single high-concentration use of the WNT5B and the CTNNB1.

Description

Technical Field

[0001] This application relates to the technical field of tooth development and tooth regeneration medicine, and particularly relates to a WNT5B odontogenic differentiation biopreparation and its application. Background Art

[0002] Tooth development is a finely regulated biological process involving complex interactions between epithelial and mesenchymal cells. These interactions rely on a variety of signaling molecules, including growth factors, cytokines, and WNT proteins, etc. The WNT signaling pathway plays a key role in many biological processes, especially in embryonic development, tissue regeneration, and tumorigenesis. In tooth development, WNT signaling molecules are secreted by epithelial cells and affect the proliferation, differentiation, and migration of mesenchymal cells. Although studies have identified the roles of multiple WNT family members in tooth development, the exact role and mechanism of the WNT5B protein, as a signaling molecule secreted by epithelial cells, during tooth germ development are not fully understood.

[0003] Currently, one of the main challenges faced by tooth regeneration medicine is how to simulate and restore the natural signaling pathways during tooth development. Although some treatment methods have attempted to utilize the WNT signaling pathway to promote tooth regeneration, these methods generally lack an in-depth understanding of the roles of specific WNT members in tooth development, resulting in limited treatment effects.

[0004] In addition, the commonly used model systems in tooth development research, such as mouse and pig tooth development samples, although providing valuable information, have certain limitations in analyzing the functions and regulatory mechanisms of specific signaling molecules. Especially during human tooth development, how signaling molecules secreted by epithelial cells precisely regulate the behavior of mesenchymal cells remains an unsolved problem. In recent years, with the development of proteomics and cell biology techniques, researchers have been able to more comprehensively analyze and identify the signaling molecules secreted by human tooth germ epithelial cells. However, most of these studies focus on the expression patterns and function predictions of proteins, and there is still insufficient in-depth research on the regulatory roles and application potential of specific signaling molecules such as WNT5B in tooth germ development. Summary of the Invention

[0005] Aiming at the above-mentioned existing technical limitations, this application reveals the potential role of WNT5B during tooth germ development by identifying and analyzing the exocrine proteome of human embryonic tooth germ epithelial cells, especially the WNT5B protein; by deeply studying the function and regulatory mechanism of WNT5B, this application provides new strategies and methods for tooth regeneration medicine, and proposes a WNT5B odontogenic differentiation biopreparation and its application; it overcomes the deficiencies and defects mentioned in the background art.

[0006] To achieve the above object, this application adopts the following technical solutions:

[0007] The inventive point of the present application is to provide a biological agent, and the biological agent contains WNT5B recombinant protein.

[0008] Optionally, for the above biological agent, the biological agent further contains CTNNB1 recombinant protein (Catenin Beta1).

[0009] Optionally, for the above biological agent, the amino acid sequence of the WNT5B recombinant protein is as shown in Sequence SEQ ID No.1, and the amino acid sequence of the CTNNB1 recombinant protein (Catenin Beta 1) is as shown in Sequence SEQ ID No.2; the nucleotide sequence encoding the WNT5B recombinant protein is as shown in Sequence SEQ ID No.3, and the nucleotide sequence encoding the CTNNB1 recombinant protein (Catenin Beta 1) is as shown in Sequence SEQ ID No.4.

[0010] SEQ ID No.1:

[0011] MPSLLLLFTAALLSSWAQLLTDANSWWSLALNPVQRPEMFIIGAQPVCSQLPGLSPGQRKLCQLYQEHMAYIGEGAKTGIKECQHQFRQRRWNCSTADNASVFGRVMQIGSRETAFTHAVSAAGVVNAISRACREGELSTCGCSRTARPKDLPRDWLWGGCGDNVEYGYRFAKEFVDAREREKNFAKGSEEQGRVLMNLQNNEAGRRAVYKMADVACKCHGVSGSCSLKTCWLQLAEFRKVGDRLKEKYDSAAAMRVTRKGRLELVNSRFTQPTPEDLVYVDPSPDYCLRNESTGSLGTQGRLCNKTSEGMDGCELMCCGRGYNQFKSVQVERCHCKFHWCCFVRCKKCTEIVDQYICK;

[0012] SEQ ID No.2:

[0013] MATQADLMELDMAMEPDRKAAVSHWQQQSYLDSGIHSGATTTAPSLSGKGNPEEEDVDTSQVLYEWEQGFSQSFTQEQVADIDGQYAMTRAQRVRAAMFPETLDEGMQIPSTQFDAAHPTNVQRLAEPSQMLKHAVVNLINYQDDAELATRAIPELTKLLNDEDQVVVNKAAVMVHQLSKKEASRHAIMRSPQMVSAIVRTMQNTNDVETARCTAGTLHNLSHHREGLLAIFKSGGIPALVKMLGSPVDSVLFYAITTLHNLLLHQEGAKMAVRLAGGLQKMVALLNKTNVKFLAITTDCLQILAYGNQESKLIILASGGPQALVNIMRTYTYEKLLWTTSRVLKVLSVCSSNKPAIVEAGGMQALGLHLTDPSQRLVQNCLWTLRNLSDAATKQEGMEGLLGTLVQLLGSDDINVVTCAAGILSNLTCNNYKNKMMVCQVGGIEALVRTVLRAGDREDITEPAICALRHLTSRHQEAEMAQNAVRLHYGLPVVVKLLHPPSHWPLIKATVGLIRNLALCPANHAPLREQGAIPRLVQLLVRAHQDTQRRTSMGGTQQQFVEGVRMEEIVEGCTGALHILARDVHNRIVIRGLNTIPLFVQLLYSPIENIQRVAAGVLCELAQDKEAAEAIEAEGATAPLTELLHSRNEGVATYAAAVLFRMSEDKPQDYKKRLSVELTSSLFRTEPMAWNETADLGLDIGAQGEPLGYRQDDPSYRSFHSGGYGQDALGMDPMMEHEMGGHHPGADYPVDGLPDLGHAQDLMDGLPPGDSNQLAWFDTDL;

[0014] SEQ ID No.3:

[0015] atgccgagcctgctgctgctgtttaccgcggcgctgctgagcagctgggcgcagctgctgaccgatgcgaacagctggtggagcctggcgctgaacccggtgcagcgcccggaaatgtttattattggcgcgcagccggtgtgcagccagctgccgggcctgagcccgggccagcgcaaactgtgccagctgtatcaggaacatatggcgtatattggcgaaggcgcgaaaaccggcattaaagaatgccagcatcagtttcgccagcgccgctggaactgcagcaccgcggataacgcgagcgtgtttggccgcgtgatgcagattggcagccgcgaaaccgcgtttacccatgcggtgagcgcggcgggcgtggtgaacgcgattagccgcgcgtgccgcgaaggcgaactgagcacctgcggctgcagccgcaccgcgcgcccgaaagatctgccgcgcgattggctgtggggcggctgcggcgataacgtggaatatggctatcgctttgcgaaagaatttgtggatgcgcgcgaacgcgaaaaaaactttgcgaaaggcagcgaagaacagggccgcgtgctgatgaacctgcagaacaacgaagcgggccgccgcgcggtgtataaaatggcggatgtggcgtgcaaatgccatggcgtgagcggcagctgcagcctgaaaacctgctggctgcagctggcggaatttcgcaaagtgggcgatcgcctgaaagaaaaatatgatagcgcggcggcgatgcgcgtgacccgcaaaggccgcctggaactggtgaacagccgctttacccagccgaccccggaagatctggtgtatgtggatccgagcccggattattgcctgcgcaacgaaagcaccggcagcctgggcacccagggccgcctgtgcaacaaaaccagcgaaggcatggatggctgcgaactgatgtgctgcggccgcggctataaccagtttaaaagcgtgcaggtggaacgctgccattgcaaatttcattggtgctgctttgtgcgctgcaaaaaatgcaccgaaattgtggatcagtatatttgcaaa;

[0016] SEQ ID No.4:

[0017]

[0018] Optionally, for the above biopreparations, the concentration of the WNT5B recombinant protein is 10 ng / ml - 100 ng / ml; the concentration of the CTNNB1 recombinant protein is 10 ng / ml - 100 ng / ml.

[0019] The preferred concentration is 10 ng / ml for both.

[0020] The second inventive point of the present application is to provide a preparation method for the above biopreparations, comprising the following steps:

[0021] S1. Dissolve PLGA:

[0022] Weigh 250 mg of PLGA (poly(lactic-co-glycolic acid)), and dissolve it in 1 ml of dichloromethane (DCM) to obtain a PLGA solution;

[0023] S2. Prepare the protein solution:

[0024] Weigh 10 μg of WNT5B and CTNNB1 recombinant proteins (Catenin Beta 1), and dissolve them in 1 ml of an appropriate buffer (PBS or deionized water) to obtain a protein solution;

[0025] S3. Mix the protein and PLGA solutions:

[0026] Add the protein solution to the PLGA solution, and stir evenly to ensure sufficient mixing of the protein and PLGA;

[0027] S4. Emulsification process:

[0028] Add the above mixed solution to 5 ml of deionized water containing 1% polyvinyl alcohol (PVA) solution, and use ultrasonic treatment (20 kHz, 30 seconds) to form an emulsion;

[0029] If necessary, the emulsifier concentration can also be increased to improve the emulsification effect;

[0030] S5. Solvent removal:

[0031] Place the emulsion in a rotary evaporator (Rotavapor) to remove dichloromethane (DCM) until solid particles are obtained;

[0032] S6. Particle washing:

[0033] Wash the nanoparticles repeatedly with deionized water to remove the unencapsulated protein and emulsifier, and obtain pure nanoparticles;

[0034] S7. Drying treatment:

[0035] The nanoparticles are lyophilized for long-term storage and stability evaluation.

[0036] Optional surface modification (to improve biocompatibility and targeting):

[0037] 1) PEGylation modification: To improve the biocompatibility of the nanoparticles, the surface of the particles can be modified with polyethylene glycol (PEG); PEGylation helps slow down the rate of recognition of the particles by the immune system and prolongs their in vivo half-life.

[0038] 2) Targeting modification: Targeting molecules (such as antibodies, peptides, or small molecule ligands) can be attached to the surface of the nanoparticles by covalent binding or non-covalent adsorption to enhance their targeted delivery to specific cells or tissues.

[0039] Characterization and analysis of the nanoparticles:

[0040] 1) Particle size and size distribution: The particle size and its distribution of the nanoparticles are determined using dynamic light scattering (DLS).

[0041] 2) Surface charge: ζ-potential analysis is used to determine the surface charge of the nanoparticles and evaluate their stability and dispersibility.

[0042] 3) Drug loading and encapsulation efficiency: The drug loading and encapsulation efficiency of WNT5B or CTNNB1 in the nanoparticles are quantitatively determined by the BCA protein quantification method or ELISA method.

[0043] 4) Protein release rate: The release curve of the protein is tested using a dialysis bag or membrane filtration method to evaluate the sustained release effect.

[0044] Sustained release characteristics:

[0045] 1) Release rate: By adjusting the molecular weight of PLGA, the emulsification process, and the concentration of the emulsifier, the degradation rate of the nanoparticles can be controlled, thereby achieving different protein release rates; generally, PLGA has a long degradation period and can provide a sustained release of WNT5B and CTNNB1 for several days to several weeks.

[0046] 2) Protein stability: Through this preparation method, the nanoparticles can protect WNT5B and CTNNB1 from environmental influences and improve the stability and activity of the protein.

[0047] The third inventive point of this application is to provide the use of the above biological agent in the preparation of a product for promoting odontogenic differentiation.

[0048] Optionally, for the above-mentioned application, the prepared tooth differentiation-promoting product is selected from one or more of a product for promoting odontogenic differentiation of dental follicle mesenchymal cells, a product for promoting odontogenic differentiation of dental pulp stem cells, a product for promoting dental pulp regeneration and repair, a product for promoting periodontal tissue repair, a product for promoting dental follicle tissue regeneration, and a product for promoting dentin regeneration and repair.

[0049] Specifically, the tooth differentiation-promoting product may include the following categories:

[0050] 1. Products for dental pulp regeneration and repair:

[0051] 1) Products for dental pulp regeneration therapy: Therapies based on stem cells or growth factors for treating diseases such as dental pulp necrosis and pulpitis; this product can promote the proliferation and differentiation of dental pulp stem cells or other types of stem cells to repair damaged dental pulp tissue;

[0052] 2) Engineered dental pulp products: Combining biomaterials and growth factors to construct functional dental pulp substitutes for repairing dental pulp tissue defects or injuries;

[0053] 2. Products for periodontal tissue repair:

[0054] 1) Products for periodontal ligament repair: Stimulating the proliferation and differentiation of periodontal ligament cells to help repair periodontal injuries such as periodontitis and periodontal pockets;

[0055] 2) Periodontal regeneration materials: Regenerative materials that can promote the regeneration of periodontal tissues, alveolar bone, and gingiva to improve periodontal health;

[0056] 3. Multifunctional regeneration products:

[0057] 1) Multifunctional stem cell products: Combining different types of stem cells (such as dental pulp stem cells and dental follicle mesenchymal stem cells) to simultaneously promote the repair of multiple aspects such as dental pulp, dentin, and periodontal tissues;

[0058] 2) Self-repairing multifunctional products: Combining bioactive molecules (such as growth factors, cytokines, antimicrobial peptides, etc.) with materials science to develop multifunctional products with self-repairing capabilities.

[0059] The fourth inventive point of this application is to provide the use of the above-mentioned biological agent in the preparation of a tooth differentiation-promoting culture medium, and the tooth differentiation-promoting culture medium is selected from one or more of a tooth differentiation-promoting culture medium for culturing dental follicle mesenchymal cells, a tooth differentiation-promoting culture medium for culturing dental pulp stem cells, a tooth differentiation-promoting culture medium for dental follicle tissue regeneration, and a tooth differentiation-promoting culture medium for dentin regeneration and repair.

[0060] The fifth inventive point of the present application is to provide a method for promoting odontogenic differentiation in vitro. The method is to culture cells with odontogenic potential in the above-mentioned culture medium containing a differentiation promoter, and the differentiation promoter is one or more of WNT5B and CTNNB1.

[0061] Optionally, in the above-mentioned method for promoting odontogenic differentiation in vitro, the cells with odontogenic potential are selected from one or more of dental germ mesenchymal cells and dental pulp stem cells.

[0062] Compared with the prior art, the present application has the following advantages:

[0063] This patent has for the first time discovered the important role of WNT5B protein in dental germ development, providing a new strategy for dental regeneration medicine; compared with other members of the WNT family (WNT5A), WNT5B has a stronger ability to promote odontogenic differentiation of dental stem cells; the effective concentration of WNT5B is low, and 10 ng / ml is the optimal concentration for WNT5B to promote odontogenic differentiation of dental stem cells; further research has also been conducted on the role of WNT5B and CTNNB1 in the extracellular secretion of dental germ epithelial cells and their synergistic effect in promoting odontogenic differentiation of dental germ mesenchymal cells. Description of the Drawings

[0064] Figure 1 Sequencing results of extracellular secreted proteins of human dental germ epithelial cells; experimental flow chart; comparison results of up-regulation and down-regulation of secreted proteins between dental epithelium (DE group) and dental mesenchyme (DM group); volcano plot showing differential expression of secreted proteins between dental epithelium group (DE) and dental mesenchyme group (DM); heat map showing expression levels of key secreted proteins in dental epithelium group (DE) and dental mesenchyme group (DM); biological pathways enriched by secreted proteins significantly up-regulated in dental epithelium group (DE); biological pathways enriched by secreted proteins significantly up-regulated in dental mesenchyme group (DM).

[0065] Figure 2 Spatial transcriptome results of candidate WNT secreted proteins.

[0066] Figure 3 Effect of human dental germ cell epithelium with WNT5B knocked out on the odontogenic ability of human dental germ mesenchymal cells.

[0067] Figure 4 Effect of overexpression of WNT5B and CTNNB1 on the odontogenic ability of human dental germ mesenchymal stem cells.

[0068] Figure 5 Effect of screening the optimal concentration of WNT5B on the odontogenic ability of human dental germ mesenchymal stem cells and the effect of WNT5B and CTNNB1 at a concentration of 100 ng / ml on the expression of odontogenesis-related genes DMP-1 and DSPP.

[0069] Figure 6 To verify the mineralization ability of WNT5B in regulating human dental germ mesenchymal stem cells by alkaline phosphatase staining.

[0070] Figure 7 To verify the mineralization ability of WNT5B in regulating human dental germ mesenchymal stem cells by alizarin red staining and its semi - quantitative experiment.

[0071] Figure 8 To determine that the odontogenic ability of the combined use of low - concentration WNT5B and CTNNB1 is significantly higher than that of high - concentration use alone by evaluating the expression of odontogenesis - related genes DMP - 1, DSPP and ALP and the mineralization effect. Detailed implementation manners

[0072] To make the objectives, technical solutions and advantages of this application clearer, the following further details this application. However, it should be understood that the description herein is only for the purpose of explaining this application and does not limit the scope of this application.

[0073] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs. The terms used in the description of this application herein are only for the purpose of describing specific embodiments and are not intended to limit this application. The reagents and instruments used herein are all commercially available, and the characterization means involved can refer to the relevant descriptions in the prior art and will not be elaborated herein.

[0074] Overview of the experimental methods in this study:

[0075] 1. Sample collection and processing:

[0076] This study used human embryonic dental germ samples. The sample source and processing method referred to the study of (Chen et al., 2024, The temporal protein signature analyses of developing human deciduous molar tooth germ - Chen - 2024 - PROTEOMICS - Wiley Online Library). Briefly, human embryonic dental germ samples at different developmental stages (from the cap stage to the early bell stage) were collected and appropriately processed and preserved.

[0077] 2. Spatial transcriptome sequencing:

[0078] The human embryonic tooth germ samples were analyzed using spatial transcriptome sequencing technology. The specific method referred to the research of (Chen et al., 2024). Sequencing was performed using the 10×Genomics Visium spatial gene expression platform, and data analysis was carried out using the R software package Seurat.

[0079] 3. Exocrine proteome sequencing:

[0080] The culture supernatants of tooth germ epithelial cells and mesenchymal cells were collected separately and subjected to exocrine proteome sequencing. The specific method referred to the research of (Chen et al., 2024). Liquid chromatography-tandem mass spectrometry (LC-MS / MS) was used for protein identification and quantitative analysis.

[0081] 4. Data integration and screening:

[0082] The spatial transcriptome data and exocrine proteome data were integrated and analyzed to screen out the signal molecules that were secreted the most during the development of tooth germ epithelium. The R software package was used for data integration and statistical analysis, and GO enrichment analysis was used to identify key signal molecules.

[0083] 5. Cell culture and differentiation induction:

[0084] Human tooth germ mesenchymal cells were isolated and cultured, referring to the method of (Kilic Bektas et al., 2022, Self-Assembled Hydrogel Microparticle-Based Tooth-Germ Organoids). Cells were treated with different concentrations of WNT5B and CTNNB1, either alone or in combination, to observe their effects on cell odontogenic differentiation.

[0085] 6. Detection of odontogenic differentiation markers:

[0086] The expression of odontogenic differentiation markers, including DSPP, DMP1, and ALP, etc., was further detected using real-time quantitative PCR (qPCR). Alkaline phosphatase (ALP) activity detection and alizarin red staining were also performed to evaluate the mineralization ability of cells.

[0087] 7. Statistical analysis:

[0088] All experiments were repeated at least three times. Data were expressed as mean ± standard deviation. Statistical analysis was performed using SPSS software, and one-way analysis of variance (ANOVA) and Tukey's multiple comparison test were used. P<0.05 was considered statistically significant.

[0089] To further understand this application, the following provides a more detailed description of this application in combination with the best embodiments.

[0090] Example 1

[0091] In this application, the exocrine protein WNT5B of human embryonic dental germ epithelial cells was screened for the first time, and on this basis, the role of epithelial-secreted WNT5B in the process of dental germ development was confirmed, especially the method and application of it as a factor promoting the odontogenic differentiation of dental stem cells.

[0092] The specific technical solution is as follows:

[0093] In the first aspect, this application provides a biological preparation containing WNT5B recombinant protein.

[0094] The screening method of this exocrine protein WNT5B of human dental germ epithelial cells includes the following steps:

[0095] a. Isolate epithelial cells from human embryonic dental germs and perform in vitro culture;

[0096] b. Collect the proteins secreted by epithelial cells and analyze the protein composition by proteomics technology;

[0097] c. Through bioinformatics methods, perform quantitative analysis on the collected proteins and screen out the WNT5B protein with the highest expression level.

[0098] Based on the same or highly similar screening process, this application also provides a biological preparation containing CTNNB1 recombinant protein (Catenin Beta 1), as well as the combined use of the two, that is, a biological preparation containing both WNT5B and CTNNB1 recombinant proteins.

[0099] In the second aspect, based on the above technology, the application of using WNT5B protein to promote the odontogenic differentiation of dental germ mesenchymal cells is proposed. The specific usage method includes the following steps:

[0100] a. Add the purified WNT5B protein or its active fragment to the dental germ mesenchymal cell culture medium;

[0101] b. Adjust the concentration of the WNT5B protein to determine the optimal conditions for promoting odontogenic differentiation;

[0102] c. Through cell biology methods, such as alkaline phosphatase staining, alizarin red staining and real-time quantitative PCR, etc., evaluate the effect of WNT5B protein on the odontogenic differentiation of dental germ mesenchymal cells.

[0103] Similarly, based on a similar usage method, the present application also provides the use of CTNNB1 protein (Catenin Beta 1) to promote the odontogenic differentiation of dental germ mesenchymal cells, as well as the combined use of the two, that is, the use of both WNT5B and CTNNB1 proteins to promote the odontogenic differentiation of dental germ mesenchymal cells.

[0104] In a third aspect, the present application can also provide a sustained-release preparation of WNT5B protein, which can be used for the continuous signal supply during dental tissue regeneration. The usage process includes the following steps:

[0105] a. Select a sustained-release gel biodegradable material as the carrier;

[0106] b. Mix the WNT5B protein with the carrier material to form a sustained-release preparation.

[0107] The carrier can specifically adopt the following preparations:

[0108] 1. Poly(lactic-co-glycolic acid) (PLGA):

[0109] PLGA is a biodegradable and biocompatible copolymer composed of lactic acid (LA) and glycolic acid (GA) monomers; it has good controllable degradability, and its degradation rate and drug release rate can be regulated by adjusting the ratio of lactic acid and glycolic acid.

[0110] Characteristics of PLGA:

[0111] 1) Adjustable: By changing the polymerization ratio (the ratio of lactic acid to glycolic acid), the degradation time and drug release rate can be adjusted;

[0112] 2) Non-toxic degradation products: The degradation products of PLGA in vivo are lactic acid and glycolic acid, which are normal metabolites in the body, so no harmful accumulation will occur;

[0113] 3) High drug loading: Suitable for loading a variety of drugs, including proteins, antibiotics, and gene therapy vectors, etc.;

[0114] 4) Application: PLGA can be used to prepare a drug sustained-release gel, especially suitable for the long-term release of bioactive proteins (such as WNT5B and CTNNB1); its degradation time can be adjusted according to needs to ensure continuous drug release in the body, and it has good clinical application prospects.

[0115] The preparation process of PLGA as a sustained-release gel carrier:

[0116] Step 1: Dissolve PLGA in a suitable organic solvent (such as dichloromethane) to form a uniform solution;

[0117] Step 2: Add the recombinant proteins of WNT5B and CTNNB1 into the PLGA solution and mix evenly.

[0118] Step 3: Add stabilizers and crosslinking agents (such as PEG, gelatin, etc.) to further enhance the gelling performance.

[0119] Step 4: Prepare the mixed solution into a gel by the solvent evaporation method or the water-in-oil emulsion method.

[0120] Step 5: Freeze-dry the gel to form a drug sustained-release gel with controlled release.

[0121] 2. Sodium alginate:

[0122] Sodium alginate is a natural polysaccharide, usually extracted from seaweeds. It has biodegradable properties and good biocompatibility, and is widely used in drug delivery systems.

[0123] Characteristics of sodium alginate:

[0124] 1) High biocompatibility: Sodium alginate is a natural material, not only has good biocompatibility, but also has no obvious immunogenic reaction.

[0125] 2) Adjustable: The network structure of the gel can be controlled by adjusting the type and concentration of the crosslinking agent (for example, calcium chloride), and then the drug release rate can be adjusted.

[0126] 3) Injectability: Sodium alginate gel can form a form suitable for injection and has good degradability in vivo.

[0127] 4) Applications: As a carrier material, sodium alginate is often used for the delivery of proteins, cells and genes. It can form a sustained-release gel by the ion crosslinking method and the solvent evaporation method, and is suitable as a sustained-release carrier for proteins such as WNT5B and CTNNB1.

[0128] Preparation process of sodium alginate as a sustained-release gel carrier:

[0129] Step 1: Dissolve sodium alginate in distilled water to form an aqueous solution with a certain concentration.

[0130] Step 2: Dissolve the proteins of WNT5B and CTNNB1 in the sodium alginate solution and mix evenly.

[0131] Step 3: Slowly add calcium chloride solution to the mixture to crosslink sodium alginate and form a gel.

[0132] Step 4: Control the degradation rate of the gel and the drug release rate by adjusting the crosslinking time and the concentration of the crosslinking agent.

[0133] Step 5: After the gel preparation is completed, the final product can be obtained by freeze-drying or injection molding.

[0134] 3. Gelatin:

[0135] Gelatin is a natural protein material derived from animal collagen; it has good biocompatibility and biodegradability and is commonly used in the preparation of drug sustained-release carriers.

[0136] Characteristics of gelatin:

[0137] 1) Biodegradability: Gelatin will hydrolyze and degrade in the body, is non-toxic and easy to excrete;

[0138] 2) Adjustable property: The solubility and gel strength of gelatin can be adjusted by changing the pH value or adding a cross-linking agent (such as glutaraldehyde);

[0139] 3) Gelation property: Gelatin easily forms a hydrogel under temperature changes and is suitable for use as a sustained-release carrier;

[0140] 4) Application: Suitable for sustained-release preparations that require biodegradation, especially as a carrier for protein drugs.

[0141] Preparation process of gelatin as a sustained-release gel carrier:

[0142] Step 1: Dissolve gelatin in distilled water at an appropriate temperature (such as 50 - 60 °C) to make a solution;

[0143] Step 2: Add WNT5B and CTNNB1 proteins to the gelatin solution and mix evenly;

[0144] Step 3: Enhance the gel structure of gelatin by adding a cross-linking agent (such as glutaraldehyde) to adjust the hardness and degradability of the gel;

[0145] Step 4: Cool the solution to room temperature to form a gel;

[0146] Step 5: Freeze-dry the gel to finally obtain a preparation with a sustained-release effect.

[0147] 4. Polyvinyl alcohol (PVA):

[0148] Polyvinyl alcohol (PVA) is a water-soluble synthetic polymer material with good gel-forming property and biocompatibility. PVA can be combined with other biodegradable materials and used as a carrier for sustained-release preparations.

[0149] Characteristics of polyvinyl alcohol (PVA):

[0150] 1) Water solubility: PVA dissolves in water to form a transparent solution and is easily prepared into a hydrogel;

[0151] 2) Good biocompatibility and biodegradability: PVA usually has good biocompatibility and can be gradually degraded in vivo;

[0152] 3) Adjustable mechanical strength and release rate: The structure and drug release rate of the gel can be changed by adjusting the concentration of PVA and the type of crosslinking agent;

[0153] 4) Applications: PVA is commonly used in the preparation of oral sustained-release formulations, injectable sustained-release formulations, and local delivery systems.

[0154] Preparation process of polyvinyl alcohol (PVA) as a sustained-release gel carrier:

[0155] Step 1: Dissolve PVA in distilled water and heat it to a high temperature to completely dissolve it;

[0156] Step 2: Add WNT5B and CTNNB1 proteins to the PVA solution and mix evenly;

[0157] Step 3: Crosslink by adding a crosslinking agent (such as glutaraldehyde, calcium chloride, etc.) to convert the PVA solution into a gel;

[0158] Step 4: Immerse the gel in a cooling solution to complete the crosslinking and drug sustained-release process;

[0159] Step 5: After the gel is formed, perform freeze-drying or spray-drying.

[0160] 5. Chitosan:

[0161] Chitosan is a natural polysaccharide extracted from the exoskeletons of crustaceans (such as shrimps and crabs), and has good biodegradability, low toxicity, and biocompatibility.

[0162] Characteristics of chitosan:

[0163] 1) Biodegradable: Chitosan will be gradually degraded in vivo through the action of enzymes;

[0164] 2) Antibacterial property: Chitosan has natural antibacterial properties and is suitable for local delivery;

[0165] 3) Strong gel-forming ability: Chitosan can react with a crosslinking agent (such as ferric chloride) under acidic conditions to form a gel;

[0166] 4) Applications: Chitosan is commonly used in the sustained-release delivery of proteins and gene drugs, and is especially suitable for local delivery and biodegradable sustained-release carriers.

[0167] Preparation process of chitosan as a sustained-release gel carrier:

[0168] Step 1: Dissolve chitosan in an appropriate amount of acidic solution (such as acetic acid solution) to form a solution;

[0169] Step 2: Add WNT5B and CTNNB1 proteins into the solution and mix evenly;

[0170] Step 3: Form a controllable-release chitosan gel by adding ferric chloride or other cross-linking agents;

[0171] Step 4: Lyophilize or freeze-mold the gel to form a stable sustained-release preparation.

[0172] Based on a similar usage process, this application also provides a CTNNB1 protein sustained-release preparation for continuous signal supply during tooth tissue regeneration, as well as the combined use of the two, that is, a "WNT5B protein + CTNNB1 protein" sustained-release preparation for continuous signal supply during tooth tissue regeneration.

[0173] Fourthly, this application can provide a dentin formation promoter, mainly composed of WNT5B protein or its derivatives and CTNNB1 protein, for promoting the natural formation and repair of dentin.

[0174] Fifthly, this application provides a tooth germ development research tool, including recombinant proteins, antibodies or small molecule compounds for simulating the functions of WNT5B / CTNNB1 proteins, for screening signal pathways or drugs that may affect tooth germ development.

[0175] In the above various preparations, the concentration of WNT5B recombinant protein is 10 ng / ml - 100 ng / ml; the concentration of CTNNB1 recombinant protein is 10 ng / ml - 100 ng / ml; and their preferred concentration is 10 ng / ml.

[0176] Similarly, the odontogenic differentiation medium containing WNT5B protein and / or CTNNB1 protein also falls within the protection scope of this application.

[0177] The odontogenic differentiation medium is selected from one or more of the odontogenic differentiation media for culturing dental germ mesenchymal cells, the odontogenic differentiation media for culturing dental pulp stem cells, the odontogenic differentiation media for tooth germ tissue regeneration, and the odontogenic differentiation media for dentin regeneration and repair.

[0178] The usage method of the medium is: Place cells with odontogenic potential in the medium containing WNT5B protein and / or CTNNB1 protein for culture, and the cells with odontogenic potential are dental germ mesenchymal cells and / or dental pulp stem cells.

[0179] Example 2

[0180] 1. Screening of the exocrine protein WNT5B in human dental germ epithelial cells:

[0181] (1) Sample acquisition and protein extraction:

[0182] Human fetuses aborted surgically and pharmacologically at approximately 11 - 12 weeks of gestation provided by Beijing Obstetrics and Gynecology Hospital, Capital Medical University were obtained. Three fetuses were used in this study. The mandibular dental germs were dissected carefully, and dental epithelial tissues and dental mesenchymes were obtained for in vitro culture. The use of human fetuses in this study was approved by the Ethics Committee of Capital Medical University. Participants provided written informed consent agreeing to use their embryos aborted pharmacologically for scientific research. 300 μL of 8 M urea was added to the exocrine proteins of epithelial cells, and protease inhibitors were added at 10% of the lysis buffer. After centrifugation at 14,100×g for 20 minutes, the supernatant was collected, and the protein concentration was determined by the Bradford method. The rest was frozen at -80 °C.

[0183] (2) Protein digestion and desalting:

[0184] 100 μg of protein was extracted from each sample and then reduced. 200 mM dithiothreitol (DTT) solution was added and incubated at 37 °C for 1 hour. The sample was diluted 4-fold with 25 mM ammonium bicarbonate (ABC) buffer. Then trypsin (trypsin:protein = 1:50) was added and incubated at 37 °C overnight. The next day, 50 μL of 0.1% FA was added to terminate the digestion. 100 μl of 100% ACN was used to wash the C18 column, and centrifuged at 1200 rpm for 3 min. The column was washed once with 100 μl of 0.1% FA and centrifuged at 1200 rpm for 3 min. The EP tube was replaced, the sample was added, and centrifuged at 1200 rpm for 3 min. The column was washed twice with 100 μl of 0.1% FA and centrifuged at 1200 rpm for 3 min. The column was washed once with 100 μl of pH 10 water. The EP tube was replaced, and eluted with 70% ACN. The eluates of each sample were combined and lyophilized. It was stored at -80 °C until loading.

[0185] (3) LC-MS / MS analysis:

[0186] The tryptic peptides were analyzed by nano-LC-MS / MS using a quadrupole Orbitrap mass spectrometer (Q Exactive HF-X, Thermo Fisher Scientific, Bremen, Germany) coupled with an EASY nLC 1200 ultra-high pressure system (Thermo Fisher Scientific) via a nanoelectrospray ionization source. 500 ng of peptides were loaded onto a 25-cm column (inner diameter 150 μm, packed with ReproSil-Pur C18-AQ 1.9-μm silica beads; Beijing Qinglian Biotechnology Co., Ltd., Beijing, China). The peptide separation was carried out using a gradient where the concentration of B was increased from 8% to 12% in 5 minutes, from 12% to 30% in 33 minutes, to 40% in 7 minutes, and then the column was washed with 95% B at 600 nl / min for 15 minutes, where solvent A was 0.1% formic acid aqueous solution and solvent B was 80% ACN and 0.1% formic acid aqueous solution. The total run time was 60 minutes. The column temperature was maintained at 60 °C using an in-house developed oven. Briefly, the mass spectrometer was operated in the "top-40" data-dependent mode, MS spectra were acquired in the Orbitrap mass analyzer (120,000 resolution, 350–1500 m / z range) with an automatic gain control (AGC) target of 3E6 and a maximum ion injection time of 80 ms. The strongest ions in the full scan were isolated with an isolation width of 1.6 m / z. After high-energy collision dissociation (HCD), the normalized collision energy (NCE) was 27, and MS / MS spectra were acquired in the Orbitrap (15,000 resolution) with an AGC target of 5E4 and a maximum ion injection time of 45 ms. Precursor dynamic exclusion was enabled for a duration of 16 s.

[0187] (4) Identification of secreted proteins and DEP functional analysis:

[0188] All RAW files were analyzed using the Proteome Discoverer suite (version 2.4, Thermo Fisher Scientific). MS2 spectra were searched against the uniprot Homo sapiens SP proteome database (20,407 target sequences downloaded on 2023-03-07). The Sequest HT search engine was used with the following parameters specified: full trypsin specificity, up to two missed cleavages, a minimum peptide length of 6, fixed carbamidomethylation of cysteine residues (+57.02146 Da), variable modification of methionine residues with oxidation (+15.99492 Da), a precursor mass tolerance of 15 ppm, and a fragment mass tolerance of 0.02 Da (for MS2 spectra collected in the Orbitrap). Peptide-spectrum matches and peptides were filtered using Percolator to have a false discovery rate (FDR) of less than 1%. After spectral assignment, peptides were assembled into proteins and further filtered based on the combined probabilities of their constituent peptides, with a final FDR of 1%. By default, the most matched protein or "master protein" is the protein with the most unique peptides and the smallest percentage of peptide coverage (i.e., the longest protein). Only unique and most parsimonious peptides were considered for quantification.

[0189] The interproscan-5 program was used for Gene Ontology (GO) and InterPro (IPR) analysis against a non-redundant protein database, and the databases COG (Clusters of Orthologous Groups) and KEGG (Kyoto Encyclopedia of Genes and Genomes) were used for analyzing protein families and pathways. Enrichment procedures were used for enrichment analysis of GO and KEGG respectively.

[0190] 952 differentially expressed proteins secreted by dental epithelium and dental mesenchymal tissues were screened, among which WNT5b was the most significantly differentially expressed in the secreted proteins upregulated in dental epithelium. To verify the above results, WNT5B recombinant protein overexpression and WNT5b knockout were performed on dental epithelial cells to verify the effect of WNT5b secreted protein on the odontogenic ability of dental mesenchymal stem cells. It was shown that WNT5B is crucial for dentin formation.

[0191] 1) Spatial transcriptome analysis of human tooth germs:

[0192] The frozen sections were cut into 10 μm thick and mounted onto the GEX array. The sections were placed on the Thermocycler Adaptor with the active surface facing up, incubated at 37°C for 1 minute, fixed with methanol at -20°C for 30 minutes, and then stained with hematoxylin and eosin stain (H&E) (Eosin, Dako). Bright-field images were taken on a Leica DMI8 whole-slide scanner at 10× resolution.

[0193] Process Visium Spatial Gene Expression using the Visium Spatial Gene Expression slide and kit (10×Genomics, PN-1000184). Add 70 μl of permease and incubate at 37 °C for 36 minutes. Wash each well with 100 μl of SSC, and add 75 μl of Reverse Transcription Master Mix for cDNA synthesis.

[0194] After the first-strand synthesis is completed, remove the RT Master Mix from the wells. Add 75 μl of 0.08 M KOH, incubate at room temperature for 5 minutes, then remove the KOH from the wells and wash with 100 μl of EB buffer. Add 75 μl of Second StrandMix to each well for second-strand synthesis. cDNA amplification is performed on an S1000TM Touch Thermal Cycler (Bio Rad).

[0195] The Visum spatial library is constructed using the Visum Spatial Library Construction Kit (10×Genomics, PN-1000184). Finally, the library is sequenced using an Illumina Novaseq6000 sequencer with a sequencing depth of at least 100,000 reads per spot, adopting a paired-end 150 bp (PE150) read strategy (performed by CapitalBio Technology Co., Ltd., Beijing).

[0196] 2) Isolate human dental follicle mesenchymal cells:

[0197] Isolate and culture human dental follicle mesenchymal cells until the 3rd passage, and seed them in 12-well plates at a density of 5×10 5 / well. Divide them into an odontogenic induction group, a WNT5A group, and a WNT5B group.

[0198] The culture medium for each group is as follows:

[0199] Odontogenic induction group: Odontogenic induction differentiation medium;

[0200] WNT5A group: Odontogenic induction differentiation medium + WNT5A recombinant protein (at two concentrations of 10 ng / ml and 100 ng / ml);

[0201] Wnt5B group: Odontogenic induction differentiation medium + WNT5B recombinant protein (at two concentrations of 10 ng / ml and 100 ng / ml);

[0202] 3) In vitro odontogenic induction and differentiation:

[0203] Tooth induction differentiation medium: On the basis of the basal medium, add 10 mmol / L β-glycerophosphate, 10 nmol / L dexamethasone, and 50 mg / L vitamin C. Extract RNA at 7 days and 14 days of culture respectively, and perform alkaline phosphatase staining and alizarin red staining.

[0204] 4) Alkaline phosphatase staining:

[0205] a. Remove the medium and wash twice with PBS;

[0206] b. Fix with paraformaldehyde at room temperature for 0.5 h;

[0207] c. Wash twice with double-distilled water;

[0208] d. Prepare the staining solution: Gently mix 1 ml of Sodium Nitrite Solution with 1 ml of FRV-Alkaline

[0209] Solution and wait for 2 minutes. Add it to 45 ml of deionized water, and finally add 1 ml of Naphthol AS-BI Alkaline Solution and mix well;

[0210] e. Add the staining solution to the 12-well plate, 1 ml per well, and stain at room temperature for 15 minutes, observing the coloring situation with the naked eye;

[0211] f. Wash 5 times with double-distilled water and gently pipette;

[0212] g. Observe under the microscope and collect images.

[0213] 5) Alizarin red staining:

[0214] a. Remove the medium and wash twice with PBS;

[0215] b. Fix with paraformaldehyde at 4°C for 30 min;

[0216] c. Wash twice with double-distilled water;

[0217] d. Stain with 40 mM alizarin red solution (pH 4.2) at room temperature for 1 - 10 minutes, observing the coloring situation with the naked eye;

[0218] e. Wash 5 times with double-distilled water and gently pipette;

[0219] f. Observe under the microscope and collect images;

[0220] 6) Realtime qPCR primer sequences:

[0221] a) GAPDH:

[0222] Forward: 5’-GCACCGTCAAGGCTGAGAAC-3’ (SEQ ID No.5);

[0223] Reverse: 5’-ATGGTGGTGAAGACGCCAGT-3’ (SEQ ID No.6);

[0224] b) ALP:

[0225] Forward: 5’-AACATCAGGGACATTGACGTG-3’ (SEQ ID No.7);

[0226] Reverse: 5’-GTATCTCGGTTTGAAGCTCTTCC-3’ (SEQ ID No.8);

[0227] c) DSPP:

[0228] Forward: 5’-GGGATGTTGGCGATGCA-3’ (SEQ ID No.9);

[0229] Reverse: 5’-CCAGCTACTTGAGGTCCATCTTC-3’ (SEQ ID No.10);

[0230] d) BSP:

[0231] Forward: 5’-TGAATACGAGGGGGAGTACG-3’ (SEQ ID No.11);

[0232] Reverse: 5’-TAGCCATCGTAGCCTTGTCC-3’ (SEQ ID No.12);

[0233] e) DMP-1:

[0234] Forward: 5’-GCAGAGTGATGACCCAGAG-3’ (SEQ ID No.13);

[0235] Reverse: 5’-GCTCGCTTCTGTCATCTTCC-3’ (SEQ ID No.14).

[0236] 7) Experimental procedures:

[0237] A. Experimental preparations before RNA extraction:

[0238] a. Preparation of DEPC water: Add 600 μl of DEPC to 600 ml of water to prepare DEPC water. Shake overnight on a shaker. The next day, autoclave at high temperature and pressure for 30 minutes.

[0239] b. Plastic products such as disposable pipette tips and centrifuge tubes are soaked in an aqueous solution of 0.1% DEPC overnight, autoclaved the next day, and then dried in an oven.

[0240] c. Glassware and mortar are baked at 180 °C for 4 hours.

[0241] d. Preparation of solutions: Prepared with 0.1% DEPC-treated water, treated at 37 °C for at least 12 hours, and then autoclaved.

[0242] B. RNA extraction:

[0243] a. Sample treatment: Cells are lysed with 1 ml of Trizol lysis buffer.

[0244] b. Vigorously shake and mix the homogenized sample, and then place it on ice for 10 minutes to completely separate the nucleic acid-protein complex.

[0245] c. Centrifuge at 12,000 g for 5 minutes at 4 °C, take the supernatant, and transfer it to a new RNase-free centrifuge tube.

[0246] d. Add 0.2 ml of chloroform to every 1 ml of sample, cover the tube cap, shake vigorously for more than 15 seconds, and place it on ice for 3 minutes.

[0247] e. Centrifuge at 12,000 g for 15 minutes at 4 °C, and transfer the top layer to a new tube.

[0248] f. Slowly add an equal volume of isopropanol, invert and mix well, incubate on ice for 10 minutes to precipitate RNA.

[0249] g. Centrifuge at 12,000 g for 10 minutes at 4 °C, discard the supernatant.

[0250] h. Add 1 ml of 75% ethanol, invert and mix well to wash the precipitate, centrifuge at 7500 g for 5 minutes at 4 °C, and discard the waste liquid.

[0251] i. Open the lid and air-dry for 5 - 10 minutes, dissolve the precipitate with 20 μl of ultrapure water, and incubate at 56 °C for 10 minutes to assist dissolution.

[0252] j. Detection of RNA OD value:

[0253] Put it on an enzyme-linked immunosorbent assay (ELISA) reader, and use Gen5 software to measure the RNA concentration and OD260 / 280 ratio. Usually, a value between 1.6 - 2.0 is normal.

[0254] C. Reverse transcription PCR:

[0255] 1) Mix and centrifuge each solution before use; calculate the amount of RNA, divide 5 μg by the RNA concentration to calculate the required number of μl.

[0256] 2) Prepare the template RNA / primer mixture in a microtube. Take the template RNA according to the calculated number of μl, add 1 μl of random primer or Oligo-(dT) and dNTP (mix) respectively; the total volume is 5 μl.

[0257] 3) Incubate at 70 °C for 5 minutes, then quickly cool on ice for more than 5 minutes, centrifuge in a microcentrifuge for 10 seconds, and store temporarily on ice.

[0258] 4) Prepare the reverse transcription reaction mixture, a 15 μl system, prepared on ice. Add 4 μl of 5×PCR reaction buffer, 3 μl of MgCl2, 1 μl of PCR Nucleotide Mix (final concentration of 0.5 mM each dNTP), 0.5 μl of RNAse Inhibit to each sample, and make up the rest with double-distilled water, centrifuge for 10 seconds, and mix well.

[0259] 5) Annealing: 25 °C, 5 minutes.

[0260] 6) Extension: 42 °C, 1 hour.

[0261] 7) Inactivate the reverse transcriptase, incubate at 70 °C for 15 minutes, and cool at 4 °C.

[0262] D. Detect the OD value of cDNA:

[0263] Put it on the microplate reader, use Gen5 software to measure the DNA concentration and the OD260 / 280 ratio, usually between 1.6 - 2.0 is normal.

[0264] E. Realtime PCR:

[0265] 1) Configure the components of the Real-time PCR reaction system as shown in Table 1 below.

[0266] Table 1

[0267]

[0268]

[0269] 2) The Real-time PCR reaction system is shown in Table 2.

[0270] Table 2

[0271]

[0272] F. Calculation formula for quantitative PCR:

[0273] Step 1: Calculate ΔCt = Ct value of the gene - Ct value of the internal reference GAPDH;

[0274] Step 2: Calculate ΔΔCt = ΔCt of the treatment - ΔCt of the control;

[0275] Step 3: Calculate the negative ΔΔCt power of 2;

[0276] The control of the final result is 1. If other treatments are greater than 1, it indicates that the gene expression is up-regulated; if it is less than 1, it indicates that the gene expression is down-regulated.

[0277] 8) Experimental results:

[0278] Quantitative proteomic analysis was performed on the exocrine proteins of human dental germ epithelium and human dental germ mesenchyme. The results showed that there were 698 differentially expressed proteins significantly up-regulated in human dental epithelium exocrine proteins, and GO analysis enrichment showed that they were mainly enriched in the WNT signaling pathway.

[0279] Figure 1 It was shown that WNT5B and CTNNB1 were significantly up-regulated in epithelial secretory proteins, which were closely related to the WNT signaling pathway and cell morphogenesis. There were no significant differences in WNT5A and WNT7A. GO enrichment analysis showed that the up-regulated genes in epithelial exocrine proteins were mostly enriched in the WNT signaling pathway, indicating that the WNT signaling pathway plays an important role in the development of dental germ epithelium.

[0280] Figure 1 The flow chart of the experiment was shown. First, the secretory proteins were collected from dental epithelium (DE group) and dental mesenchyme (DM group) samples, then trypsin digestion treatment was carried out, and then the secretory proteome was analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS). This flow chart demonstrated the complete process from sample collection to secretory protein analysis, aiming to study the differences in the composition of secretory proteins between dental epithelium and dental mesenchyme.

[0281] Figure 1 The comparison results of the up-regulation and down-regulation of secretory proteins between dental epithelium (DE group) and dental mesenchyme (DM group) were shown. The green columns represented 698 secretory proteins up-regulated in the dental epithelium group, while the pink columns represented 254 secretory proteins down-regulated in the dental mesenchyme group. This figure indicated the significant differences in the quantity of secretory proteins between dental epithelium and dental mesenchyme.

[0282] Figure 1The differential expression of secreted proteins between the dental epithelium group (DE) and the dental mesenchyme group (DM) was shown in a volcano plot. The abscissa represents the log2 fold change log2(FC) of secreted protein expression, and the ordinate represents the negative logarithm of the p-value -log10(P-value). Green dots and pink dots represent proteins significantly upregulated in the dental epithelium group and the dental mesenchyme group, respectively. It can be seen from the figure that proteins such as WNT5B, CTNNB1, WNT7A, and TGF-β1 were significantly upregulated in the dental epithelium group, indicating that the expression of these secreted proteins in the dental epithelium was significantly higher than that in the dental mesenchyme.

[0283] Figure 1 The expression levels of key secreted proteins in the dental epithelium group (DE) and the dental mesenchyme group (DM) were shown in a heatmap. The color gradient represents the level of expression (red for high expression and blue for low expression), including important proteins such as WNT5B, CTNNB1, and WNT7A. This figure clearly demonstrated the differential expression patterns of these key proteins in the dental epithelium and the dental mesenchyme groups.

[0284] Figure 1 The biological pathways enriched by the secreted proteins significantly upregulated in the dental epithelium group (DE) were shown. The upregulated secreted proteins were mainly enriched in vesicle-mediated transport, cell morphogenesis, signal transduction, WNT signaling pathway, etc. This indicates that the secreted proteins in the dental epithelium group may play an important role in regulating cell morphology and signal transduction.

[0285] Figure 1 The biological pathways enriched by the secreted proteins significantly upregulated in the dental mesenchyme group (DM) were shown. These proteins were mainly enriched in collagen fibril organization, extracellular matrix organization, TGF-β receptor signaling pathway, BMP signaling pathway, etc. It indicates that the expression of secreted proteins in the dental mesenchyme group was significantly enhanced in regulating the extracellular matrix and cell differentiation, etc.

[0286] By Figure 1 the differences in secreted proteins and related biological functions between the dental epithelium group and the dental mesenchyme group can be shown, and these differences may be closely related to tooth development and tissue-specific functions.

[0287] Figure 2 Spatial transcriptome data demonstrated the expression of WNT5B, CTNNB1, WNT5A, and WNT7A in the epithelial tissue of human tooth germs. The results showed that WNT5B and CTNNB1 were significantly expressed in the epithelial region, indicating their important role in local cell differentiation and development; while WNT5A and WNT7A showed low levels but with local specificity, suggesting the spatial specificity of the WNT signaling pathway in tissue development.

[0288] Subsequently, human dental epithelial cells with WNT5B knocked out were co-cultured with human dental mesenchymal cells in vitro. The results were as Figure 3 shown. It was found that knocking out WNT5B in human dental epithelial cells affected their regulation of odontogenesis of human dental mesenchymal stem cells. The expression of WNT5B in the supernatant was detected by ELISA, as well as the expression changes of odontogenesis-related genes (DSPP, DMP1, ALP) in dental mesenchymal cells. It was shown that knocking out epithelial WNT5B significantly reduced the expression levels of DSPP, DMP1, and ALP in dental mesenchyme, indicating that WNT5B plays an important role in promoting the odontogenic ability of human dental mesenchymal stem cells.

[0289] Human dental mesenchymal cells were isolated and cultured, induced for odontogenic differentiation, and recombinant proteins of different concentrations of WNT5A and WNT5B were added respectively. RT-qPCR detection found that WNT5B promoted odontogenic differentiation of human dental mesenchymal cells more strongly than WNT5A. The results were as Figure 4 shown. Both WNT5B and CTNNB1 promoted odontogenesis of human dental mesenchymal stem cells, that is, both WNT5B and CTNNB1 proteins significantly promoted the expression of odontogenesis-related genes (DSPP, DMP1, ALP, BSP) in dental mesenchymal cells, indicating that both of these signaling pathways play a role in promoting odontogenic differentiation of dental mesenchymal stem cells.

[0290] Further combined with alkaline phosphatase staining, the results were as Figure 6 shown. It was found that WNT5B promoted the mineralization ability of human dental mesenchymal cells more strongly than WNT5A. At the same time, when WNT5B and CTNNB1 were used in combination at low concentrations, the expression of odontogenic genes (DMP-1, DSPP, ALP) and the mineralization effect were significantly better than those used alone at high concentrations, indicating that they have a synergistic effect in promoting odontogenic differentiation under low-dose combination.

[0291] Subsequently, the working concentrations of WNT5B recombinant protein and CTNNB1 recombinant protein were screened. The results were as Figure 5As shown, PCR detection found that 10 ng / ml of WNT5B could significantly promote the expression of odontogenic genes in human dental follicle mesenchymal cells, and both WNT5B and CTNNB1 showed a stronger promoting effect on odontogenic differentiation than WNT5A. By comparing the effects of WNT5B and CTNNB1 at a concentration of 100 ng / ml on the expression of odontogenesis-related genes DMP-1 and DSPP, it was found that both WNT5B and CTNNB1 significantly up-regulated the expression levels of these two genes, and their effects were significantly better than the positive control WNT5A, indicating that WNT5B and CTNNB1 play an important role in promoting odontogenic differentiation of dental follicle cells.

[0292] Furthermore, through alkaline phosphatase and alizarin red staining, it was found that 10 ng / ml was the optimal concentration for WNT5B to promote the mineralization ability of human dental follicle mesenchymal cells (dark gray represents mineralization, and the darker the color, the stronger the mineralization ability) ( Figure 6 、 Figure 8 ).

[0293] Potential mechanisms of the synergistic effect of low-concentration WNT5B and CTNNB1:

[0294] 1.1 Signal pathway interaction:

[0295] 1.1.1 Cross-regulation between non-canonical and canonical WNT pathways:

[0296] Low-concentration WNT5B may indirectly affect the activity of the canonical WNT pathway by activating downstream molecules of non-canonical WNT pathways such as RhoA and JNK. For example, the activation of JNK may enhance its transcriptional activity by phosphorylating CTNNB1. This cross-regulation may be more significant under low-concentration conditions, thus achieving the synergistic effect of WNT5B and CTNNB1.

[0297] 1.1.2 Regulation of CTNNB1 stability and activity:

[0298] WNT5B may enhance the output of the canonical WNT signaling pathway by affecting the stability or activity of CTNNB1. Low-concentration WNT5B may increase the intracellular concentration and activity of CTNNB1 by inhibiting the degradation complex of CTNNB1 or promoting its nuclear translocation. This regulatory mechanism may be more sensitive under low-concentration conditions, thus achieving a synergistic effect.

[0299] 1.2 Co-regulation of downstream gene expression:

[0300] Low-concentration WNT5B and CTNNB1 may jointly regulate the expression of certain key genes, which play important roles in tooth development and odontoblast differentiation. For example, genes such as SOX2 and AXIN2 have been confirmed as important target genes of the WNT signaling pathway. Low-concentration WNT5B may enhance the transcriptional activity of CTNNB1 or recruit other transcriptional cofactors, enabling these target genes to be effectively activated even under low-level stimulation, thereby producing a synergistic effect.

[0301] 1.3 Synergistic regulation of cell behavior:

[0302] During tooth development, behaviors such as cell polarity, migration, and differentiation need to be precisely regulated. Low-concentration WNT5B may provide a suitable microenvironment for the role of CTNNB1 in cell proliferation and differentiation by regulating cytoskeleton remodeling and polarity establishment. For example, WNT5B may promote the arrangement and orientation of odontoblasts at appropriate spatial positions, while CTNNB1 activates related genes to further promote tooth development.

[0303] 1.4 Regulation of cell fate determination:

[0304] In the early stage of tooth development, low-concentration WNT5B may assist CTNNB1 in regulating stem cell fate determination by affecting the polarity and migration ability of stem cells. WNT5B may regulate the initial differentiation state of cells through the non-canonical WNT pathway, while CTNNB1 further guides the differentiation of these cells into odontoblasts by activating specific gene expression. This synergistic effect may ensure that cells can effectively complete the differentiation process at the appropriate time and environment.

[0305] The above are only the preferred embodiments of this application and are not intended to limit this application. Any modifications, equivalent replacements, or improvements made within the spirit and principles of this application shall be included within the protection scope of this application.

Claims

1. A biological agent, characterized in that: The biological preparation contains WNT5B recombinant protein.

2. The biological agent according to claim 1, characterized in that The biological preparation also contains CTNNB1 recombinant protein.

3. The biological agent according to claim 1 or 2, characterized in that: The amino acid sequence of the WNT5B recombinant protein is shown in sequence SEQ ID No.1, and the amino acid sequence of the CTNNB1 recombinant protein is shown in sequence SEQ ID No.2; the nucleotide sequence encoding the WNT5B recombinant protein is shown in sequence SEQ ID No.3, and the nucleotide sequence encoding the CTNNB1 recombinant protein is shown in sequence SEQ ID No.

4.

4. The biological agent according to any one of claims 1 to 3, characterized in that The concentration of the WNT5B recombinant protein is 10 ng / ml-100 ng / ml; the concentration of the CTNNB1 recombinant protein is 10 ng / ml-100 ng / ml.

5. The method for preparing a biological agent according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1. Dissolving PLGA: Weigh 250 mg of poly(lactic-co-glycolic acid) copolymer PLGA and dissolve it in 1 ml of dichloromethane DCM to obtain a PLGA solution; S2. Protein solution preparation: Weigh 10 μg of WNT5B and CTNNB1 recombinant proteins and dissolve them in 1 ml of an appropriate buffer to obtain a protein solution; the buffer may be PBS buffer or deionized water; S3. Protein mixed with PLGA solution: Add the protein solution to the PLGA solution and stir evenly to ensure that the protein and PLGA are fully mixed; S4. Emulsification process: The mixed solution is added to 5 ml of deionized water containing 1% polyvinyl alcohol (PVA) solution, and an ultrasonic treatment is performed to form an emulsion. The ultrasonic treatment is performed at 15-25 kHz for 25-35 seconds, preferably at 20 kHz for 30 seconds. S5. Solvent removal: The dichloromethane (DCM) in the emulsion is removed by rotary evaporation until solid nanoparticles are obtained; S6. Particle washing: The solid nanoparticles were repeatedly washed with deionized water to remove unencapsulated proteins and emulsifiers to obtain pure nanoparticles; S7. Drying treatment: The nanoparticles were lyophilized for long-term storage and stability assessment.

6. Use of the biological preparation according to any one of claims 1 to 4 in the preparation of a product that promotes tooth differentiation.

7. The use according to claim 6, characterized in that: The prepared product promoting odontogenic differentiation is selected from one or more of products promoting odontogenic differentiation of tooth germ mesenchymal cells, products promoting odontogenic differentiation of dental pulp stem cells, products promoting tooth germ tissue regeneration, products promoting dental pulp regeneration and repair, products promoting periodontal tissue repair and products promoting dentin regeneration and repair.

8. Use of the biological agent according to any one of claims 1 to 4 in the preparation of a culture medium for promoting odontogenic differentiation, characterized in that: The odontogenic differentiation medium is selected from one or more of an odontogenic differentiation medium for culturing tooth germ mesenchymal cells, an odontogenic differentiation medium for culturing dental pulp stem cells, an odontogenic differentiation medium for tooth germ tissue regeneration, and an odontogenic differentiation medium for dentin regeneration and repair.

9. A method for promoting odontogenesis in vitro, characterized in that: The method comprises placing cells with odontogenic potential in a culture medium containing a differentiation promoting agent for culturing, wherein the differentiation promoting agent is one or more of WNT5B and CTNNB1.

10. The method for promoting odontogenic differentiation in vitro according to claim 9, characterized in that: The cells with odontogenic potential are selected from one or more of tooth germ mesenchymal cells and dental pulp stem cells.

Images