Cervical cancer detection kit and application

Abstract

The invention discloses a cervical cancer detection kit and application, a PAX1 PCR reaction solution, a CTBP2P1 PCR reaction solution, an AMD1P2 PCR reaction solution and a DPH3P2 PCR reaction solution provided in the kit contain specific primers and probes for detecting target genes, the detection sensitivity is high, and the specificity is good. Based on a fluorescent quantitative PCR technology, the detection reagent is used for carrying out methylation joint detection on four target genes PAX1, CTBP2P1, AMD1P2 and DPH3P2 in a detection sample, so that whether the sample is cancerous or not is judged, the difference possibly caused by site selection and a reaction system is effectively supplemented, the randomness of base change is reduced, and the accuracy of cervical cancer screening is improved.

Description

Technical Field

[0001] The present invention relates to the field of biomedical testing technologies, and particularly relates to a kit and a detection method for detecting gene methylation of cervical cells based on fluorescence quantitative PCR technology. Background Art

[0002] Cervical cancer is one of the common malignant tumors in women, and its incidence rate ranks second among gynecological malignant tumors. The occurrence of cervical cancer is a long process, and there is a latency period of 5 - 10 years from precancerous lesions to invasive cancer. The occurrence of cervical cancer is closely related to the infection of human papillomavirus (HPV). After high-risk HPV infection, the occurrence of cervical cancer requires multiple steps, from persistent high-risk HPV infection to precancerous lesions, and finally developing into invasive cancer. In China, cervical cancer is one of the common malignant tumors threatening women's health. It is worth noting that in recent years, the average onset age of cervical cancer has been gradually decreasing, showing a trend of getting younger. Therefore, it is very necessary to standardize the diagnosis and treatment of cervical cancer nationwide. On the other hand, the occurrence of cervical cancer can be effectively controlled by examining and treating precancerous lesions.

[0003] Gene methylation is an important part of genetic epigenetics and is an early event in the process of tumorigenesis. After methylation occurs in the promoter region of a gene, it usually leads to down-regulation of the expression of this gene, thereby affecting a series of molecular events in the cell and ultimately causing the cell to become cancerous. Compared with gene mutations, epigenetic changes (such as DNA methylation) are more common in the occurrence of tumors. DNA methylation can regulate cell proliferation, apoptosis and differentiation, and its level is closely related to the biological characteristics of tumors. Therefore, using gene methylation for early diagnosis of tumors has become a hot field in molecular testing.

[0004] Currently, the commonly used cervical cancer screening methods in clinical practice include visual inspection with acetic acid staining, TCT detection, and HPV DNA detection. Among them, although the HPV DNA detection has relatively high sensitivity, most HPVs are general infections and will not develop into cervical precancerous lesions or cervical cancer, causing unnecessary panic to the testers and wasting medical resources. In addition, TCT detection is prone to missed detection, and the HPV detection has problems such as a relatively high false positive rate. Therefore, there is an urgent need in clinical practice for a technology that can screen for early-stage cervical cancer immediately and accurately; a biological marker that can identify true high risks is required. Summary of the Invention

[0005] Aiming at the defects existing in the prior art, the purpose of the present invention is to provide a cervical cancer detection kit and its application. Based on the fluorescence quantitative PCR technology, the detection reagents in the kit are used to detect the methylation of cervical cancer markers PAX1, CTBP2P1, AMD1P2 and DPH3P2, and the early screening of cervical cancer is realized through the combined detection of multi-gene methylation.

[0006] The four target genes PAX1, CTBP2P1, AMD1P2 and DPH3P2 targeted by the detection reagents provided by the present invention are all closely related to the progression of cervical cancer. Among them, the NCBI database number of the involved PAX1 gene sequence is NC_000020.11, and the NCBI database numbers of the CTBP2P1 gene, AMD1P2 gene and DPH3P2 gene are NC_000024.10, NC_000023.11 and NC_000023.11 respectively.

[0007] To achieve the purpose of the invention, the present invention provides the following technical solutions: The present invention provides a cervical cancer detection kit, which is characterized in that the kit contains the following detection reagents: PAX1 PCR reaction solution, which is used to detect the methylation degree in at least one target region in the promoter region of the PAX1 gene; CTBP2P1 PCR reaction solution, which is used to detect the methylation degree in at least one target region in the promoter region of the CTBP2P1 gene; AMD1P2 PCR reaction solution, which is used to detect the methylation degree in at least one target region in the promoter region of the AMD1P2 gene; DPH3P2 PCR reaction solution, which is used to detect the methylation degree in at least one target region in the promoter region of the DPH3P2 gene; Positive control product and negative control product, wherein the positive control substance contained in the positive control product is selected from the DNA of cervical adenocarcinoma cell Hela, and the negative control product is sterile water; The promoter regions for the above detection reagents to detect the methylation of the target genes PAX1, CTBP2P1, AMD1P2, DPH3P2 are not strictly limited to the regions located within the promoter fragments, but the gene fragments in the regions near the promoter.

[0008] The nucleotide sequences of the gene-specific primers, probes and internal reference gene primers, probes involved in the detection reagents in the cervical cancer detection kit of the present invention are shown in Table 1 below. At the same time, the nucleotide sequences involved in Table 1 of the present invention will be submitted to the State Intellectual Property Office in the form of a sequence listing conforming to the WIPO ST.26 standard.

[0009] Table 1: Nucleotide sequences of gene-specific primers, probes and internal reference gene primers, probes Sequence Name Oligonucleotide Sequence 5'-3' Number PAX1 Forward Primer TCGACGTTGTAGTTTTTCGGT SEQ ID No.1 PAX1 Reverse Primer TACCCCTCCAAAACCTCCCAC SEQ ID No.2 PAX1 Probe CCCGACCCCAACCCAAATAACTTCAT SEQ ID No.3 CTBP2P1 Forward Primer ATATAGACCAATGGAACAA SEQ ID No.4 CTBP2P1 Reverse Primer AGAAATAATGCCAC SEQ ID No.5 CTBP2P1 Probe TAGCCAGTTTTCCCAGCACC SEQ ID No.6 AMD1P2 Forward Primer AGTATTCCAAGATCTGAGTGGG SEQ ID No.7 AMD1P2 Reverse Primer ATGCTACTCTCACTGAGTA SEQ ID No.8 AMD1P2 Probe GATGTGTAATGTTCAA SEQ ID No.9 DPH3P2 Forward Primer CATGCTTGGTCTGTTCC SEQ ID No.10 DPH3P2 Reverse Primer ATGCCCATATAAATTGT SEQ ID No.11 DPH3P2 Probe GCACTTATTACATGACAATGA SEQ ID No.12 Internal Reference ACTB Forward Primer TAGGATTTTTATTTAG SEQ ID No.13 Internal Reference ACTB Reverse Primer TGTGAATTTTTGTTAT SEQ ID No.14 Internal Reference ACTB Probe TTTTAAGGGAGGAGT SEQ ID No.15 The components of the PAX1 PCR reaction solution are as follows: including PAX1 forward and reverse primers, PAX1 probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, 10× buffer, dNTP, Taq enzyme and UNG enzyme; the molar concentration ratio of the PAX1 forward and reverse primers and the PAX1 probe is 4:4:2; The base sequence of the PAX1 forward primer is shown in SEQ ID No. 1, the base sequence of the PAX1 reverse primer is shown in SEQ ID No. 2, the base sequence of the PAX1 probe is shown in SEQ ID No. 3, the base sequence of the internal reference ACTB forward primer is shown in SEQ ID No. 13, the base sequence of the internal reference ACTB reverse primer is shown in SEQ ID No. 14, and the base sequence of the internal reference ACTB probe is shown in SEQ ID No. 15.

[0010] The components of the CTBP2P1 PCR reaction solution are as follows: including CTBP2P1 forward and reverse primers, CTBP2P1 probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, 10× buffer, dNTP, Taq enzyme and UNG enzyme; the molar concentration ratio of the CTBP2P1 forward and reverse primers and the PAX1 probe is 4:4:2; The base sequence of the CTBP2P1 forward primer is shown in SEQ ID No. 4, the base sequence of the CTBP2P1 reverse primer is shown in SEQ ID No. 5, the base sequence of the CTBP2P1 probe is shown in SEQ ID No. 6, the base sequence of the internal reference ACTB forward primer is shown in SEQ ID No. 13, the base sequence of the internal reference ACTB reverse primer is shown in SEQ ID No. 14, and the base sequence of the internal reference ACTB probe is shown in SEQ ID No. 15.

[0011] The components of the AMD1P2 PCR reaction solution are as follows: including AMD1P2 forward and reverse primers, AMD1P2 probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, 10× buffer, dNTP mixture, Taq enzyme and UNG enzyme; the molar concentration ratio of the AMD1P2 forward and reverse primers and the AMD1P2 probe is 4:4:2; The base sequence of the forward primer of AMD1P2 is shown in SEQ ID No. 7, the base sequence of the reverse primer of AMD1P2 is shown in SEQ ID No. 8, the base sequence of the probe of AMD1P2 is shown in SEQ ID No. 9, the base sequence of the forward primer of the internal reference ACTB is shown in SEQ ID No. 13, the base sequence of the reverse primer of the internal reference ACTB is shown in SEQ ID No. 14, and the base sequence of the probe of the internal reference ACTB is shown in SEQ ID No. 15.

[0012] The components of the DPH3P2 PCR reaction solution are as follows: including the forward and reverse primers of AMD1P2, the probe of DPH3P2, the forward and reverse primers of the internal reference ACTB, the probe of the internal reference ACTB, 10× buffer, dNTP mixture, Taq enzyme and UNG enzyme; the molar concentration ratio of the forward and reverse primers of AMD1P2 and the probe of DPH3P2 is 4:4:2; The base sequence of the forward primer of DPH3P2 is shown in SEQ ID No. 10, the base sequence of the reverse primer of DPH3P2 is shown in SEQ ID No. 11, the base sequence of the probe of DPH3P2 is shown in SEQ ID No. 12, the base sequence of the forward primer of the internal reference ACTB is shown in SEQ ID No. 13, the base sequence of the reverse primer of the internal reference ACTB is shown in SEQ ID No. 14, and the base sequence of the probe of the internal reference ACTB is shown in SEQ ID No. 15.

[0013] The Taq enzyme contained in the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, the AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution of the present invention is a hot-start Taq enzyme, and the UNG enzyme contained is uracil-N-glycosylase.

[0014] At both ends of the PAX1 probe, CTBP2P1 probe, AMD1P2 probe, and the internal reference ACTB probe involved in the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution of the present invention are respectively labeled with a fluorescent reporter group and a fluorescent quenching group. Among them, the fluorescent reporter groups labeled on the PAX1 probe, CTBP2P1 probe, and AMD1P2 probe are different from the fluorescent reporter group labeled on the internal reference ACTB probe.

[0015] The fluorescent reporter groups labeled at both ends of the above-mentioned probe are selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5; the labeled fluorescent quenching groups are selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

[0016] The application of the cervical cancer detection kit of the present invention is characterized in that, based on the fluorescence quantitative PCR technology, the methylation combined detection of four genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 closely related to the cervical cancer process is carried out using the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution.

[0017] When the cervical cancer detection kit of the present invention is applied, based on the fluorescence quantitative PCR technology, the methylation combined detection of four target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in the cervical exfoliated cells of patients is carried out. The specific detection method includes the following steps: S1. Extraction, bisulfite conversion and preservation of samples S1.1 Extract cell DNA from the cervical exfoliated cell sample; S1.2 After the extraction of cell DNA is completed, perform bisulfite conversion on the extracted DNA to obtain a purified Bis-DNA sample; The obtained Bis-DNA sample should be detected in time, or can be stored at -20 °C for future testing. The storage period generally does not exceed 4 months. For long-term storage, please place it at -80 °C.

[0018] S2. Use the detection reagent of the present invention to detect the methylation of cervical cell genes in the detection sample S2.1 Prepare the reagents required for the PCR reaction system for detecting the target genes (PAX1, CTBP2P1, AMD1P2, DPH3P2) and the detection sample; S2.2 Add samples to the eight-well strip tube to prepare the PCR reaction system for detecting the target genes; S2.3. Perform PCR amplification and detection Using the purified Bis-DNA as a template, PCR amplification reactions were respectively carried out with the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution of the present invention; for the four target genes of PAX1, CTBP2P1, AMD1P2, and DPH3P2, ACTB was selected as the internal reference gene, and simultaneous detection of the target genes (PAX1, CTBP2P1, AMD1P2, DPH3P2) and the internal reference ACTB gene was achieved according to the multi-channel fluorescent probe labeling, and the ΔCt value of the target gene (ΔCt value = target Ct value - internal reference Ct value) was obtained.

[0019] S2.4. Judgment of detection results Substitute the ΔCt values of the target genes (PAX1, CTBP2P1, AMD1P2, DPH3P2) obtained in the above steps into the logistic regression equation: Y = A0 + A1*X1 + A2*X2 + A3*X3 + A4*X4, where A0, A1, A2, A3, A4 are clinical coefficients, the constant A0 = 6.945, the proportion coefficient of PAX1 A1 = 0.263, the proportion coefficient of CTBP2P1 A2 = -0.439, the proportion coefficient of AMD1P2 A3 = -0.55, the proportion coefficient of DPH3P2 A4 = -0.257; X1, X2, X3, X4 are the ΔCt values of PAX1, CTBP2P1, AMD1P2, DPH3P2 respectively; When Y ≥ 0, it is determined that the sample to be tested is positive for cervical cancer methylation; when Y < 0, it is determined that the sample to be tested is negative for cervical cancer methylation.

[0020] Based on the fluorescence quantitative PCR technology, the present invention conducts a combined methylation detection of the PAX1, CTBP2P1, AMD1P2, and DPH3P2 genes in the cervical exfoliated cells of the test sample. The present invention provides a supporting method for sample nucleic acid extraction and bisulfite conversion, uses the bisulfite-converted DNA as the template for the PCR reaction, and uses the specific primers and fluorescent probes contained in the detection reagent of the present invention to amplify the nucleic acid, so as to achieve the rapid detection of the methylation of the methylation-related genes PAX1, CTBP2P1, AMD1P2, and DPH3P2, and provides a more simple and accurate screening method for clinical use.

[0021] The beneficial effects of the present invention are as follows: A cervical cancer detection kit provided by the present invention, the detection reagents PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, the AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution respectively contain specific primers and probes designed for the target genes, and based on the fluorescence quantitative PCR technology, rapid methylation detection of the target genes can be achieved.

[0022] Using the detection agent provided by the present invention, the methylation of target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in cervical exfoliated cells is detected by combined detection. The methylation detection region of each target gene contains multiple CpGs, effectively compensating for the differences caused by site selection and reaction systems. At the same time, the combined methylation detection of four target genes reduces the randomness of base changes compared to the detection of single bases, improving the accuracy of cervical cell gene methylation detection and providing a guarantee for early screening of cervical cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the methylation PCR amplification curve of target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in a typical cervical cancer exfoliated cell sample in the application experiment of the present invention; Figure 2 It is the methylation PCR amplification curve of target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in a typical normal cervical exfoliated cell sample in the application experiment of the present invention; Figure 3 It is the receiver operating characteristic ROC curve established for 200 detection samples in the application experiment of the present invention; Figure 4 It is the comparison table of the detection results and clinical pathological diagnosis results in the application experiment of the present invention; Figure 5 It is the methylation PCR amplification curve of target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in a typical cervical cancer exfoliated cell sample in the verification experiment of the present invention; Figure 6 It is the methylation PCR amplification curve of target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in a typical normal cervical exfoliated cell sample in the verification experiment of the present invention; Figure 7 For the present invention Verification Experiment Comparison table of detection results and clinical pathological diagnosis results. DETAILED DESCRIPTION OF THE INVENTION Example 1

[0024] This example details the composition of a cervical cancer detection kit of the present invention.

[0025] The present invention provides a cervical cancer detection kit, which contains the following detection reagents: PAX1 PCR reaction solution, used to detect the methylation degree in at least one target region in the promoter region of the PAX1 gene; CTBP2P1 PCR reaction solution, used for detecting the methylation level in at least one target region within the promoter region of the CTBP2P1 gene; AMD1P2 PCR reaction solution, used for detecting the methylation level in at least one target region within the promoter region of the AMD1P2 gene; DPH3P2 PCR reaction solution, used for detecting the methylation level in at least one target region within the promoter region of the DPH3P2 gene; Positive control and negative control, the positive control substance contained in the positive control is selected from the DNA of cervical adenocarcinoma cell line Hela, and the negative control is sterile water; The promoter regions for the methylation detection of target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 by the above detection reagents are not strictly limited to the regions within the promoter fragments, but are gene fragments in the regions near the promoter.

[0026] As a preferred embodiment, a cervical cancer detection kit of the present invention contains the reagents, reagent compositions, and specifications as shown in Table 2 below.

[0027] Table 2: Composition of the kit Reagent Main Components Specification PAX1 PCR Reaction Solution PAX1 Forward Primer, PAX1 Reverse Primer, PAX1 Probe, Internal Reference ACTB Forward Primer, Internal Reference ACTB Reverse Primer, Internal Reference ACTB Probe, 10× Buffer, 10 mM dNTP Mix, Taq Enzyme and UNG Enzyme. 400ul CTBP2P1 PCR Reaction Solution CTBP2P1 Forward Primer, CTBP2P1 Reverse Primer, CTBP2P1 Probe, Internal Reference ACTB Forward Primer, Internal Reference ACTB Reverse Primer, Internal Reference ACTB Probe, 10× Buffer, 10 mM dNTP Mix, Taq Enzyme and UNG Enzyme. 400ul AMD1P2 PCR Reaction Solution AMD1P2 Forward Primer, AMD1P2 Reverse Primer, AMD1P2 Probe, Internal Reference ACTB Forward Primer, Internal Reference ACTB Reverse Primer, Internal Reference ACTB Probe, 10× Buffer, 10 mM dNTP Mix, Taq Enzyme and UNG Enzyme. 400ul DPH3P2 PCR Reaction Solution DPH3P2 forward primer, DPH3P2 reverse primer, DPH3P2 probe, internal reference ACTB forward primer, internal reference ACTB reverse primer, internal reference ACTB probe, 10× buffer, 10 mM dNTP mixture, Taq enzyme and UNG enzyme. 400ul Positive control Hela cell DNA 50ul Negative control Sterile water 50ul As shown in Table 2, the composition components of the PAX1 PCR reaction solution of the present invention include forward and reverse primers of PAX1, PAX1 probe, forward and reverse primers of internal reference ACTB, ACTB probe, 10× buffer, 10 mM dNTP mixture, Taq enzyme, and UNG enzyme. In the PAX1 PCR reaction solution of the present invention, the concentration of the PAX1 forward primer is 200 nM, the concentration of the PAX1 reverse primer is 200 nM, and the concentration of the PAX1 probe is 100 nM.

[0028] As shown in Table 2, the composition components of the CTBP2P1 PCR reaction solution of the present invention include forward and reverse primers of CTBP2P1, CTBP2P1 probe, forward and reverse primers of internal reference ACTB, ACTB probe, 10× buffer, 10 mM dNTP mixture, Taq enzyme, and UNG enzyme. In the CTBP2P1 PCR reaction solution of the present invention, the concentration of the PAX1 forward primer is 200 nM, the concentration of the CTBP2P1 reverse primer is 200 nM, and the concentration of the CTBP2P1 probe is 100 nM.

[0029] As shown in Table 2, the components of the AMD1P2 PCR reaction solution of the present invention include forward and reverse primers of AMD1P2, a probe of AMD1P2, forward and reverse primers of the internal reference ACTB, a probe of the internal reference ACTB, 10× buffer, 10 mM dNTP mixture, Taq enzyme and UNG enzyme. In the AMD1P2 PCR reaction solution of the present invention, the concentration of the forward primer of AMD1P2 is 200 nM, the concentration of the reverse primer of AMD1P2 is 200 nM, and the concentration of the probe of AMD1P2 is 100 nM.

[0030] As shown in Table 2, the components of the DPH3P2 PCR reaction solution of the present invention include forward and reverse primers of DPH3P2, a probe of DPH3P2, forward and reverse primers of the internal reference ACTB, a probe of the internal reference ACTB, 10× buffer, 10 mM dNTP mixture, Taq enzyme and UNG enzyme. In the DPH3P2 PCR reaction solution of the present invention, the concentration of the forward primer of DPH3P2 is 200 nM, the concentration of the reverse primer of DPH3P2 is 200 nM, and the concentration of the probe of DPH3P2 is 100 nM.

[0031] The nucleotide sequences of the gene-specific primers, probes, internal reference gene primers and probes contained in the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution and DPH3P2 PCR reaction solution of the present invention are shown in Table 1.

[0032] As shown in Table 1, the base sequence of the PAX1 forward primer is as shown in SEQ ID No. 1, the base sequence of the PAX1 reverse primer is as shown in SEQ ID No. 2, and the base sequence of the PAX1 probe is as shown in SEQ ID No. 3; The base sequence of the CTBP2P1 forward primer is as shown in SEQ ID No. 4, the base sequence of the CTBP2P1 reverse primer is as shown in SEQ ID No. 5, and the base sequence of the CTBP2P1 probe is as shown in SEQ ID No. 6; The base sequence of the AMD1P2 forward primer is as shown in SEQ ID No. 7, the base sequence of the AMD1P2 reverse primer is as shown in SEQ ID No. 8, and the base sequence of the AMD1P2 probe is as shown in SEQ ID No. 9; The base sequence of the DPH3P2 forward primer is as shown in SEQ ID No. 10, the base sequence of the DPH3P2 reverse primer is as shown in SEQ ID No. 11, and the base sequence of the DPH3P2 probe is as shown in SEQ ID No. 12; The base sequence of the forward primer of internal reference ACTB is shown as SEQ ID No. 13, the base sequence of the reverse primer of internal reference ACTB is shown as SEQ ID No. 14, and the base sequence of the probe of internal reference ACTB is shown as SEQ ID No. 15.

[0033] The Taq enzyme contained in the detection reagents PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution provided by the present invention is a hot start Taq enzyme, and the UNG enzyme contained is uracil-N-glycosylase.

[0034] For the PAX1 probe, CTBP2P1 probe, AMD1P2 probe, and internal reference ACTB probe involved in the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution of the present invention, both ends are respectively labeled with a fluorescent reporter group and a fluorescent quenching group. Among them, the fluorescent reporter groups labeled on the PAX1 probe, CTBP2P1 probe, and AMD1P2 probe are different from the fluorescent reporter group labeled on the internal reference ACTB probe.

[0035] The fluorescent reporter groups labeled at both ends of the above probes are selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, or CY5; the fluorescent quenching groups labeled are selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

[0036] As a preferred embodiment, in the PAX1 PCR reaction solution of the present invention, the fluorescent reporter group at the 5' end of the PAX1 probe is FAM, the fluorescent quenching group at the 3' end is BHQ1, the fluorescent reporter group at the 5' end of the internal reference ACTB probe is VIC, and the fluorescent quenching group at the 3' end is BHQ1.

[0037] In the CTBP2P1 PCR reaction solution of the present invention, the fluorescent reporter group at the 5' end of the CTBP2P1 probe is FAM, the fluorescent quenching group at the 3' end is BHQ1; the fluorescent reporter group at the 5' end of the internal reference ACTB probe is VIC, and the fluorescent quenching group at the 3' end is BHQ1.

[0038] In the AMD1P2 PCR reaction solution of the present invention, the fluorescent reporter group at the 5' end of the AMD1P2 probe is FAM, the fluorescent quenching group at the 3' end is BHQ1, the fluorescent reporter group at the 5' end of the internal reference ACTB probe is VIC, and the fluorescent quenching group at the 3' end is BHQ1.

[0039] In the DPH3P2 PCR reaction solution of the present invention, the fluorescent reporter group at the 5' end of the DPH3P2 probe is FAM, the fluorescent quenching group at the 3' end is BHQ1, the fluorescent reporter group at the 5' end of the internal reference ACTB probe is VIC, and the fluorescent quenching group at the 3' end is BHQ1.

[0040] For the detection reagents used in the application experiment and verification experiment of the detection kit of the present invention, both ends of the probe adopt the fluorescent reporter group and fluorescent quenching group labeled in this preferred embodiment. Example 2

[0041] This example relates to the application of a cervical cancer detection kit of the present invention.

[0042] The application of the cervical cancer detection kit of the present invention is based on the fluorescence quantitative PCR technology, and uses the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, the AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution to perform methylation combined detection on four genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 that are closely related to the cervical cancer process.

[0043] When the cervical cancer detection kit of the present invention is applied, based on the fluorescence quantitative PCR technology, methylation combined detection is performed on four target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in the cervical exfoliated cells of patients. The specific detection method includes the following steps: S1. Extraction, bisulfite conversion and preservation of samples The specific operations are as follows: S1.1. Extract cell DNA from the cervical exfoliated cell sample. After the extraction is completed, use a Nano-500 type micro-spectrophotometer to measure the concentration and OD260 / OD280 of the DNA, and the OD260 / OD280 is between 1.6 and 2.0.

[0044] After the extraction of cell DNA is completed, perform bisulfite conversion on the extracted DNA. The unmethylated cytosine c is converted into uracil (U), while the methylated cytosine (C) remains unchanged, thereby obtaining a purified Bis-DNA sample.

[0045] The obtained Bis-DNA sample should be detected in time, or can be stored at -20°C for future detection. The storage period is generally not more than 4 months. For long-term storage, please place it at -80°C.

[0046] S2. Use the detection reagent of the present invention to perform methylation detection of cervical cell genes on the detection sample S2.1. Prepare the reagents required for the PCR reaction system for detecting target genes (PAX1, CTBP2P1, AMD1P2, DPH3P2) and the test samples; The reagent composition of the PCR reaction system for detecting the target genes (PAX1, CTBP2P1, AMD1P2, DPH3P2) of the present invention is shown in Tables 3 to 6 below: Table 3: PCR reaction system for detecting PAX1 gene Composed of Total volume (μL) PAX1 PCR reaction solution 15 Bis-DNA template 2~5 Purified water up to 20 Table 4: PCR reaction system for detecting CTBP2P1 gene Composed of Total volume (μL) CTBP2P1 PCR reaction solution 15 Bis-DNA template 2~5 Purified water up to 20 Table 5: PCR reaction system for detecting AMD1P2 gene Composed of Total volume (μL) AMD1P2 PCR reaction solution 15 Bis-DNA template 2~5 Purified water up to 20 Table 6: PCR reaction system for detecting DPH3P2 gene Composed of Total volume (μL) DPH3P2 PCR reaction solution 15 Bis-DNA template 2~5 Purified water up to 20 S2.2. Add samples to the eight-well strip tube to prepare the PCR reaction system for detecting target genes Add 2 - 5 μL of the nucleic acid sample to be tested (Bis-DNA template) to the eight-well strip tube, add 15 μL of PAX1 PCR reaction solution or CTBP2P1 PCR reaction solution or AMD1P2 PCR reaction solution or DPH3P2 PCR reaction solution. The final volume is 20 μL per tube. Tighten the tube cap, centrifuge at low speed instantaneously, and then perform PCR amplification on the PCR instrument.

[0047] S2.3. PCR amplification and detection Select the fluorescence detection channel and set the amplification cycle parameters for the PCR instrument as shown in Table 7 below. The selection of the fluorescence detection channel corresponds to the fluorescence reporter groups labeled by the target gene probe and the internal reference ACTB probe contained in the detection reagents (PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, DPH3P2 PCR reaction solution) of the present invention. In the examples of the present invention, the fluorescence reporter groups labeled by the PAX1 probe, CTBP2P1 probe, AMD1P2 probe, and DPH3P2 probe in the detection reagents used are all FAM, and the fluorescence reporter group labeled by the internal reference ACTB probe is VIC.

[0048] Table 7 Selection of fluorescence detection channel and setting of amplification cycle parameters Step Temperature Time Number of cycles Step 1 (Denaturation) 95°C 30 sec 1 Step 2 (Amplification) 95°C 10 sec 45 Step 2 (Amplification) 60 °C (Fluorescence collection) 30 sec 45 Note: Do not select ROX correction, select None for the quenching group; after setting, save the file and run the reaction program.

[0049] Using the purified Bis-DNA as a template, PCR amplification reactions were respectively carried out using the primer and probe combinations in the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution in the kit of the present invention. For the four target genes of PAX1, CTBP2P1, AMD1P2, and DPH3P2, ACTB was selected as the internal reference gene. According to the multi-channel fluorescent probe labeling, simultaneous detection of the target genes (PAX1, CTBP2P1, AMD1P2, DPH3P2) and the internal reference ACTB gene was achieved, and the ΔCt value of the target gene (ΔCt value = target Ct value - internal reference Ct value) was obtained.

[0050] S2.4. Determination of detection results Substitute the ΔCt values of the target genes (PAX1, CTBP2P1, AMD1P2, DPH3P2) obtained in the above steps into the logistic regression equation: Y = A0 + A1*X1 + A2*X2 + A3*X3 + A4*X4, where A0, A1, A2, A3, A4 are clinical coefficients, the constant A0 = 6.945, the proportion coefficient of PAX1 A1 = 0.263, the proportion coefficient of CTBP2P1 A2 = -0.439, the proportion coefficient of AMD1P2 A3 = -0.55, the proportion coefficient of DPH3P2 A4 = -0.257; X1, X2, X3, X4 are the ΔCt values of PAX1, CTBP2P1, AMD1P2, DPH3P2 respectively; When Y ≥ 0, it is determined that the sample to be tested is positive for cervical cancer methylation; when Y < 0, it is determined that the sample to be tested is negative for cervical cancer methylation.

[0051] Based on the fluorescence quantitative PCR technology, the present invention performs a combined methylation detection on the PAX1, CTBP2P1, AMD1P2, and DPH3P2 genes of the cervical exfoliated cells in the test sample. The present invention provides a supporting method for sample nucleic acid extraction and bisulfite conversion, uses the bisulfite-converted DNA as the template for the PCR reaction, and uses the specific primers and fluorescent probes contained in the detection reagent of the present invention to amplify the nucleic acid, so as to achieve the rapid detection of the methylation of the methylation-related genes PAX1, CTBP2P1, AMD1P2, and DPH3P2, and provide a more simple and accurate screening method for clinical practice.

[0052] Example 3 This example is an application experiment of a cervical cancer detection kit of the present invention.

[0053] Experimental subjects: 200 cervical exfoliated cell samples, and the clinical pathological diagnosis results (taking CIN2 as the clinical diagnosis threshold) are as follows: 150 are normal cervical exfoliated cell samples, and 50 are cervical exfoliated cell samples of cervical lesion patients.

[0054] Using the detection reagents provided by the present invention (PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, DPH3P2 PCR reaction solution) to detect the methylation of four target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in 200 test samples, the specific detection is as follows Figures 1 to 4 shown.

[0055] Figure 1 This is the methylation PCR amplification curve of the target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in a typical cervical cancer exfoliated cell sample in the application experiment of the present invention; as shown Figure 1 by the amplification map, the Ct values of the PAX1 gene, CTBP2P1 gene, AMD1P2 gene, and DPH3P2 gene in the cervical cancer exfoliated cell sample are all ≤ 32.

[0056] Figure 2 This is the PCR amplification curve of the target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in a typical normal cervical exfoliated cell sample in the application experiment of the present invention; as shown Figure 2 by the amplification map, the Ct values of the PAX1, CTBP2P1, AMD1P2, and DPH3P2 genes in the normal cervical exfoliated cell sample are all > 32.

[0057] It can be seen from Figure 1 , Figure 2 that there are significant differential expressions of the four target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 targeted by the detection reagents of the present invention in the cervical cancer exfoliated cell sample and the normal cervical exfoliated cell sample. The four target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 are all closely related to the progression of cervical cancer. The detection reagent contains specific primers and probes for detecting the target genes, with high detection sensitivity and good specificity.

[0058] Figure 3 The receiver operating characteristic (ROC) curve established for 200 test samples in the application experiment of the present invention. Using the detection reagents provided by the present invention, namely the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution, methylation detection was performed on four corresponding target genes, PAX1, CTBP2P1, AMD1P2, and DPH3P2, in 200 test samples. The area under the ROC curve (AUC) was 0.974 (95% CI 0.994 - 0.991; P < 0.0001). This indicates that the detection method provided by the present invention has high accuracy and can clearly distinguish cervical pre-cancerous lesions (CIN2 and above) from normal people.

[0059] Figure 4 Comparison table of the detection results of the application experiment of the present invention with the clinical pathological diagnosis results; Using the detection reagents provided by the present invention, namely the PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution, methylation detection was performed on four corresponding target genes, PAX1, CTBP2P1, AMD1P2, and DPH3P2, in 200 test samples. Among 50 samples clinically and pathologically diagnosed as cervical pre-cancerous lesions (CIN2 and above), 47 cases of cervical cancer methylation were detected positive in this application experiment; among 150 samples clinically and pathologically diagnosed as normal cervical exfoliated cell samples, 149 cases of cervical cancer methylation were detected negative in this application experiment.

[0060] By comparing the detection results of the application experiment of the present invention with the clinical pathological diagnosis results, it is concluded that the detection sensitivity (positive coincidence rate) of the detection reagent provided by the present invention for the target gene is 94%, and the specificity (negative coincidence rate) is 99.33%.

[0061] Application experiment logistic regression analysis Substitute the △Ct values of the target genes (PAX1, CTBP2P1, AMD1P2, DPH3P2) obtained from this application experiment (200 test samples) into the logistic regression equation: Y = A0 + A1*X1 + A2*X2 + A3*X3 + A4*X4, where A0, A1, A2, A3, A4 are clinical coefficients, the constant A0 = 6.945, the proportion coefficient of PAX1 A1 = 0.263, the proportion coefficient of CTBP2P1 A2 = -0.439, the proportion coefficient of AMD1P2 A3 = -0.55, the proportion coefficient of DPH3P2 A4 = -0.257; X1, X2, X3, X4 are the △Ct values of PAX1, CTBP2P1, AMD1P2, and DPH3P2 respectively; When Y ≥ 0, it is determined that the sample to be tested is positive for cervical cancer methylation; when Y < 0, it is determined that the sample to be tested is negative for cervical cancer methylation.

[0062] Through the combined detection of cervical cancer and precancerous lesions by analyzing the methylation fitting regression analysis of four target genes, the sensitivity and specificity are much higher than the detection analysis results of a single gene such as PAX1 or CTBP2P1 or AMD1P2 or DPH3P2.

[0063] Example 4 This example is to verify the accuracy of the detection results when applying a cervical cancer detection kit of the present invention, and the following verification experiments are provided specifically: Experimental subjects: 180 cervical exfoliated cell samples, and the clinical pathological diagnosis results (with CIN2 as the clinical diagnosis threshold) are as follows: 140 are normal cervical exfoliated cell samples, and 40 are cervical exfoliated cell samples of cervical lesion patients.

[0064] Using the detection reagents provided by the present invention (PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, DPH3P2 PCR reaction solution), the methylation of four target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in 100 detection samples is detected, and the specific detection is as Figures 5 to 7 shown.

[0065] Figure 5 This is the methylation PCR amplification curve of the target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in a typical cervical cancer exfoliated cell sample in the verification experiment of the present invention; as shown Figure 5 by the amplification map, the Ct values of the PAX1 gene, CTBP2P1 gene, AMD1P2 gene, and DPH3P2 gene in the cervical cancer exfoliated cell sample are all ≤ 32.

[0066] Figure 6 This is the methylation PCR amplification curve of the target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in a typical normal cervical exfoliated cell sample in the verification experiment of the present invention; as shown Figure 6 by the amplification map, the Ct values of the PAX1 gene, CTBP2P1 gene, AMD1P2 gene, and DPH3P2 gene in the normal cervical exfoliated cell sample are all > 32.

[0067] As shown Figure 5 , Figure 6 It can be seen that there are significant differential expressions of the four target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 targeted by the detection reagent of the present invention in cervical cancer exfoliated cell samples and normal cervical exfoliated cell samples. The genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 are all closely related to the progression of cervical cancer.

[0068] Figure 7 This is a comparison table of the detection results of the verification experiment of the present invention and the clinical pathological diagnosis results. Using the detection reagents provided by the present invention (PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, DPH3P2 PCR reaction solution), methylation detection and comprehensive judgment were performed on the four target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 in 140 detection samples. The detection results of the verification experiment are as follows: Among 40 samples clinically and pathologically diagnosed as cervical intraepithelial neoplasia (CIN2 and above), 38 cases were detected as positive for cervical cancer methylation in this verification experiment. Among 140 samples clinically and pathologically diagnosed as normal cervical exfoliated cell samples, 139 cases were detected as negative for cervical cancer methylation in this verification experiment.

[0069] By comparing the detection results of the verification experiment of the present invention with the clinical pathological diagnosis results, it is concluded that: the detection sensitivity (positive coincidence rate) of the detection reagent provided by the present invention for the target gene is 95.00%, that is, the missed diagnosis rate is 5.00%; the specificity (negative coincidence rate) is 99.28%, that is, the misdiagnosis rate is 0.72%; the total correct rate of all 180 samples in the verification set is 98.33%.

[0070] In summary, a cervical cancer detection kit and its application provided by the present invention achieve the methylation combined detection of cervical cancer-related genes PAX1, CTBP2P1, AMD1P2, and DPH3P2, improve the accuracy of cervical cancer gene methylation detection, and provide a guarantee for early screening of cervical cancer.

Claims

1. A cervical cancer detection kit, characterized in that: The kit contains the following test reagents: PAX1 PCR reaction solution, used to detect the methylation level in at least one target region of the PAX1 gene promoter region; CTBP2P1 PCR reaction solution, used to detect the methylation level in at least one target region of the CTBP2P1 gene promoter region; AMD1P2 PCR reaction solution, used to detect the methylation level in at least one target region of the AMD1P2 gene promoter region; DPH3P2 PCR reaction solution, used to detect the methylation level in at least one target region of the DPH3P2 gene promoter region; A positive control substance and a negative control substance, wherein the positive control substance contained in the positive control substance is selected from DNA of cervical adenocarcinoma cells Hela, and the negative control substance is sterile water; The promoter region of the target genes PAX1, CTBP2P1, AMD1P2, and DPH3P2 for methylation detection by the above detection reagents is not strictly limited to the region within the promoter fragment, but the gene fragment in the region near the promoter.

2. A cervical cancer detection kit according to claim 1, characterized in that: The components of the PAX1 PCR reaction solution are as follows: PAX1 forward and reverse primers, PAX1 probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, 10× buffer, dNTP, Taq enzyme and UNG enzyme; the molar concentration ratio of the PAX1 forward and reverse primers and the PAX1 probe is 4:4:2; The components of the CTBP2P1 PCR reaction solution are as follows: CTBP2P1 forward and reverse primers, CTBP2P1 probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, 10× buffer, dNTP, Taq enzyme and UNG enzyme; the molar concentration ratio of the CTBP2P1 forward and reverse primers and the PAX1 probe is 4:4:2; The components of the AMD1P2 PCR reaction solution are as follows: AMD1P2 forward and reverse primers, AMD1P2 probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, 10× buffer, dNTP mixed solution, Taq enzyme and UNG enzyme; the molar concentration ratio of the AMD1P2 forward and reverse primers and the AMD1P2 probe is 4:4:2; The components of the DPH3P2 PCR reaction solution are as follows: AMD1P2 forward and reverse primers, DPH3P2 probe, internal reference ACTB forward and reverse primers, internal reference ACTB probe, 10× buffer, dNTP mixed solution, Taq enzyme and UNG enzyme; the molar concentration ratio of the AMD1P2 forward and reverse primers and the DPH3P2 probe is 4:4:2; The base sequence of the PAX1 forward primer is shown in SEQ ID No. 1, the base sequence of the PAX1 reverse primer is shown in SEQ ID No. 2, and the base sequence of the PAX1 probe is shown in SEQ ID No. 3; The base sequence of the CTBP2P1 forward primer is shown in SEQ ID No. 4, the base sequence of the CTBP2P1 reverse primer is shown in SEQ ID No. 5, and the base sequence of the CTBP2P1 probe is shown in SEQ ID No. 6; The base sequence of the AMD1P2 forward primer is shown in SEQ ID No. 7, the base sequence of the AMD1P2 reverse primer is shown in SEQ ID No. 8, and the base sequence of the AMD1P2 probe is shown in SEQ ID No. 9; The base sequence of the DPH3P2 forward primer is shown in SEQ ID No. 10, the base sequence of the DPH3P2 reverse primer is shown in SEQ ID No. 11, and the base sequence of the DPH3P2 probe is shown in SEQ ID No. 12; The base sequence of the internal reference ACTB forward primer is shown in SEQ ID No. 13, the base sequence of the internal reference ACTB reverse primer is shown in SEQ ID No. 14, and the base sequence of the internal reference ACTB probe is shown in SEQ ID No.

15.

3. A cervical cancer detection kit according to claim 1, characterized in that: The Taq enzyme contained in the PAX1 PCR reaction solution, the CTBP2P1 PCR reaction solution, the AMD1P2 PCR reaction solution, and the DPH3P2 PCR reaction solution is a hot start Taq enzyme, and the UNG enzyme contained is uracil-N-glycosylase.

4. Application of a cervical cancer detection kit, characterized in that: Based on fluorescence quantitative PCR technology, PAX1 PCR reaction solution, CTBP2P1 PCR reaction solution, AMD1P2 PCR reaction solution, and DPH3P2 PCR reaction solution were used to perform joint methylation detection on four genes closely related to the progression of cervical cancer, namely PAX1, CTBP2P1, AMD1P2, and DPH3P2.

Images