Recombinant microorganism and application thereof in fermentation production of L-histidine

Abstract

The invention relates to the technical field of biochemical engineering, and particularly discloses a recombinant microorganism and application thereof in fermentation production of L-histidine. Compared with an original strain, the recombinant microorganism provided by the invention has the advantages that serine hydroxymethyltransferase glyA is overexpressed, and / or glycine cleavage proteins gcvP, gcvT and gcvH are overexpressed, and the original strain is escherichia coli capable of producing histidine. The recombinant microorganism provided by the invention can improve the production efficiency of L-histidine, and provides a novel efficient method for synthesizing L-histidine by a biological method.

Description

Technical Field

[0001] The present invention relates to the technical field of biochemistry, and more specifically, to a recombinant microorganism and its application in the fermentation production of L-histidine. Background Art

[0002] L-histidine is an essential amino acid for human infants and adults, and is widely used in industries such as feed supplements, health products, and pharmaceuticals. It has been reported that histidine has anti-inflammatory and antioxidant properties and is a precursor of histamine, which is known to play an important role in regulating the human immune response. Therefore, the application of histidine in the medical industry is very attractive (Wu et al, 2020; Hasegawa et al, 2012). The industrial production of L-histidine is mainly through microbial fermentation. Microorganisms commonly used for the production of L-histidine mainly include Corynebacterium glutamicum, Escherichia coli, and Serratia marcescens.

[0003] In Escherichia coli, the synthesis of L-histidine uses glucose as a raw material, and adenosine triphosphate (ATP) and 5-phosphoribosyl 1-pyrophosphate (PRPP) as precursors, and is synthesized through ten catalytic reactions. The biosynthetic pathway of histidine is very special for amino acids because this pathway is closely linked to other pathways. Therefore, finding a way to modify recombinant bacteria that can both increase the production of histidine and not produce unwanted side effects is still a research topic. Summary of the Invention

[0004] One of the objectives of the present invention is to provide a new recombinant microorganism that can improve the effect of fermenting and producing L-histidine.

[0005] To achieve this objective, the technical solution of the present invention is as follows:

[0006] A recombinant microorganism, compared with the starting strain, overexpresses serine hydroxymethyltransferase glyA, and / or overexpresses glycine cleavage proteins gcvP, gcvT, and gcvH, and the starting strain is Escherichia coli capable of producing histidine.

[0007] Preferably, compared with the starting strain, the recombinant microorganism of the present invention overexpresses serine hydroxymethyltransferase glyA and glycine cleavage proteins gcvP, gcvT, and gcvH simultaneously.

[0008] The present invention has found through research that in Escherichia coli, C1 (C1 metabolism) supply is an important target for histidine production. The de novo synthesis pathway of purine is closely linked to the C1 metabolic pathway, which is manifested in that this pathway requires two molecules of 10-formyltetrahydrofolate (fTHF) as cofactors. The present invention promotes the generation of 5,10-methylenetetrahydrofolate (mTHF) from cofactor tetrahydrofolate (THF) by upregulating the expression of the glyA gene (encoding serine hydroxymethyltransferase, SHMT) in Escherichia coli, and at the same time converts L-serine into glycine. The two molecules of fTHF required for de novo biosynthesis of histidine can be provided in the form of mTHF by serine hydroxymethyltransferase, thereby increasing the C1 supply in Escherichia coli to improve the yield of L-histidine.

[0009] To reduce the content of by-product glycine, the present invention further introduces a glycine cleavage system into the recombinant bacterium, which can convert glycine into carbon dioxide and ammonia and generate mTHF from THF. This step is expected to reduce the accumulation of glycine and further increase the supply of cofactor mTHF.

[0010] Compared with the starting strain, the recombinant microorganism of the present invention further overexpresses the gene fragment hisGDCBHAFI, and the nucleotide sequence of the gene fragment hisGDCBHAFI is as shown in SEQ ID NO.13.

[0011] The overexpression of the present invention can be achieved by one or more of the following methods (1) and (2):

[0012] (1) Increasing the copy number of the coding gene of the target enzyme;

[0013] (2) Replacing the transcriptional or translational regulatory elements of the coding gene of the target enzyme with regulatory elements having higher activity;

[0014] Preferably, the increase in the copy number of the coding gene of the target enzyme is achieved by introducing a plasmid carrying the coding gene and / or integrating the coding gene into the genome;

[0015] The transcriptional or translational regulatory elements are selected from one or more of a promoter, a ribosome binding site, and an enhancer.

[0016] More preferably, the overexpression of serine hydroxymethyltransferase glyA and / or glycine cleavage proteins gcvP, gcvT, and gcvH of the present invention is achieved by replacing the original promoter with a promoter having higher expression intensity. More preferably, the promoter having higher expression intensity is the Ptrc promoter.

[0017] Preferably, in the present invention, by using the promoter Ptrc to enhance the expression of the Escherichia coli glyA gene and the promoter Ptrc to enhance the expression of the gcvP, gcvT, and gcvH genes in Escherichia coli, the expression of the glyA gene and the genes of the glycine cleavage system (gcvP, gcvT, gcvH) is up-regulated respectively. Furthermore, without introducing the by-product glycine, the intracellular content of mTHF is increased, and the yield and productivity of L-histidine are improved.

[0018] In the present invention, the nucleotide sequence of the serine hydroxymethyltransferase glyA is shown as the bases at positions 58-1311 in SEQ ID NO.1, the nucleotide sequence of the glycine cleavage protein gcvT is shown as the bases at positions 58-1152 in SEQ ID NO.3, the nucleotide sequence of the glycine cleavage protein gcvH is shown as SEQ ID NO.4, and the nucleotide sequence of the glycine cleavage protein gcvP is shown as SEQ ID NO.5.

[0019] The present invention also provides any one of the following applications of the above recombinant microorganism:

[0020] (1) Application in the fermentative production of L-histidine;

[0021] (2) Application in the modification of microorganisms for the production of L-histidine;

[0022] (3) Application in improving the ability of biosynthesis of L-histidine by biological methods.

[0023] Preferably, improving the ability of biosynthesis of L-histidine by biological methods means increasing the productivity of fermentative production of L-histidine and / or reducing the synthesis of the by-product glycine.

[0024] The present invention further provides a method for fermentative production of L-histidine, which includes the step of culturing the above recombinant microorganism.

[0025] The specific embodiments of the present invention include: (1) replacing the original promoter of the serine hydroxymethyltransferase glyA with the Ptrc promoter in Escherichia coli; (2) replacing the original promoters of the glycine cleavage system gcvP, gcvT, and gcvH genes with the Ptrc promoter in Escherichia coli; (3) fermentatively culturing the above strain and detecting the growth of the cells and the yield of L-histidine.

[0026] The present invention further provides a method for constructing a recombinant microorganism for producing L-histidine, which includes the step of overexpressing the serine hydroxymethyltransferase glyA and / or overexpressing the glycine cleavage proteins gcvP, gcvT, and gcvH, or further overexpressing the gene fragment hisGDCBHAFI in the starting strain; the starting strain is Escherichia coli capable of producing histidine.

[0027] The nucleotide sequence of the serine hydroxymethyltransferase glyA is shown as the bases at positions 58 - 1311 in SEQ ID NO.1, the nucleotide sequence of the glycine cleavage protein gcvT is shown as the bases at positions 58 - 1152 in SEQ ID NO.3, the nucleotide sequence of the glycine cleavage protein gcvH is shown as SEQ ID NO.4, the nucleotide sequence of the glycine cleavage protein gcvP is shown as SEQ ID NO.5, and the nucleotide sequence of the gene fragment hisGDCBHAFI is shown as SEQ ID NO.13.

[0028] The beneficial effects of the present invention are at least as follows:

[0029] The present invention provides a method that can significantly improve the yield and productivity of L - histidine in Escherichia coli fermentation. Detailed implementation manners

[0030] The preferred implementation manners of the present invention will be described in detail below in conjunction with embodiments. It should be understood that the following embodiments are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0031] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments can all be obtained from commercial channels or prepared by conventional methods in the art.

[0032] Example 1 Replacement of the original promoter of glyA in Escherichia coli with the Ptrc promoter

[0033] In this example, the original promoter of the serine hydroxymethyltransferase glyA in Escherichia coli MG1655 ATCC 700926 (the sequence is shown as SEQ ID No.2) was replaced with the Ptrc promoter (the sequence is shown as the bases at positions 1 - 57 in SEQ ID NO.1).

[0034] Using the genome of Escherichia coli MG1655 as a template, and using glyA - UP - F (cataggctttaccccacgcgtccagcacttcctg, SEQ ID No.7) and glyA - UP - R (gtgaaattccacacattatacgagccggatgattaattgtcaatgatgcaaatttttcacttcatcac, SEQ ID No.8) as primers for PCR, a gene fragment glyA - UP of about 500 bp was obtained and the PCR product was purified.

[0035] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with glyA-DOWN-F (gtataatgtgtggaatttcacacaggaaacagaccatgttaaagcgtgaaatgaac, SEQ ID No.9) and glyA-DOWN-R (ggcttgtgttctttggcttgtttttccaga, SEQ ID No.10) as primers to obtain a gene fragment glyA-DOWN of approximately 500 bp and the PCR product was purified. The fragments glyA-UP and glyA-DOWN were subjected to overlap PCR to obtain the targeting fragment. Using plasmid pTarget (Jiang, Y., Chen, B., Duan, C.L., Sun, B.B., Yang, J.J., and Yang, S. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 81:2506–2514.) as a template, amplification was carried out with primers glyA-N20-F (tcagctaacaataaaattttgttttagagctagaaatagcaagttaaaat, SEQ ID No.18) and glyA-N20-R (aaaattttattgttagctgaactagtattatacctaggactgagctag, SEQ ID No.19) to obtain pTarget-glyA. The targeting fragment, plasmid pTarget-glyA and plasmid pCas9 (Jiang, Y., Chen, B., Duan, C.L., Sun, B.B., Yang, J.J., and Yang, S. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 81:2506–2514.) were electrotransformed into Escherichia coli MG1655 using an electroporator (Bio-Rad). The electroporation conditions were voltage 2.5 KV, resistance 200 Ω, capacitance 25 μF (the width of the electroporation cuvette was 2 mm). The recombinant bacterium was screened and named E.coil-Ptrc-glyA. The key feature of this recombinant bacterium is the up-regulation of the expression of the glyA gene and it contains the sequence shown in SEQ ID No.1 (the tandem sequence of the Ptrc promoter and the glyA gene).

[0036] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with hisG-F (gaattcgagctcatgttgaaaatcgctgtcccaaacaaaggctcg, SEQ ID No. 11) and hisI-R (ctctagaggatcctcactgatgccgtttacgcaggttctcaattaccgtcgtt, SEQ ID No. 12) as primers to obtain the gene fragment hisGDCBHAFI (SEQ ID No. 13). This fragment was ligated to the vector pTrc99a through the restriction enzyme sites SacI and BamHI, and the resulting recombinant plasmid was named pTrc99a-hisGDCBHAFI. The recombinant plasmid pTrc99a-hisGDCBHAFI was transformed into Escherichia coli MG1655 and E.coil-Ptrc-glyA by electroporation (conditions as above), and the resulting recombinant strains were named E.coil MG1655 / pTrc99a-hisGDCBHAFI and E.coil-Ptrc-glyA / pTrc99a-hisGDCBHAFI.

[0037] Example 2 Expression of gcvP, gcvT, and gcvH genes containing the Ptrc promoter

[0038] In this example, the original promoters of gcvP, gcvT, and gcvH in Escherichia coli MG1655 ATCC 700926 and E.coil-Ptrc-glyA (the sequence is shown as SEQ ID No. 6) were replaced with the Ptrc promoter (the sequence is shown as the first 57 bases in SEQ ID No. 3).

[0039] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with gcvT-UP-F (acggttgcatcgtcaggggaaagacatcg, SEQ ID No. 14) and gcvT-UP-R (gtgaaattccacacattatacgagccggatgattaattgtcaaaataaaaaaccaaaaaatacaccag, SEQ ID No. 15) as primers to obtain a gene fragment gcvT-UP of approximately 500 bp and the PCR product was purified.

[0040] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with gcvT-DOWN-F (gtataatgtgtggaatttcacacaggaaacagaccatggcacaacagactcctttg, SEQ ID No.16) and gcvT-DOWN-R (gcctgacgctgggcgtcattaaacagtgtgg, SEQ ID No.17) as primers to obtain a gene fragment gcvT-DOWN of approximately 500 bp and purify the PCR product. The fragments gcvT-UP and gcvT-DOWN were subjected to overlap PCR to obtain a targeting fragment. Using plasmid pTarget as a template, amplification was performed with primers gcvT-N20-F (tcttgtcctcattgaataaggttttagagctagaaatagcaagttaaa, SEQ ID No.20) and gcvT-N20-R (cttattcaatgaggacaagaactagtattatacctaggactga, SEQ ID No.21) to obtain pTarget-gcvT. The targeting fragment, plasmid pTarget-gcvT, and plasmid pCas9 were electrotransformed into Escherichia coli MG1655 and E.coil-Ptrc-glyA using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). Recombinant bacteria were screened and named E.coil-Ptrc-gcvTHP and E.coil-Ptrc-glyA-Ptrc-gcvTHP. The key feature of this recombinant bacterium is the upregulation of the expression of the gcvP, gcvT, and gcvH genes and contains the sequences shown in SEQ ID No.3-5. Among them, SEQ ID No.3 is the tandem sequence of the Ptrc promoter and the gcvT gene, SEQ ID No.4 is the gcvH gene sequence, and SEQ ID No.5 is the gcvP gene sequence.

[0041] The plasmid pTrc99a-hisGDCBHAFI was introduced into E.coil-Ptrc-gcvTHP and E.coil-Ptrc-glyA-Ptrc-gcvTHP by electrotransformation (conditions as in Example 1), and the resulting recombinant strains were named E.coil-Ptrc-gcvTHP / pTrc99a-hisGDCBHAFI and E.coil-Ptrc-glyA-Ptrc-gcvTHP / pTrc99a-hisGDCBHAFI.

[0042] Example 3 Fermentation and culture of recombinant Escherichia coli for the production of L-histidine

[0043] The recombinant strains E.coil MG1655 / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-glyA / pTrc99a-hisGDCBHAFI, E.coil-Ptrc-gcvTHP / pTrc99a-hisGDCBHAFI and E.coil-Ptrc-glyA-Ptrc-gcvTHP / pTrc99a-hisGDCBHAFI were cultured overnight on an LB plate. Single colonies were inoculated from this fresh plate into a test tube containing 5 ml of LB medium and cultured at 37 °C and 200 rpm for 12 hours.

[0044] They were inoculated into a 500-ml baffled shake flask containing 50 ml of fermentation medium at an inoculation amount of 5% and cultured at 37 °C and 200 rpm until the OD600 reached 0.6, then 0.1 mM IPTG was added and co-cultured for 48 h.

[0045] The fermentation medium formulation included (g / L): glucose 20 g, magnesium sulfate heptahydrate 0.8 g, diammonium hydrogen phosphate 4 g, potassium dihydrogen phosphate 6.67 g, potassium citrate 1.35 g, 3-morpholinopropanesulfonic acid 20.9 g, yeast powder 2.5 g, ferrous sulfate heptahydrate 50 mg, calcium chloride dihydrate 10 mg, zinc sulfate heptahydrate 11 mg, manganese sulfate tetrahydrate 2.5 mg, copper sulfate pentahydrate 5 mg, ammonium molybdate 0.5 mg, sodium borate decahydrate 0.1 mg.

[0046] During the fermentation process, the product concentration and the growth of the strains were detected by liquid chromatography, and the results are shown in Table 1 and Table 2. It can be seen from Table 1 and Table 2 that after introducing Ptrc-glyA and Ptrc-gcvTHP respectively, compared with the control strain E.coil MG1655 / pTrc99a-hisGDCBHAFI, the yield and production efficiency of L-histidine of the strains E.coil-Ptrc-glyA / pTrc99a-hisGDCBHAFI and E.coil-Ptrc-gcvTHP / pTrc99a-hisGDCBHAFI were improved without affecting the cell growth. After introducing the glycine cleavage system on the basis of introducing Ptrc-glyA, the yield and production efficiency of L-histidine of the strain E.coil-Ptrc-glyA-Ptrc-gcvTHP / pTrc99a-hisGDCBHAFI were further improved.

[0047] Table 1 Growth conditions (OD600) of different strains

[0048]

[0049] Table 2 L-histidine yield of different strains (g / L)

[0050]

[0051] Although the present invention has been described in detail above in general descriptions and specific embodiments, modifications or improvements can be made thereto based on the present invention, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

Claims

1. A recombinant microorganism, characterized in that, compared with the parental strain, the recombinant microorganism overexpresses serine hydroxymethyltransferase glyA, and / or overexpresses glycine cleavage proteins gcvP, gcvT and gcvH, and the parental strain is Escherichia coli capable of producing histidine.

2. The recombinant microorganism according to claim 1, characterized in that, compared with the parental strain, the recombinant microorganism overexpresses serine hydroxymethyltransferase glyA and glycine cleavage proteins gcvP, gcvT and gcvH.

3. The recombinant microorganism according to claim 1 or 2, characterized in that, compared with the parental strain, the recombinant microorganism further overexpresses the gene fragment hisGDCBHAFI, and the nucleotide sequence of the gene fragment hisGDCBHAFI is as shown in SEQ ID NO.

13.

4. The recombinant microorganism according to any one of claims 1-3, characterized in that, the overexpression of serine hydroxymethyltransferase glyA and / or glycine cleavage proteins gcvP, gcvT and gcvH is achieved by replacing the original promoter with a promoter with higher expression intensity.

5. The recombinant microorganism according to claim 4, characterized in that, the promoter with higher expression intensity is thePtrc promoter.

6. The recombinant microorganism according to any one of claims 1-5, characterized in that, the nucleotide sequence of serine hydroxymethyltransferase glyA is as shown by the 58th to 1311th bases in SEQ ID NO.1, the nucleotide sequence of glycine cleavage protein gcvT is as shown by the 58th to 1152nd bases in SEQ ID NO.3, the nucleotide sequence of glycine cleavage protein gcvH is as shown in SEQ ID NO.4, and the nucleotide sequence of glycine cleavage protein gcvP is as shown in SEQ ID NO.

5.

7. Any one of the following applications of the recombinant microorganism according to any one of claims 1-6: (1) Application in fermentative production of L-histidine; (2) Application in microbial transformation for producing L-histidine; (3) Application in improving the ability of biological synthesis of L-histidine.

8. The application according to claim 7, characterized in that, improving the ability of biological synthesis of L-histidine means improving the yield of fermentative production of L-histidine and / or reducing the synthesis of by-product glycine.

9. A method for fermentative production of L-histidine, characterized in that, it includes the step of culturing the recombinant microorganism according to any one of claims 1-6.

10. A method for constructing a recombinant microorganism for producing L-histidine, characterized in that, it includes the step of making the parental strain overexpress serine hydroxymethyltransferase glyA, and / or overexpress glycine cleavage proteins gcvP, gcvT and gcvH, or further overexpress the gene fragment hisGDCBHAFI; the parental strain is Escherichia coli capable of producing histidine; The nucleotide sequence of the serine hydroxymethyltransferase glyA is shown as the bases at positions 58 - 1311 in SEQ ID NO.1, the nucleotide sequence of the glycine cleavage protein gcvT is shown as the bases at positions 58 - 1152 in SEQ ID NO.3, the nucleotide sequence of the glycine cleavage protein gcvH is shown as SEQ ID NO.4, the nucleotide sequence of the glycine cleavage protein gcvP is shown as SEQ ID NO.5, and the nucleotide sequence of the gene fragment hisGDCBHAFI is shown as SEQ ID NO.13.

Images