An OsEra2 gene and a method for cultivating and regulating the flowering period of rice

By knocking out the rice OsEra2 gene through CRISPR/Cas9 technology and regulating the m6A modification during the heading period of rice, the gap in RNA epigenetic modification in the regulation of the heading period of rice was solved, transgenic rice with early heading phenotype was achieved, and the precise regulation of the rice flowering period was promoted.

CN120138007BActive Publication Date: 2025-09-19INST OF BOTANY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510353464.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-25
Publication Date
2025-09-19
Estimated Expiration
2045-03-25

AI Technical Summary

Technical Problem

There are no reports in the existing technology on the regulation of rice heading period by RNA epigenetic modification, especially the role of RNA methylation modification in the regulation of rice heading period has not been fully explored, which affects the precise regulation of rice flowering period.

Method used

The OsEra2 gene in rice was knocked out using CRISPR/Cas9 technology. OsEra2 acts as an RNA methylation removal enzyme, regulating the m6A modification related to the heading period of rice, achieving gene editing and obtaining transgenic rice with an early heading phenotype.

Benefits of technology

The successful acquisition of transgenic rice with an early heading phenotype provides a theoretical basis for regulating the heading period of rice, lays the foundation for cultivating transgenic plants with suitable heading periods, and further clarifies the molecular mechanism of plant regulation of heading period.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138007B_ABST
    Figure CN120138007B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of genetic engineering technology, and more particularly to an OsEra2 gene and a method for cultivating and regulating the flowering period of rice. The present invention provides an OsEra2 gene, the nucleotide sequence of which is shown in SEQ ID NO:1. Experiments have demonstrated that knocking down the OsEra2 gene in wild-type rice can produce transgenic rice with an altered heading period phenotype. Compared to recipient rice, OsEra2 gene expression is reduced in the transgenic rice. The OsEra2 gene is associated with rice heading period control, providing a theoretical foundation for cultivating transgenic plants with an appropriate heading period.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to an OsEra2 gene and a method for cultivating and regulating the flowering period of rice. Background Art

[0002] Flowering marks the transition from vegetative to reproductive growth, playing a crucial role in completing offspring reproduction and adapting to specific ecological environments. The heading date of rice is a key trait that determines rice yield, and heading at the appropriate time is crucial for completing the rice growth cycle. Current research on rice heading date focuses on the photoperiod and circadian clock pathways, hormone signaling pathways, and chromatin regulatory pathways. Within the photoperiod and circadian clock pathways, plants receive light signals from the external environment through photoreceptors, which are then integrated into the circadian clock system. This ultimately influences specific downstream signaling pathways, regulating plant growth and development, including flowering. Within the hormone signaling pathway, abscisic acid (ABA) has been implicated in controlling rice heading date. Among the chromatin-mediated mechanisms regulating rice heading date, epigenetic modifications such as H3K4me3 on histones have been shown to influence heading date, and other epigenetic modifiers are increasingly being discovered. However, studies examining the role of RNA epigenetic modifications in regulating rice heading date have been limited.

[0003] The RNAm6A modification involved in the present invention belongs to RNA methylation modification, specifically refers to a very conservative chemical modification type formed after the hydrogen atom (H) at the RNAN6 position is replaced by a methyl group (CH3). The rice heading period regulatory factor OsEra2 involved in the present invention belongs to RNA methylation removal enzyme, which is responsible for removing the methyl group (CH3) modified by m6A and reducing it to a hydrogen atom (H). The present invention found that after the OsEra2 gene was knocked out by CRISPR gene editing, compared with the recipient rice Zhonghua 11 (ZH11), the two strains of the OsEra2 knockout mutant showed an early flowering phenotype during the heading period, proving that the OsEra2 gene plays an important role in mediating RNAm6A modification and then responding to the control of rice heading period. Subsequent research on the OsEra2 gene and the m6A modification research on its downstream regulatory genes will be of great significance to the regulation of rice heading period by m6A modification. Summary of the Invention

[0004] The purpose of the present invention is to provide an OsEra2 gene and a method for cultivating and regulating the flowering period of rice.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides an OsEra2 gene, the nucleotide sequence of the OsEra2 gene is shown in SEQ ID NO: 1.

[0007] The present invention also provides the use of the OsEra2 gene in regulating the heading period of rice.

[0008] Preferably, the OsEra2 gene is knocked out or knocked down to obtain rice with an early heading phenotype.

[0009] The present invention also provides an expression vector, comprising an initial vector and the OsEra2 gene.

[0010] The present invention also provides a host transformed or transfected with the expression vector; the host is a microorganism.

[0011] The present invention also provides the use of the expression vector or the host in regulating the heading period of rice.

[0012] The present invention also provides a silencing vector, comprising an original vector and the OsEra2 gene.

[0013] The present invention also provides a silent recombinant bacterium transformed or transfected with the silencing vector.

[0014] The present invention also provides the use of the silencing vector or the silencing recombinant bacteria in regulating the heading period of rice.

[0015] The present invention also provides a method for cultivating and regulating the flowering period of rice, which regulates the expression of heading period-related proteins in rice; the heading period-related proteins are the following proteins A1), A2) or A3):

[0016] A1) a protein encoded by SEQ ID NO: 3;

[0017] A2) a protein having at least 90% identity with the protein described in A1);

[0018] A3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein described in A1) or A2).

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This study demonstrates that knocking down the OsEra2 gene in wild-type rice can produce transgenic rice with an altered heading period phenotype. Compared to recipient rice, OsEra2 gene expression is reduced in the transgenic rice. The OsEra2 gene is implicated in controlling rice heading period, providing a theoretical foundation for cultivating transgenic plants with optimal heading periods.

[0021] The present invention has important theoretical significance for further clarifying the molecular mechanism of plant regulation of heading period and cultivating new rice varieties with regulated heading period through genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0023] Figure 1 The heading period phenotypes of wild-type ZH11 and homozygous mutants OsEra2-L1 and OsEra2-L2 under natural long-day conditions.

[0024] Figure 2 These are the statistical results of heading period of wild type ZH11 and homozygous mutants OsEra2-L1 and OsEra2-L2 under natural long daylight conditions.

[0025] Figure 3 These are the mutation types of OsEra2 mutants in the ZH11 background obtained using CRISPR / Cas9 technology, named OsEra2-L1 and OsEra2-L2, both of which are loss-of-function mutants. DETAILED DESCRIPTION

[0026] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0027] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples are commercially available unless otherwise specified.

[0028] The experimental material used in this study was the commonly used japonica rice variety Zhonghua 11 (ZH11).

[0029] The CRISPR / Cas9 vector system in the following examples is described in the following literature (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8: 1274-1284).

[0030] Example 1 Cloning of the Rice Salt Stress Response Gene OsEra2

[0031] The inventors of the present invention isolated and cloned a rice heading period regulating gene OsEra2 from the rice variety Zhonghua 11, as shown in SEQ NO: 1 in the sequence listing, and named its encoded protein OsEra2 protein, as shown in SEQ NO: 2 in the sequence listing.

[0032] Total RNA was extracted from rice cultivar Zhonghua 11 and reverse-transcribed into cDNA. PCR amplification was performed using primers F:ATGATCATACTGACCAAGGA and R:TTATTTTGCGGCATTCGGCT (SEQ NOs: 4 and 5). The amplification reaction used the high-fidelity TOYOBO KOD FX high-success-rate PCR enzyme. The reaction system consisted of 25 μL of 2x PCR buffer for KOD FX, 10 μL of 2 mM dNTPs, 11.5 μL of 10 pmol / μL Primer#1, 1.5 μL of 10 pmol / μL Primer#2, ≥1 μL of template DNA (~200 ng of cDNA), 1 μL of KOD FX (1.0 U / μL), and 50 μL of ddH2O.

[0033] The PCR reaction procedure was as follows: 94°C pre-denaturation for 2 minutes; 35 cycles of denaturation at 98°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 68°C for 1 minute; and extension at 68°C for 5 minutes. The PCR product was subjected to Sanger sequencing. Sequencing results showed that the nucleotide sequence of the PCR amplification product was SEQ NO:1 in the sequence listing, and its coding sequence was nucleotides 1-765 of SEQ NO:2 in the sequence listing, encoding the protein OsEra2 set forth in SEQ NO:2 (amino acid residues 1-254 of SEQ NO:3 in the sequence listing). The DNA set forth in SEQ NO:1 in the sequence listing was designated the OsEra2 gene.

[0034] SEQ ID NO: 1

[0035] OsEra2 gene genomic nucleotide sequence

[0036] TTCCCCTTCACCGTTCGCGAGATGATGGCCTCGCGGTCGCGGCTCCGCCTCGCCGCCGCC

[0037] GGCGAGAACCCTATCCCACACTCCAAGTCCGGCGGGGAGGGAGGAACGGAGAGGAAGCCG

[0038] GAGGAGGCGCTGCGGCGGGAGGTGACGGACCTGGGCGGCGGCAGCGAGGTGGTGCACGTG

[0039] CCCGCGTTTCGTGCCCCGGGAGGCGGCGTGGGGGTGGTTCGACTACCTCGACAAGCGCATC

[0040] CCATGGACGCGCCCCACCATCCGCGTATTCGGCCGCTCCGCCGTCCAGGTACAGAGAGGT

[0041] CACCGCCGCCGCCCGCGCTCTCATTGAACCCTTCATTTTAATCTTTGTGGGGCTTCCCT

[0042] AATCGGTCGCAATTTTTGCTCTGTTGTTCATTTGATAAATTTCTACTAGTGCTAAGATTT

[0043] CGCTATAGGTTGGTGCATTATCGTTGATTCTTGGAGGAAAAACCATAGTACTATCTTGCT

[0044] TGGTGAGATTCTGAATATGGTGCTGAGGTTGTGGTACTTCGGTGAGTCTGAAGAATGGTT

[0045] ACTGCAGGCAGTGTTGCTTACGATTTAGCTGTGGCCCTTCGGCCTGGGGGCTTACAAATTT

[0046] ACACTAGGCATTTGCGTTTCCCGGTAAAAGCTGGTTGAATTCATAGGAAATTGGCATAA

[0047] TGATAGTGACTGCAGCTGATCCGGATCCTAAAGAAATCATAGTCGGCAGAAATAGCATCGT

[0048] GCATGTAATTGCAGTATTGGTGAGTTGTTCTCTTTAACGTCTGAGCTGAATTTTAATTTG

[0049] TGGGCAGAAATAAACTATATAAGTACATATACATTAGTGGGATATAAACAAACTGATAGG

[0050] TACACCAGTGGCTCTGATAAATATTACTCCCTCCATCCCAAAATATAACAACTTTTGGGT

[0051] GGATGAGACATATTCTAGTACTATGAATCTGGATAGGGGTTATGTCCAGATCCATGGTAC

[0052] TATGATACGTTCCATCCACCCTAAAATCGTTATATTTATGACGGAGGGAGTAACTGCTA

[0053] AGTTTCTGATGCTTATGTCCCAAACGATGGTAGCTCCTAAGCTCTGTAATACCATTGTC

[0054] TTTCCAGAAAACCACGGTTACCATTGTCTTCCAATTGGAGACACATTGATAGTGTAACTG

[0055] TTGTGAAAGATTCTAGCTCAAGTATCCCATTCTCTTACTGTTCTGCAGCCGAGAGATACA

[0056] TGCTATGTCGCGGACGAAGGGCTAACAGATTTGAGATATAGTGGCCATCAGCCTCATGCA

[0057] CATTCTTGGGATGAATTCCCTGTGCTCAAGGATATCCTGAAGGCGGTGAGAGCTTTGCCA

[0058] TGATTATTCTTTGCAATGCTATATATGATTTGCAGTTAATTTCAAGCATTAGTATTCTAA

[0059] AATAGTATCAACTAGTTTGTATTTGATGATGGGCATCTCAAAGCTCTCATTCTATCTAGT

[0060] GATTTGCTGATTAATGTATGTTCAATAGGTTCATGAAGCCCTCCCTGGGAGCCATTTTAA

[0061] CAGCTTGCTCCTAAACAGATACAAGACCGGTTCAGATTACGTCTCATGGCATGCTGATGA

[0062] CGAGCCGCTGTATGGACCTACCCCAGAGATAGCATCTGTCACCCTCGGATGCGAACGAGA

[0063] GTTCTTACTTAGAAAGAAGCCGACGAAATCGCAAGGTAAGCGGTGCACACACTAGGAAAA

[0064] TTTTTGGACTGGCAGCCTCACTATCATTTGTAGATTTTGGAGTTTAGATCACATCAACTC

[0065] CGAAATCGATCCCTATTATTTCCGTCGAAGAAAAGATTGATCCCTTTTAATCTACCATCC

[0066] AGCTTCACTTGGATCTGGGGAAGTTGCGCCGAAGCGGCTCAAGGTCAGTGCTCCTCAGCA

[0067] GCATTCTTTCCTCCTGAAGCATGGGTCGCTGCTTGTGATGAGAGGCTATACCCAACGGGA

[0068] CTGGCAGCACTCGGTCCCGAAACGAGCTAAAGCAAGCTCACCGAGGATCAATCTGACTTT

[0069] CCGGCGAGTGCTGTAG

[0070] SEQ ID NO:2

[0071] CDS sequence of OsEra2 gene

[0072] ATGATGGCCTCGCGGTCGCGGCTCCGCCTCGCCGCCGCCGGCGAGAACCCTATCCCACAC

[0073] TCCAAGTCCGGCGGGGAGGGAGGAACGGAGAGGAAGCCGGAGGAGGCGCTGCGGCGGGAG

[0074] GTGACGGACCTGGGCGGCGGCAGCGAGGTGGTGCACGTGCCGCGGTTCGTGCCCCGGGAG

[0075] GCGGCGTGGGGGTGGTTCGACTA CCTCGACAAGCGCATCCCATGG ACGCGCCCCACCATC

[0076] CGCGTATTCGGCCGCTCCGCCGTCCAGCCGAGAGATACATGCTATGTCGCGGACGAAGGG

[0077] CTAACAGATTTGAGATATAGTGGCCATCAGCCTCATGCACATTCTTGGGATGAATTCCCT

[0078] GTGCTCAAGGATATCCTGAAGGCGGTTCATGAAGCCCTCCCTGGGAGCCATTTTAACAGC

[0079] TTGCTCCTAAACAGATACAAGACCGGTTCAGATTACGTCTCATGGCATGCTGATGACGAG

[0080] CCGCTGTATGGACCTACCCCAGAGATAGCATCTGTCACCCTCGGATGCGAACGAGAGTTC

[0081] TTACTTAGAAAGAAGCCGACGAAATCGCAAGCTTCACTTGGATCTGGGGAAGTTGCGCCG

[0082] [[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​

[0093] (1) Construction of vectors and recombinant bacteria

[0094] The DNA sequence shown in SEQ NO: 1 was used to screen for suitable targets on the E-CRISPR website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html). Based on the score and target location, CCTCGACAAGCGCATCCCATGG, located in the first exon of OsEra2, was selected as the CRISPR / Cas9 target. Primer sequences F: ggcaCCTCGACAAGCGCATCCCA and R: aaacTGGGATGCGCTTGTCGAGG (SEQ NOs: 6 and 7) were used for synthesis.

[0095] The pCRISPR / Cas9 vector system was constructed according to the literature (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8: 1274-1284) to obtain a new vector pCRISPR / Cas9-OsEra2. The plasmid pCRISPR / Cas9-OsEra2 was introduced into Agrobacterium EHA105 competent cells to obtain recombinant Agrobacterium pCRISPR / Cas9-OsEra2.

[0096] (2) pCRISPR / Cas9-OsEra2 transformed rice callus and positive callus screening

[0097] The genetic transformation of rice was completed by Wuhan Boyuan Biotechnology Co., Ltd., and the T0 generation transgenic strain of CRISPR / Cas9-OsEra2 under the ZH11 background was obtained, namely the T0 generation of rice OsEra2 mutant.

[0098] Example 3 Identification of transgenic rice CRISPR / Cas9-OsEra2 T0 plants

[0099] DNA was extracted from leaves of the T0 generation of the rice OsEra2 mutant. PCR amplification was performed using the extracted DNA as a template using OsEra2-specific primers (F: GAGGGAGGAACGGAGAGGAA; R: GTACCACAACCTCAGCACCA (SEQ NOs: 8 and 9). The amplification reaction used the high-fidelity enzyme Vazyme 2×Taq Plus MasterMix. The reaction system consisted of 25 μL of 2×Taq Plus MasterMix, 2 μL of Primer 1 (10 μM), 2 μL of Primer 2 (10 μM), ≥1 μL of Template DNA (0.1–1 μg of Genomic DNA), and up to 50 μL of ddH2O.

[0100] The PCR reaction procedure was as follows: pre-denaturation at 95°C for 3 minutes, followed by 35 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 1 minute, followed by extension at 72°C for 5 minutes. The PCR products were subjected to Sanger sequencing to check for mutations at the target site.

[0101] Leaf DNA extraction was performed as follows: Place rice leaves in a 2.0 mL centrifuge tube, add steel balls, and grind into powder using a grinder. Add 400 μL of extraction buffer to the centrifuge tube and shake to mix. Add an equal volume of a 1:1 mixture of chloroform and phenol, shake to mix, and centrifuge at 12,000 rpm for 10 minutes. Take 200 μL of the supernatant, add an equal volume of chloroform, shake vigorously to mix, and centrifuge at 12,000 rpm for 10 minutes. Take 100 μL of the supernatant, add twice the volume of anhydrous ethanol, and precipitate at 0°C for 10 minutes. Centrifuge at 4°C, 12,000 rpm, and centrifuge for 10 minutes. Remove the supernatant, add 500 μL of 75% ethanol, wash twice, blow dry, and dissolve in 30 μL of ddH2O.

[0102] The results showed that two independent transgenic plants (OsEra2-L1 and OsEra2-L2) with mutations in the OsEra2 gene were finally identified. The mutation sites were as follows: Figure 3 OsEra2-L1 lacks 17 bp, causing a frameshift mutation in OsEra2 and resulting in complete loss of function; OsEra2-L2 lacks 5 bp, also resulting in a frameshift mutation and complete loss of function.

[0103] Example 4 Observation of the heading period of the OsEra2 mutant under long-day conditions

[0104] The differences in heading date between OsEra2-L1, OsEra2-L2 and wild-type ZH11 were observed and counted under natural long-day conditions in Beijing in summer. The number of rice lines counted for each rice line was greater than or equal to 15. Figure 1 、 2 It can be seen that both lines of the OsEra2 mutant showed an early heading phenotype compared with the wild type.

[0105] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Application of the OsEra2 gene in regulating the heading period of rice, characterized in that: By knocking out the OsEra2 gene, early heading phenotype rice is obtained. The nucleotide sequence of the OsEra2 gene is shown in SEQ ID NO:

1.

2. The application of OsEra2 gene in regulating the heading period of rice is characterized by: By knocking down the OsEra2 gene, early heading phenotype rice is obtained. The nucleotide sequence of the OsEra2 gene is shown in SEQ ID NO:

1.

3. A method for cultivating and regulating the flowering period of rice, characterized in that: Early heading phenotype rice is obtained by knocking out the OsEra2 gene; the amino acid sequence of the protein encoded by the OsEra2 gene is shown in SEQ ID NO: 3.

Citation Information

Patent Citations

  • Application of PvALKBH10 protein and coding gene thereof in regulating and controlling flowering time of plant

    CN118127065A

  • Application of ALKBH2 gene or encoded protein thereof in regulation and control of plant growth or yield

    CN119639806A