Composition for detecting colorectal cancer and application thereof

Abstract

The invention provides a composition for detecting colorectal cancer and application thereof, the composition comprises nucleic acid for detecting the methylation state of a target gene, and the target gene is one or more of Septin9 gene, SDC2 gene and NDRG4 gene. The invention also provides a kit comprising the composition, and application of the composition in preparation of the kit for in-vitro detection of colorectal cancer.

Description

Technical Field

[0001] This application belongs to the field of molecular biology, involves gene detection, and specifically relates to a composition for detecting colorectal cancer and its uses. Background Art

[0002] Currently, the means clinically used for colorectal cancer screening and diagnosis mainly include tumor marker examinations, such as the carbohydrate antigen family (CAs), carcinoembryonic antigen (CEA), etc., which are used to assist in the diagnosis and monitoring of disease progression; PET-CT: By injecting a radioactive tracer to detect the metabolic situation of tumors, helping to determine the location and spread of cancer. The sensitivity of tumor marker detection is high but the specificity is low. Currently, colonoscopy and biopsy are the most reliable methods for diagnosing colorectal cancer.

[0003] Colonoscopy can directly observe the internal situation of the intestine and plays an irreplaceable role in detecting intestinal lesions such as polyps, inflammation, tumors, etc. Its advantages include being able to provide intuitive intestinal images, perform tissue biopsies, and in some cases perform endoscopic treatments, such as hemostasis and polyp resection. However, colonoscopy also has some disadvantages and risks, including possible complications such as intestinal perforation and bleeding, as well as discomfort during the examination, such as abdominal distension and abdominal pain. In addition, colonoscopy requires strict bowel preparation, which may cause electrolyte disorders and gastrointestinal discomfort, and for patients with heart or cerebrovascular diseases, it may increase the cardiovascular burden. Although painless colonoscopy can reduce the discomfort of patients, it increases the anesthesia risk and cost. Therefore, there is an urgent need to find a non-invasive and highly accurate screening method.

[0004] Liquid biopsy technology uses body fluids such as blood, saliva, urine, etc. as test materials and tumor markers, etc. as detection indicators to achieve early screening and diagnosis of cancer, assist in staging, prognosis and recurrence monitoring, medication guidance, etc., and has the advantages of being non-invasive, efficient, accurate, etc. Among them, using abnormal changes in DNA methylation levels as markers for tumor molecular diagnosis is one of the current research hotspots.

[0005] DNA methylation is an important epigenetic modification and is involved in regulating various cytological processes, including embryonic development, gene transcription, X-chromosome inactivation, genomic imprinting, chromatin structure stability, etc. Therefore, abnormal DNA methylation is closely related to the occurrence of human complex diseases. In normal cells, cytosines in CpG islands and some regions rich in CG sites are usually unmethylated, while cytosine bases in regions with a low CG ratio are mostly in a hypermethylated state. However, in various cancers, the methylation pattern is exactly the opposite. Multiple studies have shown that hypermethylation of CpG islands can inhibit or silence the expression of some tumor suppressor genes and DNA mismatch repair genes, while hypomethylation in other regions of the genome can promote the expression of proto-oncogenes, which can endow normal cells with carcinogenic characteristics and thus promote the occurrence of cancer. In addition, abnormal DNA methylation usually occurs in the ultra-early stage of cancer and is a "seed" factor for tumor growth. Moreover, as the cancer progression develops, the methylation status of DNA also undergoes dynamic changes, which can directly reflect the growth of tumor lesions. Therefore, using DNA methylation detection for early cancer screening and auxiliary diagnosis has great application potential. Summary of the Invention

[0006] Based on the problems existing in the current detection of colorectal cancer, the purpose of this application is to provide a composition, a kit and its use for detecting colorectal cancer, as well as a use for detecting colorectal cancer.

[0007] The specific technical solutions of this application are as follows:

[0008] 1. A composition for in vitro detection of colorectal cancer, the composition comprising:

[0009] Nucleic acids for detecting the methylation status of target genes,

[0010] wherein, the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene,

[0011] wherein, the target gene is one or more of the Septin9 gene, the SDC2 gene and the NDRG4 gene.

[0012] 2. The composition according to item 1, wherein the target sequence of the Septin9 gene is a sequence shown in any one of SEQ ID NOs: 1-4 or a sequence containing a sequence shown in any one of SEQ ID NOs: 1-4; and / or

[0013] the target sequence of the SDC2 gene is a sequence shown in any one of SEQ ID NOs: 5-8 or a sequence containing a sequence shown in any one of SEQ ID NOs: 5-8; and / or

[0014] The target sequence of the NDRG4 gene is a sequence shown in any one of SEQ ID NOs: 9-12 or a sequence containing a sequence shown in any one of SEQ ID NOs: 9-12.

[0015] 3. The composition according to item 1 or 2, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0016] Primers, which are fragments of at least 9 nucleotides in the target sequence of the target gene,

[0017] The fragment contains at least one CpG dinucleotide sequence;

[0018] Preferably, the fragment of at least 9 nucleotides is a sequence shown in SEQ ID NO: 13 and SEQ ID NO: 14, and / or a sequence shown in SEQ ID NO: 15 and SEQ ID NO: 16, and / or a sequence shown in SEQ ID NO: 17 and SEQ ID NO: 18;

[0019] Preferably, the nucleic acid for detecting the methylation status of the target gene comprises:

[0020] Probes, which are fragments of at least 15 nucleotides that hybridize to the target sequence of the target gene under medium stringency or stringent conditions,

[0021] The fragment contains at least one CpG dinucleotide sequence;

[0022] Preferably, the fragment of at least 15 nucleotides is a sequence shown in SEQ ID NO: 19, and / or a sequence shown in SEQ ID NO: 20, and / or a sequence shown in SEQ ID NO: 21;

[0023] Preferably, it further comprises:

[0024] A reagent for converting the 5-position unmethylated cytosine base of the target sequence of the target gene into uracil.

[0025] 4. An oligonucleotide for in vitro detection of colorectal cancer, which comprises:

[0026] A fragment of at least 9 nucleotides in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0027] A fragment of at least 9 nucleotides in SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0028] A fragment of at least 9 nucleotides in SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12 or its complementary sequence and containing at least one CpG dinucleotide sequence.

[0029] 5. The oligonucleotide according to item 4, further comprising:

[0030] A fragment of at least 15 nucleotides in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or its complementary sequence and containing at least one CpG dinucleotide sequence, which hybridizes under medium stringency or stringent conditions; and / or

[0031] A fragment of at least 15 nucleotides in SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8 or its complementary sequence and containing at least one CpG dinucleotide sequence, which hybridizes under medium stringency or stringent conditions; and / or

[0032] A fragment of at least 15 nucleotides in SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12 or its complementary sequence and containing at least one CpG dinucleotide sequence, which hybridizes under medium stringency or stringent conditions.

[0033] 6. An oligonucleotide for in vitro detection of colorectal cancer, comprising:

[0034] The sequences of SEQ ID NO:13 and SEQ ID NO:14. Preferably, it further comprises:

[0035] The sequence of SEQ ID NO:19.

[0036] 7. The oligonucleotide according to item 6, the oligonucleotide further comprises:

[0037] The sequences of SEQ ID NO:15 and SEQ ID NO:16. Preferably, it further comprises:

[0038] The sequence of SEQ ID NO:20; and / or

[0039] The oligonucleotide further comprises:

[0040] The sequences of SEQ ID NO:17 and SEQ ID NO:18; preferably, it further comprises:

[0041] The sequence of SEQ ID NO:21.

[0042] 8. An oligonucleotide for in vitro detection of colorectal cancer, comprising:

[0043] The sequences of SEQ ID NO:13 and SEQ ID NO:14; the sequences of SEQ ID NO:15 and SEQ ID NO:16, and the sequences of SEQ ID NO:17 and SEQ ID NO:18; preferably, it further comprises:

[0044] The sequence of SEQ ID NO:19, the sequence of SEQ ID NO:20, and the sequence of SEQ ID NO:21.

[0045] 9. A kit, comprising the composition according to any one of items 1-3 or the oligonucleotide according to any one of items 4-8;

[0046] Preferably, it further contains at least one other component selected from the following:

[0047] Nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase;

[0048] Preferably, the samples for detection by the kit include: cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colonic effluents, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof;

[0049] Preferably, it further contains: an instruction manual.

[0050] 10. Use of the composition according to any one of items 1-3 or the oligonucleotide according to any one of items 4-8 in the preparation of a kit for in vitro detection of colorectal cancer;

[0051] Preferably, the kit for in vitro detection of colorectal cancer detects colorectal cancer by a method comprising the following steps:

[0052] 1) Isolate a DNA sample comprising a target sequence or a fragment thereof of a target gene in a biological sample to be tested;

[0053] 2) Determine the methylation status of the target sequence of the target gene;

[0054] 3) Judge the status of the biological sample based on the detection result of the methylation status of the target sequence of the target gene, thereby achieving in vitro detection of colorectal cancer;

[0055] Preferably, the method includes the following steps:

[0056] Extract genomic DNA from a biological sample to be tested;

[0057] Treat the extracted genomic DNA with a reagent to convert the 5-position unmethylated cytosine base into uracil or other bases;

[0058] Contact the DNA sample treated with the reagent with a DNA polymerase and primers for the target sequence of the target gene to perform a DNA polymerization reaction;

[0059] Detect the amplification product with a probe; and

[0060] Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide in the target sequence of the target gene;

[0061] Preferably, the reagent is a bisulfite reagent.

[0062] Effects of the Invention

[0063] This application has the following technical effects:

[0064] 1) By detecting the methylated nucleic acid sequences of the target sequences of the target genes Septin9, SDC2, and NDRG4 and their fragments, the in vitro detection of colorectal cancer is realized by using the methylation biomarkers of the target gene target sequences, thereby effectively improving the sensitivity and specificity of the in vitro detection of colorectal cancer.

[0065] 2) The kit provided by the present invention has good sensitivity for detecting colorectal cancer and can conveniently, quickly, and effectively detect colorectal cancer.

[0066] 3) By using the method of analyzing the DNA of blood samples by real-time PCR, it is possible to conveniently detect the methylation status of the target sequences of the target genes Septin9, SDC2, and NDRG4, and it is possible to quickly and conveniently determine whether the sample is positive according to the CT value of real-time PCR. Detailed Embodiments

[0067] The following provides a detailed description of this application. Although specific embodiments of this application are shown, it should be understood that this application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a more thorough understanding of this application and to fully convey the scope of this application to those skilled in the art.

[0068] Unless otherwise indicated, the practice of the present application will employ conventional molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and genetics techniques, all of which are within the scope of conventional technical means in the art. Such techniques are described in detail in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (M.J. Gait, 1984 Edition); Animal Cell Culture (R.I. Freshney, 1987 Edition); Methods in Enzymology series (Academic Press, Inc., USA); Current Protocols in Molecular Biology (F.M. Ausubel et al., 1987 Edition, and updated periodically); PCR: The Polymerase Chain Reaction (Mullis et al., 1994 Edition). Primers, probes, and kits used in the present application can be prepared using standard techniques well known in the art.

[0069] Unless otherwise defined, the technical and scientific terms used in the present application have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0070] Definitions

[0071] "Stringent hybridization conditions" and "highly stringent" in the present application refer to the conditions under which a probe hybridizes to its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and vary in different circumstances. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays". Generally, stringent conditions are about 5 - 10 °C below the melting temperature (Tm) of a particular nucleic acid at a defined ionic strength and pH. At the temperature of Tm (at the defined ionic strength, pH, and nucleic acid concentration), 50% of the probes complementary to the target hybridize to the target sequence evenly. Stringent conditions can also be achieved by increasing the destabilizer. For selective or specific hybridization, a positive signal is twice the background hybridization, preferably 10 times. Exemplary stringent hybridization conditions are as follows: Hybridize at 42 °C in a solution of 50% formamide, 5x SSC, and 1% SDS, or at 65 °C in a solution of 5x SSC and 1% SDS, and then wash at 65 °C in a solution of 0.2x SSC and 0.1% SDS.

[0072] Also, if the polypeptides encoded by the nucleic acids are substantially similar, nucleic acids that do not hybridize under stringent conditions are still substantially similar. In such cases, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. By way of example, "moderately stringent hybridization conditions" include hybridization in a solution of 40% formamide, 1 M sodium chloride, and 1% SDS at 37°C, and washing in a 1x SSC solution at 45°C. One of ordinary skill in the art can readily obtain guidance in the prior art for obtaining conditions that achieve the same stringency. For PCR, a temperature of about 36°C is typically suitable for low-stringency amplification, and the annealing temperature ranges from 32°C to 48°C based on the length of the primers. For highly stringent PCR amplification, it is generally at 62°C, and the annealing temperature for highly stringent hybridization ranges from 50°C to 65°C based on the length and specificity of the primers. For the cycling conditions for highly stringent and low-stringency amplification, typically, they include: a denaturation stage at 90 - 95°C for 30 seconds to 2 minutes, an annealing stage for 30 seconds to 2 minutes, and an extension stage at about 72°C for 1 to 2 minutes. Tools and guidance for low- and high-stringency amplification reactions are available in the prior art.

[0073] As used herein, an "oligonucleotide" refers to a molecule composed of two or more nucleotides, preferably a molecule composed of more than three nucleotides, and its exact size can depend on many factors, which in turn are determined by the ultimate function and use of the oligonucleotide. In certain embodiments, the oligonucleotide can include a length of 10 nucleotides to 100 nucleotides. In certain embodiments, the oligonucleotide can include a length of 10 nucleotides to 30 nucleotides, or can have a length of 20 and 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.

[0074] As used herein, a "primer" refers to an oligonucleotide that can serve as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand, i.e., in the presence of nucleotides and an inducer such as a DNA or RNA polymerase and at a suitable temperature and pH, whether it is naturally occurring in a purified restriction digest or synthetically produced. The primer can be single-stranded or double-stranded and must be long enough to initiate the synthesis of the desired extension product in the presence of the inducer. The exact length of the primer depends on various factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides depending on the complexity of the target sequence, but it can contain fewer or more nucleotides. The factors involved in determining the appropriate length of the primer are well known to those skilled in the art.

[0075] The "primer pair" of the present application refers to a primer pair that hybridizes to the opposite strand of a target DNA molecule or to a target DNA region flanking a nucleotide sequence to be amplified.

[0076] The "primer site" of the present application refers to the region of a target DNA or other nucleic acid to which a primer hybridizes.

[0077] The "probe" of the present application, when referring to a nucleic acid sequence, is used in its ordinary meaning and refers to a selected nucleic acid sequence that can hybridize to a target sequence under defined conditions and can be used to detect the presence of the target sequence. Those skilled in the art should understand that in some cases, a probe can also be used as a primer, and a primer can be used as a probe.

[0078] "DNA methylation" in the present application refers to the addition of a methyl group to the 5-position of cytosine (C), which is usually (but not necessarily) in the case of CpG (guanine following cytosine) dinucleotides. The "increased degree of methylation" or "significant degree of methylation" as used herein refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, where the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues) is non-methylated. In certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more C's can be methylated, where the C's at these positions in the control DNA sample are non-methylated.

[0079] In embodiments, a variety of different methods can be used to detect DNA methylation alterations. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using southern or polymerase chain reaction (PCR) analysis, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high-resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation-specific single-strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO). These assays can be PCR analysis, quantitative analysis using fluorescent labels, or southern blot analysis.

[0080] The "methylation assay" of the present application refers to any assay for determining the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.

[0081] "Detection" in this application refers to any process of observing a biomarker or a change in a biomarker (e.g., a change in the methylation status of a biomarker or the expression level of a nucleic acid or protein sequence) in a biological sample, regardless of whether the biomarker or the change in the biomarker is actually detected. In other words, the act of probing for a biomarker or a change in a biomarker in a sample is "detection", even if the biomarker is determined to be absent or below the sensitivity level. Detection can be a quantitative, semi - quantitative or non - quantitative observation and can be based on a comparison with one or more control samples.

[0082] "Homology", "identity", and "similarity" as used in this application denote sequence similarity between two nucleic acid molecules. The "homology", "identity", or "similarity" can be determined by comparing positions in each sequence, and the sequences can be aligned for the purpose of comparison. When the equivalent positions in the compared sequences are occupied by the same base, the molecules are identical at that position; when the equivalent sites are occupied by the same or similar amino acid (e.g., similar in spatial properties or charge properties) residues, the molecules can be said to be homologous (similar) at that position. The expression of the percentage of homology / similarity or identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity, with the sequences of this application. When comparing two sequences, the presence of deletions or additional residues (amino acids or nucleic acids) also reduces identity and homology / similarity. In a specific embodiment, for two or more sequences or subsequences, determination is made by using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below or by manual alignment and visual inspection provided, for example, online by the National Center for Biotechnology Information (NCBI). When comparing and aligning for maximum correspondence over a comparison window or specified region, if their sequences have an identity of about 60%, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher over the specified region, they can be considered to be substantially or significantly homologous, similar, or identical. This definition also pertains to or can be used to test the complement of a sequence. Thus, to the extent permitted by the context herein, for example, if a nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally in the form of one or both of the complementary strands, a nucleotide sequence complementary to a specified target sequence or its variant is itself considered to be "similar" to the target sequence, and when referring to "similar" nucleic acid sequences, includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Circumstances where similarity must be restricted to the analysis of a single nucleic acid strand sequence can include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In embodiments, the identity or similarity can be over a region of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides, or over a region of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more than about 100 nucleotides.

[0083] "Amplification" in this application refers to the process of obtaining multiple copies from a specific locus of a nucleic acid, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known means, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).

[0084] "Fluorescence-based real-time PCR" in this application refers to a method in which a fluorophore is added to the PCR reaction system, and the entire PCR process is monitored in real time using the accumulation of fluorescence signals. Finally, the unknown template is quantitatively analyzed through a standard curve. In this PCR technique, there is a very important concept, the cycle threshold, also known as the Ct value. C represents Cycle, t represents threshold, and the meaning of the Ct value is: the number of cycles experienced when the fluorescence signal in each reaction tube reaches the set threshold. For example, the method for setting the fluorescence threshold is as follows: the fluorescence signals in the first 15 cycles of the PCR reaction are used as the fluorescence background signals, and the default setting of the fluorescence threshold is 10 times the standard deviation of the fluorescence signals in cycles 3 - 15.

[0085] "Cut off value of real-time PCR" in this application refers to a critical Ct value for judging the negativity or positivity of a sample for a certain biomarker. According to certain specific real-time methods of this application, "the critical Ct value (Cut Off value) is obtained based on statistical processing of a certain amount of sample data", and this critical Ct value can vary according to different requirements for sensitivity or specificity.

[0086] "Sensitivity" in this application refers to the proportion of cancers detected from a certain cancer sample, and its calculation formula is: Sensitivity = (Detected cancers / All cancers), while "specificity" refers to the proportion of normals detected from a certain normal sample, and its calculation formula is Specificity = (Detected negatives / Total negatives).

[0087] The "label" or "detectable moiety" of the present application is a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxin, or haptens and proteins that can be prepared to be detectable, e.g., by incorporating a radioactive label into a peptide or an antibody that specifically reacts with the peptide.

[0088] A variety of different methods can be used to detect nucleic acid molecules. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blotting, Northern blotting, or in situ hybridization). Specifically, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying a target nucleic acid can be used in a PCR reaction. The PCR method generally includes the following steps: obtaining a sample, isolating nucleic acid (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acid with one or more oligonucleotide primers that specifically hybridize to the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is generated. The conditions for nucleic acid amplification and amplification product detection are known to those skilled in the art. A variety of improvements to the basic PCR technique have been developed, including but not limited to, anchored PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). The primer pairs in the amplification reaction must anneal to opposite strands of the template nucleic acid and should be positioned at an appropriate distance from each other such that the polymerase can efficiently polymerize across the region and such that the amplification product can be easily detected, e.g., using electrophoresis. For example, computer programs such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to assist in designing primers with similar melting temperatures. Generally, oligonucleotide primers are 9 - 30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length), but oligonucleotide primers can be longer or shorter provided that appropriate amplification conditions are used.

[0089] Detection of amplification products or hybridization complexes is typically achieved using detectable labels. The term "label", when referring to nucleic acids, is intended to include direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, as well as indirect labeling of nucleic acids by reaction with another reagent that has been directly labeled with a detectable substance. Detectable substances include a variety of enzymes, cofactors, fluorescent materials, chemiluminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable cofactor complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; examples of chemiluminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin. Examples of indirect labeling include end-labeling nucleic acids with biotin such that the nucleic acid can be detected with fluorescently labeled streptavidin.

[0090] Overview

[0091] In one aspect, the present application provides a composition for in vitro detection of colorectal cancer, the composition comprising: a nucleic acid for detecting the methylation status of a target gene, wherein the methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, and wherein the target gene is one or more of the Septin9 gene, the SDC2 gene, and the NDRG4 gene.

[0092] The present application provides target sequences of target genes that exhibit abnormal methylation in colorectal cancer, including target sequences of one or more of the Septin9 gene, the SDC2 gene, and the NDRG4 gene. The target sequence of the Septin9 gene is a sequence shown in any one of SEQ ID NOs: 1-4 or a sequence containing a sequence shown in any one of SEQ ID NOs: 1-4; the target sequence of the SDC2 gene is a sequence shown in any one of SEQ ID NOs: 5-8 or a sequence containing a sequence shown in any one of SEQ ID NOs: 5-8; the target sequence of the NDRG4 gene is a sequence shown in any one of SEQ ID NOs: 9-12 or a sequence containing a sequence shown in any one of SEQ ID NOs: 9-12.

[0093] Those skilled in the art can also understand that the target sequences of the Septin9 gene, SDC2 gene, and NDRG4 gene are not limited to the specific sequences listed above. The target sequence of the Septin9 gene should cover sequences that contain one, two, or more than three nucleotide mutations compared to any of the sequences shown in SEQ ID NOs: 1-4, but still substantially have the same essential function, and also cover sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs: 1-4. The target sequence of the SDC2 gene should cover sequences that contain one, two, or more than three nucleotide mutations compared to any of the sequences shown in SEQ ID NOs: 5-8, but still substantially have the same essential function, and also cover sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs: 5-8. The target sequence of the NDRG4 gene should cover sequences that contain one, two, or more than three nucleotide mutations compared to any of the sequences shown in SEQ ID NOs: 9-12, but still substantially have the same essential function, and also cover sequences that have 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NOs: 9-12.

[0094] The target sequence of the Septin9 gene (5'-3') is as follows:

[0095] TGACACCACCCTCCAGTCATAATTAGTCACTTCTTCCTCTGTACGTTGGAAACACCGCTTTATCGTGGAGACTTTAAGGATATCCAAGTAGAGAGAATTCTTCCGTGCAAGTTTTGCATCCTCTCACCACTGCCTGCGTTACCCGAGTTGTAAAGGGCGGCTCCCTGTGTCTGCCCCGCTGCACCGATACACCGAGCTGCGCACGGTGCCCAGCGCAGGGAGAACAAATGATCATCTGTCCAACGCGCCCATTTACAG (SEQ ID NO: 1)

[0096] The sequence of the target sequence of the Septin9 gene after bisulfite treatment (5'-3') is as follows:

[0097] TGATATTATTTTTTAGTTATAATTAGTTATTTTTTTTTTTGTACGTTGGAAATATCGTTTTATCGTGGAGATTTTAAGGATATTTAAGTAGAGAGAATTTTTTCGTGTAAGTTTTGTATTTTTTTATTATTGTTTGCGTTATTCGAGTTGTAAAGGGCGGTTTTTTGTGTTTGTTTCGTTGTATCGATATATCGAGTTGCGTACGGTGTTTAGCGTAGGGAGAATAAATGATTATTTGTTTAACGCGTTTATTTATAG(SEQ ID NO:2)

[0098] The reverse complementary sequence (5'-3') of the target sequence of the Septin9 gene is as follows:

[0099] CTGTAAATGGGCGCGTTGGACAGATGATCATTTGTTCTCCCTGCGCTGGGCACCGTGCGCAGCTCGGTGTATCGGTGCAGCGGGGCAGACACAGGGAGCCGCCCTTTACAACTCGGGTAACGCAGGCAGTGGTGAGAGGATGCAAAACTTGCACGGAAGAATTCTCTCTACTTGGATATCCTTAAAGTCTCCACGATAAAGCGGTGTTTCCAACGTACAGAGGAAGAAGTGACTAATTATGACTGGAGGGTGGTGTCA(SEQ ID NO:3)

[0100] The sequence of the reverse complementary sequence of the Septin9 gene target sequence after bisulfite treatment (5'-3') is as follows:

[0101] TTGTAAATGGGCGCGTTGGATAGATGATTATTTGTTTTTTTTGCGTTGGGTATCGTGCGTAGTTCGGTGTATCGGTGTAGCGGGGTAGATATAGGGAGTCGTTTTTTATAATTCGGGTAACGTAGGTAGTGGTGAGAGGATGTAAAATTTGTACGGAAGAATTTTTTTTATTTGGATATTTTTAAAGTTTTTACGATAAAGCGGTGTTTTTAACGTATAGAGGAAGAAGTGATTAATTATGATTGGAGGGTGGTGTTA

[0102] The target sequence (5'-3') of the SDC2 gene is as follows:

[0103] TGCGGCTAGGGCGAGGTAACCGACACTACGTGGAATCGCAGTAGGCGATCCCTCAAGGGGATACTGGGGGAGGCACGGAACGCGTCCGAAAATGCTGGGACGCCGGCCACTGGATTCCCAGTCCTGCGGCGACCCCCTCCTCGTTGAGGGGTGGAGGTTGCACCGCGGGGCGTCAGG(SEQ ID NO:5)

[0104] The sequence of the target sequence of the SDC2 gene after bisulfite treatment (5'-3') is as follows:

[0105] TGCGGTTAGGGCGAGGTAATCGATATTACGTGGAATCGTAGTAGGCGATTTTTTAAGGGGATATTGGGGGAGGTACGGAACGCGTTCGAAAATGTTGGGACGTCGGTTATTGGATTTTTAGTTTTGCGGCGATTTTTTTTTCGTTGAGGGGTGGAGGTTGTATCGCGGGGCGTTAGG(SEQ ID NO:6)

[0106] The reverse complementary sequence of the target sequence of the SDC2 gene (5'-3') is as follows:

[0107] CCTGACGCCCCGCGGTGCAACCTCCACCCCTCAACGAGGAGGGGGTCGCCGCAGGACTGGGAATCCAGTGGCCGGCGTCCCAGCATTTTCGGACGCGTTCCGTGCCTCCCCCAGTATCCCCTTGAGGGATCGCCTACTGCGATTCCACGTAGTGTCGGTTACCTCGCCCTAGCCGCA(SEQ ID NO:7)

[0108] The sequence of the reverse complementary sequence of the target sequence of the SDC2 gene after bisulfite treatment (5'-3') is as follows:

[0109] TTTGACGTTTCGCGGTGTAATTTTTATTTTTTAACGAGGAGGGGGTCGTCGTAGGATTGGGAATTTAGTGGTCGGCGTTTTAGTATTTTCGGACGCGTTTCGTGTTTTTTTTAGTATTTTTTTGAGGGATCGTTTATTGCGATTTTACGTAGTGTCGGTTATTTCGTTTTAGTCGTA(SEQ ID NO:8)

[0110] The target sequence (5'-3') of the NDRG4 gene is as follows:

[0111] GGCTCCGCGTCGCGGTCCCCGCTCGCCCTCCCGCCCGCCCACCGGGCACCCCAGCCGCGCAGAAGGCGGAAGCCACGCGCGAGGGACCGCGGTCCGTCCGGGACTAGCCCCAGGCCCGGCACCGCCCCGCGGGCCGAGCGCCCACACCCGCCAA(SEQ ID NO:9)

[0112] The sequence of the target sequence of the NDRG4 gene after bisulfite treatment (5'-3') is as follows:

[0113] AGGTTTCGCGTCGCGGTTTTCGTTCGTTTTTTCGTTCGTTTATCGGGTATTTTAGTCGCGTAGAAGGCGGAAGTTACGCGCGAGGGATCGCGGTTCGTTCGGGATTAGTTTTAGGTTCGGTATCGTTTCGCGGGTCGAGCGTTTATATTCGTTAA(SEQ ID NO:10)

[0114] The reverse complementary sequence (5'-3') of the target sequence of the NDRG4 gene is as follows:

[0115] TTGGCGGGTGTGGGCGCTCGGCCCGCGGGGCGGTGCCGGGCCTGGGGCTAGTCCCGGACGGACCGCGGTCCCTCGCGCGTGGCTTCCGCCTTCTGCGCGGCTGGGGTGCCCGGTGGGCGGGCGGGAGGGCGAGCGGGGACCGCGACGCGGAGCC(SEQ ID NO:11)

[0116] The sequence of the reverse complementary sequence of the target sequence of the NDRG4 gene after bisulfite treatment (5'-3') is as follows:

[0117] TTGGCGGGTGTGGGCGTTCGGTTCGCGGGGCGGTGTCGGGTTTGGGGTTAGTTTCGGACGGATCGCGGTTTTTCGCGCGTGGTTTTCGTTTTTTGCGCGGTTGGGGTGTTCGGTGGGCGGGCGGGAGGGCGAGCGGGGATCGCGACGCGGAGTTT(SEQ ID NO:12)

[0118] The target sequences and related sequences of Septin9 gene, SDC2 gene and NDRG4 gene are shown in Table 1 as follows:

[0119] Table 1: Target sequences and related sequences of each gene

[0120]

[0121]

[0122] Preferably, the nucleic acid for detecting the methylation status of a target gene comprises a fragment of at least 9 nucleotides in the target sequence of the target gene, wherein the fragment comprises at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite conversion is used to transform the DNA of the sample to be tested, the nucleic acid for detecting the methylation status of the target gene comprises a fragment of at least 9 nucleotides in the sequence obtained by bisulfite conversion of the target sequence of the target gene, preferably at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment comprises at least one CpG dinucleotide sequence.

[0123] More preferably, the nucleic acid for detecting the methylation status of a target gene comprises a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or stringent conditions, wherein the nucleotide fragment comprises at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite conversion is used to transform the DNA of the sample to be tested, the nucleic acid for detecting the methylation status of the target gene comprises a fragment of at least 15 nucleotides that hybridizes to the sequence obtained by bisulfite conversion of the target sequence of the target gene under moderately stringent or stringent conditions, preferably at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the nucleotide fragment comprises at least one CpG dinucleotide sequence.

[0124] Preferably, the composition further comprises a reagent for converting the 5-position unmethylated cytosine base of the target sequence of the target gene into uracil. More preferably, the reagent is bisulfite.

[0125] Preferably, the composition comprises one or more of the primers and probes shown in Table 2.

[0126] Table 2: Primer and probe sequences used in this application

[0127] Sequence number Sequence name Specific nucleotide sequence (5’-3’) SEQ ID NO:13 Septin9_F TTTTTTGTACGTTGGAAATATC SEQ ID NO:14 Septin9_R ACGAAAAAATTCTCTCTACTTAA SEQ ID NO:19 Septin9_P ATATCCTTAAAATCTCCACGATAAAAC SEQ ID NO:15 SDC2_F TCGGCGTTTTAGTATTTTC SEQ ID NO:16 SDC2_R CTACGTAAAATCGCAATAAAC SEQ ID NO:20 SDC2_P ACGCGTTTCGTGTTTTT SEQ ID NO:17 NDRG4_F ACGGATCGCGGTTTTTC SEQ ID NO:18 NDRG4_R ACCGAACACCCCAACC SEQ ID NO:21 NDRG4_P CGCGTGGTTTTCGTTTTTTGC

[0128] In Table 3, "F" represents the forward primer; "R" represents the reverse primer; "P" represents the probe.

[0129] Preferably, the probe sequences used in this application are labeled with fluorescence, as shown in Table 3.

[0130] Table 3

[0131] Sequence number Sequence name 5’ label 3’ label SEQ ID NO:19 Septin9_P FAM BHQ1 SEQ ID NO:20 SDC2_P VIC BHQ1 SEQ ID NO:21 NDRG4_P Cy5 BHQ3

[0132] In certain embodiments, the composition further comprises a reagent that converts the 5-position unmethylated cytosine base of a gene into uracil. Preferably, the reagent is bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In the DNA of eukaryotic cells, 5-methylcytosine is the most common covalent base modification. 5-Methylcytosine cannot be identified by sequencing because 5-methylcytosine has the same base pairing behavior as cytosine. In addition, during PCR amplification, the epigenetic information carried by 5-methylcytosine is completely lost. The most commonly used method for analyzing the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, cytosine that is not methylated is converted to uracil, which corresponds to thymine in terms of base pairing behavior; but 5-methylcytosine remains unmodified under these conditions. Thus, the original DNA is transformed in such a way that 5-methylcytosine, which could not be distinguished from cytosine in its hybridization behavior, can now be detected by conventional known molecular biology techniques as the only remaining cytosine, for example by amplification and hybridization. All of these techniques are based on different base pairing properties and can now be fully utilized. Thus, typically, the present application provides for the combined use of bisulfite technology with one or more methylation assays to determine the methylation status of CpG dinucleotide sequences within the target sequence of a target gene. In addition, the methods of the present application are suitable for analyzing heterogeneous biological samples, such as low-concentration tumor cells in blood or feces. Thus, when analyzing the methylation status of CpG dinucleotide sequences in such samples, those skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion, or degree) of a specific CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation profile or methylation status should also be considered to refer to a value that reflects the methylation status of a CpG dinucleotide sequence.

[0133] On the other hand, the present application provides oligonucleotides for in vitro detection of colorectal cancer, comprising: a fragment of at least 9 nucleotides of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0134] a fragment of at least 9 nucleotides of SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or

[0135] A fragment of at least 9 nucleotides from SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12 or its complementary sequence and containing at least one CpG dinucleotide sequence.

[0136] The oligonucleotide for in vitro detection of colorectal cancer in the present application further comprises: a fragment of at least 15 nucleotides hybridizing to SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or its complementary sequence under moderate stringency or stringent conditions and containing at least one CpG dinucleotide sequence; and / or

[0137] a fragment of at least 15 nucleotides hybridizing to SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8 or its complementary sequence under moderate stringency or stringent conditions and containing at least one CpG dinucleotide sequence; and / or

[0138] a fragment of at least 15 nucleotides hybridizing to SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12 or its complementary sequence under moderate stringency or stringent conditions and containing at least one CpG dinucleotide sequence.

[0139] In a specific embodiment, the oligonucleotide for in vitro detection of colorectal cancer comprises the sequences of SEQ ID NO:13 and SEQ ID NO:14. It further comprises the sequence of SEQ ID NO:19.

[0140] In another specific embodiment, the oligonucleotide for in vitro detection of colorectal cancer comprises the sequences of SEQ ID NO:13 and SEQ ID NO:14 and the sequences of SEQ ID NO:15 and SEQ ID NO:16. It further comprises the sequences of SEQ ID NO:19 and SEQ ID NO:20.

[0141] In another specific embodiment, the oligonucleotide for in vitro detection of colorectal cancer comprises the sequences of SEQ ID NO:13 and SEQ ID NO:14 and the sequences of SEQ ID NO:17 and SEQ ID NO:18. It further comprises the sequences of SEQ ID NO:19 and SEQ ID NO:21.

[0142] In another specific embodiment, the oligonucleotide for in vitro detection of colorectal cancer comprises: the sequences of SEQ ID NO:15 and SEQ ID NO:16, and the sequences of SEQ ID NO:17 and SEQ ID NO:18, and further comprises: the sequences of SEQ ID NO:20 and SEQ ID NO:21.

[0143] In another specific embodiment, the oligonucleotide for in vitro detection of colorectal cancer comprises: the sequences of SEQ ID NO:13 and SEQ ID NO:14; the sequences of SEQ ID NO:15 and SEQ ID NO:16, and the sequences of SEQ ID NO:17 and SEQ ID NO:18, and further comprises: the sequences of SEQ ID NO:19, SEQ ID NO:20 and SEQ ID NO:21.

[0144] On the other hand, the present application provides a kit comprising the composition. The kit further contains at least one other component selected from the following: nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0145] Typically, the kit further includes a container for accommodating a biological sample of a patient. And, the kit also includes instructions for using and interpreting the test results.

[0146] The present application also relates to the use of the above composition and oligonucleotide in the preparation of a kit for in vitro detection of colorectal cancer.

[0147] The present application also relates to the use of the combination of Septin9 gene or SDC2 gene or NDRG4 gene or Septin9 gene and SDC2 gene or Septin9 gene and NDRG4 gene or SDC2 gene and NDRG4 gene or Septin9 gene, SDC2 gene and NDRG4 gene in the preparation of a kit for in vitro detection of colorectal cancer.

[0148] In still another aspect, the present application provides a method for in vitro detection of colorectal cancer, the method comprising the following steps:

[0149] 1) Isolating a target sequence or a fragment thereof of a target gene in a biological sample to be tested;

[0150] 2) Determining the methylation status of the target sequence of the target gene;

[0151] 3) Judging the status of the biological sample based on the detection result of the methylation status of the target sequence of the target gene, thereby achieving in vitro detection of colorectal cancer.

[0152] According to certain preferred embodiments, the method further comprises the following steps:

[0153] 1) Extract genomic DNA from a biological sample to be tested;

[0154] 2) Treat the DNA sample obtained in step 1) with a reagent to convert the 5-position unmethylated cytosine bases into uracil or other bases, i.e., convert the 5-position unmethylated cytosine bases of the target gene's target sequence into uracil or other bases. The converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable;

[0155] 3) Contact the DNA sample treated in step 2) with a DNA polymerase and primers of the target gene's target sequence, such that the treated target gene's target sequence is amplified to produce an amplification product or not amplified; if a DNA polymerization reaction occurs for the treated target gene's target sequence, an amplification product will be produced; if no DNA polymerization reaction occurs for the treated target gene's target sequence, it will not be amplified;

[0156] 4) Detect the amplification product with a probe; and

[0157] 5) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target gene's target sequence.

[0158] Preferably, typical primers include fragments of the target gene's target sequence, and the fragments of the target gene's target sequence include fragments that are respectively identical to, complementary to, or hybridize under medium stringency or high stringency conditions to at least 9 nucleotides selected from any one of SEQ ID NOs: 1-4, and / or at least 9 nucleotides selected from any one of SEQ ID NOs: 5-8, and / or at least 9 nucleotides selected from any one of SEQ ID NOs: 9-12.

[0159] Preferably, typical probes include fragments of the target gene's target sequence, and the fragments of the target gene's target sequence include fragments that are respectively identical to, complementary to, or hybridize under medium stringency or high stringency conditions to at least 15 nucleotides selected from any one of SEQ ID NOs: 1-4, and / or at least 15 nucleotides selected from any one of SEQ ID NOs: 1-4, and / or at least 15 nucleotides selected from any one of SEQ ID NOs: 9-12.

[0160] Preferably, one or more of the primers and probes are as shown in Table 2 above.

[0161] And the contacting or amplifying comprises using at least one of the following methods: using a thermostable DNA polymerase as the amplifying enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), generating an amplified product nucleic acid molecule with a detectable label.

[0162] Preferably, the methylation status is determined by PCR. Assay methods such as "fluorescence-based real-time PCR technology", methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylation CpG island amplification (MCA) are used to determine the methylation status of at least one CpG dinucleotide in the target sequence of the target gene. Among them, the "fluorescence-based real-time PCR" assay is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and does not require further operations after the PCR step. Briefly, the "fluorescence-based real-time PCR" method starts with a mixed sample of genomic DNA, which is converted into a mixed pool of methylation-dependent sequence differences in a bisulfite reaction according to standard operations. Subsequently, fluorescence-based PCR is performed in a "biased" reaction (using PCR primers that overlap known CpG dinucleotides). Sequence differences can be generated at the amplification level and at the fluorescence detection amplification level. The "fluorescence-based real-time PCR" assay can be used as a quantitative test for the methylation status in a genomic DNA sample, where sequence discrimination occurs at the probe hybridization level. In this quantitative method, in the presence of a fluorescence probe that overlaps a specific CpG dinucleotide, the PCR reaction provides methylation-specific amplification. An unbiased control for the starting DNA amount is provided by the following reaction: where neither the primer nor the probe covers any CpG dinucleotides. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as "TaqMan", "Lightcycler", etc. The TaqMan probe is double-labeled with a fluorescence reporter (RTSPYL5rter) and a quencher molecule and is designed to be specific for regions with a relatively high GC content, so that it melts at a temperature approximately 10°C higher than the forward or reverse primer in the PCR cycle. This allows the TaqMan probe to remain fully hybridized during the PCR annealing / extension step. When Taq polymerase enzymatically synthesizes a new strand during PCR, it will eventually encounter the annealed TaqMan probe. The 5' to 3' endonuclease activity of Taq polymerase will then displace it by digesting the TaqMan probe, thereby releasing the fluorescence reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescence detection system. Typical reagents for "fluorescence-based real-time PCR" analysis can include, but are not limited to: PCR primers for the target sequence of the target gene; non-specific amplification blockers; TaqMan or Lightcycler probes; optimized PCR buffer and deoxynucleotides; and Taq polymerase, etc.

[0163] In some preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined by the critical Ct value of a real-time PCR reaction. By using the method of analyzing DNA in a biological sample through a real-time PCR reaction, it is convenient to detect the methylation status of the target sequence of the target gene, and it is possible to quickly and conveniently determine whether the tested sample is positive based on the critical Ct value of the PCR reaction. Therefore, a non-invasive and rapid in vitro detection method for colorectal cancer is provided.

[0164] The biological sample can be, for example, peripheral blood whole blood, plasma or serum.

[0165] Example

[0166] This application generally and / or specifically describes the materials and test methods used in the experiments. In the following examples, unless otherwise specifically stated, % represents wt%, that is, weight percentage. Reagents or instruments without indicating the manufacturer can be obtained as conventional reagent products through commercial purchase.

[0167] Example 1 Primer and Probe Testing

[0168] The methylation Septin9 gene detection of the present invention is a non-invasive peripheral blood detection and has obtained CFDA and CE certifications (CFDA registration number: National Medical Device Registration 20143405186). The screening process for the remaining two genes is as follows:

[0169] 1) Tissue data screening: Twenty pairs of colorectal cancer and adjacent cancer patients were collected for whole genome bisulfite sequencing (WGBS). Markers were screened using intervals rich in CG sites (see patent: 2023112202446 (patent application number)), and intervals with cancer mean / median > adjacent cancer mean / median were selected.

[0170] 2) Plasma data screening: According to the intervals of the above tissue data differences, corresponding primer probes were customized. The applicant collected the blood of 100 healthy people and 100 colorectal cancer patients for targeted high-throughput sequencing. It was required that the cancer mean & median / healthy person mean & median in the interval rich in CG > 1.2, and the overall methylation level of healthy people in this interval < 0.02. Finally, 123 differentially methylated regions were obtained. Intervals located in the gene promoter and genes with relevant references were selected, and finally 6 intervals were obtained.

[0171] 3) Biomarker verification: Primers and probes were designed for the above 6 differentially methylated regions, and qPCR verification was performed using the applicant's (Bocheng) blood samples (number of colorectal cancer samples = 40, number of healthy person samples = 38). Finally, the genes Septin9, SDC2, and NDRG4 showed the best performance. The optimal qPCR system is shown in Table 4 below.

[0172] Table 4: PCR System of the Optimal Primer Combinations

[0173]

[0174]

[0175] Note: "F" represents the forward primer; "R" represents the reverse primer; "P" represents the probe.

[0176] Genomic DNA was extracted from 90 colorectal cancer blood samples and 30 control plasma samples. After being converted to BisDNA by bisulfite treatment, methylation detection of the Septin9, SDC2, and NDRG4 genes was performed according to the PCR reaction system in Example 1. Finally, the CT values of real-time PCR for the target gene sequences in 120 samples were measured. According to the PCR results (Table 5), the critical value for the Ct values of all three genes was selected as Ct = 45. Samples with Ct values less than 45 were detected as positive, and samples with Ct values greater than or equal to 45 were detected as negative. When using blood to detect the methylation level of the Septin9 gene, its sensitivity and specificity were 76.67% and 100.00% respectively (as shown in Table 6 below). When using blood to detect the methylation level of the SDC2 gene, its sensitivity and specificity were 40.00% and 98.89% respectively (as shown in Table 7 below). When using blood to detect the methylation level of the NDRG4 gene, its sensitivity and specificity were 43.33% and 100.00% respectively (as shown in Table 8 below). The sensitivity and specificity of the combined detection of the three genes (positive for single positive, negative for triple negative) were 90.00% and 98.89% respectively (as shown in Table 9 below).

[0177] Table 5: Detection Results of Ct Values of Septin9, SDC2, and NDRG4 Genes in Colorectal Cancer Samples and Control Samples

[0178]

[0179]

[0180]

[0181]

[0182]

[0183] Table 6: Detection results of Septin9 gene in colorectal cancer samples and control samples

[0184]

[0185] Table 7: Detection results of SDC2 gene in colorectal cancer samples and control samples

[0186]

[0187] Table 8: Detection results of NDRG4 gene in colorectal cancer samples and control samples

[0188]

[0189]

[0190] Table 9: Detection results of combined Septin9, SDC2, and NDRG4 genes in colorectal cancer samples and control samples

[0191]

[0192] The above experimental results indicate that the methylated DNA of the target gene target sequence is a biomarker for colorectal cancer. Through the detection of the methylated DNA of the target gene target sequence of the present invention, non-invasive in vitro detection of colorectal cancer can be achieved, and the detection rate of colorectal cancer can be improved.

Claims

1. A composition for in vitro detection of colorectal cancer, comprising: Nucleic acid used to detect the methylation status of the target gene, Wherein, the methylation state of the target gene is characterized by the methylation of the target sequence of the target gene, Wherein, the target gene is one or more of Septin9 gene, SDC2 gene and NDRG4 gene.

2. The composition according to claim 1, wherein The target sequence of the Septin9 gene is a sequence as shown in any one of SEQ ID NOs: 1-4 or comprises a sequence as shown in any one of SEQ ID NOs: 1-4; and / or The target sequence of the SDC2 gene is a sequence as shown in any one of SEQ ID NOs: 5-8 or comprises a sequence as shown in any one of SEQ ID NOs: 5-8; and / or The target sequence of the NDRG4 gene is as shown in any one of SEQ ID NOs: 9-12 or comprises the sequence shown in any one of SEQ ID NOs: 9-12.

3. The composition according to claim 1 or 2, wherein The nucleic acid used to detect the methylation status of the target gene includes: A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene, The fragment comprises at least one CpG dinucleotide sequence; Preferably, the fragment of at least 9 nucleotides is a sequence as shown in SEQ ID NO: 13 and SEQ ID NO: 14, and / or a sequence as shown in SEQ ID NO: 15 and SEQ ID NO: 16, and / or a sequence as shown in SEQ ID NO: 17 and SEQ ID NO: 18; Preferably, the nucleic acid used to detect the methylation status of the target gene includes: A probe, wherein the probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or stringent conditions, The fragment comprises at least one CpG dinucleotide sequence; Preferably, the fragment of at least 15 nucleotides is a sequence as shown in SEQ ID NO: 19, and / or a sequence as shown in SEQ ID NO: 20, and / or a sequence as shown in SEQ ID NO: 21; Preferably, it also includes: A reagent that converts unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.

4. An oligonucleotide for in vitro detection of colorectal cancer, comprising: A fragment of at least 9 nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or A fragment of at least 9 nucleotides of SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or A fragment of at least 9 nucleotides of SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

5. The oligonucleotide according to claim 4, further comprising: A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or its complementary sequence under moderately stringent or stringent conditions and comprises at least one CpG dinucleotide sequence; and / or A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or its complementary sequence under moderately stringent or stringent conditions and comprises at least one CpG dinucleotide sequence; and / or A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or its complementary sequence under moderately stringent or stringent conditions and comprises at least one CpG dinucleotide sequence.

6. An oligonucleotide for in vitro detection of colorectal cancer, comprising: The sequence of SEQ ID NO: 13 and SEQ ID NO: 14, preferably, further comprising: Sequence of SEQ ID NO:

19.

7. The oligonucleotide according to claim 6, further comprising: The sequences of SEQ ID NO: 15 and SEQ ID NO: 16 preferably further include: The sequence of SEQ ID NO: 20; or The oligonucleotide further comprises: The sequence of SEQ ID NO: 17 and SEQ ID NO: 18; preferably, it also includes: Sequence of SEQ ID NO:

21.

8. An oligonucleotide for in vitro detection of colorectal cancer, comprising: The sequence of SEQ ID NO: 13 and SEQ ID NO: 14; the sequence of SEQ ID NO: 15 and SEQ ID NO: 16 and the sequence of SEQ ID NO: 17 and SEQ ID NO: 18; preferably, it also includes: The sequence of SEQ ID NO:19, the sequence of SEQ ID NO:20 and the sequence of SEQ ID NO:

21.

9. A kit comprising the composition of any one of claims 1 to 3 or the oligonucleotide of any one of claims 4 to 8; Preferably, it further comprises at least one other component selected from the following: Nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase; Preferably, the samples used for detection in the kit include: Cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, stool, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof; Preferably, it also includes: an instruction manual.

10. Use of the composition according to any one of claims 1 to 3 or the oligonucleotide according to any one of claims 4 to 8 in the preparation of a kit for in vitro detection of colorectal cancer; Preferably, the kit for in vitro detection of colorectal cancer detects colorectal cancer by a method comprising the following steps: 1) separating a DNA sample including a target sequence of a target gene or a fragment thereof from a biological sample to be tested; 2) determining the methylation status of the target sequence of the target gene; 3) judging the state of the biological sample by the detection result of the methylation state of the target sequence of the target gene, thereby realizing the in vitro detection of colorectal cancer; Preferably, the method comprises the following steps: Extracting genomic DNA from the biological sample to be tested; Treat the extracted genomic DNA with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases; contacting the DNA sample treated with the reagent with a DNA polymerase and a primer of a target sequence of a target gene to perform a DNA polymerization reaction; Detect the amplified product using a probe; as well as Determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplification product; Preferably, the reagent is a bisulfite reagent.

Images