Biological substance treatment method, reaction detection method, biological substance treatment device, and reaction detection device

By using a flow cell and a microcavity array device in digital bioassay, combined with the phase separation properties of dextran and polyethylene glycol aqueous solution, the problems of micro-compartment size limitation and complex operation in the prior art are solved, and efficient concentration and high sensitivity detection of biological matter are achieved.

CN120153086APending Publication Date: 2025-06-13THE JAPAN SCI & TECH AGENCY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202380073531.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-10-18
Filing Date
2023-10-17
Publication Date
2025-06-13

AI Technical Summary

Technical Problem

Existing digital bioassays require increasing the total number or volume of reactors when improving detection sensitivity, but physical constraints limit the size of micro-cells, and the off-chip enrichment step requires additional equipment, which is complex in operation.

Method used

Using a biological matter treatment method, the biological matter is concentrated in the micro cavity through a flow cell and a micro cavity array device, and the solvent phase separation is performed using a dextran and polyethylene glycol aqueous solution with easy phase separation properties to keep the biological matter in the micro cavity.

Benefits of technology

Efficient maintenance and concentration of biological matter in micro-cavities of tiny sizes is achieved, operation is simplified, detection sensitivity is improved, and the use of additional equipment is avoided.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120153086A_ABST
    Figure CN120153086A_ABST
Patent Text Reader

Abstract

In this biological substance treatment method, a flow cell (1) is prepared, said flow cell (1) being provided with a microcavity array device (1) having a plurality of microcavities (14) each of which is 1 nanoliter or less, and a lid main body (21) that defines a flow path (40) that communicates with openings of the microcavities (14) and is provided so as to communicate with the plurality of microcavities (14). Next, DEX and PEG, both of which are aqueous and which are phase-separated when left to stand at room temperature, are prepared. Wherein the DEX has the property of phase separation to the microcavity 14 side, and has the property of distribution of the biological substance to the DEX more preferentially than PEG. Then, the biological substance is mixed in PEG, and DEX is introduced into the flow path 40 such that the DEX is filled in the microcavity 14 and the flow path 40. Next, PEG is caused to flow into the flow path 40 to flush away the remaining DEX, while the DEX is brought into contact with PEG, thereby concentrating the biological substance in the DEX within the microcavity 14.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for processing biological substances, a method for detecting reactions, a device for processing biological substances, and a device for detecting reactions. Background Art

[0002] Methods and devices for detecting reactions of biological substances are being developed in various fields such as academic research and medicine. Digital biometrics has emerged as a method for binarizing signals after encapsulating enzymes and enzyme-labeled molecules into microcompartments and performing quantification with single-molecule detection sensitivity. Single-molecule enzyme assays with microcompartmentalization were first reported in the 1960s, but quantitative digital biometrics became possible only after compartments with uniform shapes on the micron scale could be generated by microfabrication techniques. To date, the fabrication of various forms of microcompartments such as droplets formed by flow focusing and hydrogel particle template droplets has been reported. With the popularization of these microcompartmentalization techniques, the digitization of various enzyme assays has become possible, and the measurement of not only simple enzymes but also nucleic acids, antigens, viruses, membrane transport carriers, etc. has become possible.

[0003] The greatest feature of digital biometric methods, in addition to high detection sensitivity, lies in the quantitativeness that can easily determine the concentration of target molecules over multiple orders of magnitude. Therefore, digital immunoassays (digital ELISA), etc., digitalized biometric assays are highly anticipated as next-generation diagnostic tests.

[0004] In digital biometric assays, a chip with multiple microspaces (microcavities) formed is used, and the microcavities are used as reaction sites (reactors) to detect biological reactions. The limit of detection (LOD) of digital biometric assays is limited by the total number of reactors × the volume of each reactor. Since 3 molecules are required to detect 1 or more positive reactors with a detection probability of 95% or more from all reactors, the concentration equivalent to 3 molecules per unit total reactor volume becomes the LOD of a practical device. A simple method for improving the LOD is to increase the total number of reactors or the volume of the reactors. However, there are physical limitations to the size of microcompartments in array-type microreactors or microdroplet devices.

[0005] Therefore, when the required detection sensitivity is higher than the theoretical LOD defined based on the total capacity of the reactor, an off-chip concentration step is often adopted as a pretreatment in digital bioassays. However, such an off-chip concentration step necessarily requires additional steps using equipment such as solution handling, centrifuges, or solution dispensing devices. On the other hand, although on-chip concentration using dielectrophoresis or magnetic fields has also been reported, these methods require external equipment such as magnets or power supplies.

[0006] The present inventors have hitherto developed a method for detecting minute substances contained in a plurality of receptacles formed separately from each other (for example, refer to Patent Document 1). In this document, it is described that by introducing a solvent containing minute substances into the space between the lower layer portion and the upper layer portion of the receptacle and introducing a gas into this space, droplets of the solvent containing minute substances are formed in the receptacle. The receptacle has a bottom surface diameter of about 0.1 μm to 10 μm, a height (depth) of 0.1 μm to 10 μm, and a volume of about 1 zeptoliter to 1 attoliter.

[0007] In addition, a technique for multiplexing homogeneous immunoassays using an aqueous two-phase system is also known (for example, refer to Non-Patent Document 1). In this document, a micro-patterned aqueous two-phase system (ATPS) formed between polyethylene glycol (PEG) and dextran (DEX) as phase-separating polymers is utilized. A custom 96-well microplate for multiplexed ATPS-AlphaLISA is used. In the ATPS-multiplexed homogeneous assay, an ATPS formed from 18 wt% PEG (Mw. 35 kDa) and 18 wt% DEX (Mw. 10 kDa) is used. The microplate is a microplate in which white individual DEX micro-pots (2.5 mm × 2.5 mm × 2.5 mm) are arranged on a plate substrate (well size 8 mm × 8 mm, height 11.5 mm). Then, in the presence of the ATPS, with the detection antibody, receptor particles, and donor particles confined in the DEX droplets, the antigen diffuses from the bulk PEG phase into the DEX droplets.

[0008] This document describes that receptor particles and biotinylated detection antibodies against 4 antigens (CXCL10, CXCL9, IL-8, IL-6) were prepared using 18% DEX, and the PEG-antigen mixture was dispensed into a 384-well microplate so that each well contained about 2 μl of a standard sample and 8 μl of PEG, etc. (page 181). In addition, this document also describes that 100 μL of the PEG-antigen mixture was dispensed into a common PEG well, and the DEX solution was separately dispensed into 4 DEX micro-pots using a multi-channel pipette, etc.

[0009] Prior art documents

[0010] Patent documents

[0011] Patent Document 1: International Publication No. WO 2018 / 181488 (Claim 1, Paragraph 0022, etc.)

[0012] Non-patent documents

[0013] Non-patent Document 1:

[0014] Arlyne B. Simon et al.; "Aqueous two-phase systems enable multiplexing of homogeneous immunoassays". May 2014, TECHNOLOGY 2(2): 176 - 184, DOI: 10.1142 / S2339547814500150 Summary of the invention

[0015] Technical problems to be solved by the invention

[0016] In Non-patent Document 1, the size of the micro-wells of the microplate is 2.5 mm × 2.5 mm × 2.5 mm (i.e., 2.5 μl), and only 4 wells are provided. From this, it can be understood that the purpose of the microplate in this document is not for digital bioassay that holds biomolecules composed of one or several molecules in multiple recesses and binarizes reaction signals.

[0017] In addition, in the method of this document, first, the PEG antigen mixture is dispensed into a common PEG recess, and then the DEX solution containing receptor particles and detection antibodies is dispensed into the DEX micro-wells using a multi-channel pipette. When PEG and DEX are mixed in this way, when PEG or DEX exceeds the critical concentration, PEG spontaneously phase-separates to the upper layer and DEX phase-separates to the lower layer. Therefore, when the DEX solution is directly dispensed into the DEX micro-wells with a pipette, the mixing of PEG and DEX becomes insufficient, and the reaction between the antigen in PEG and the detection reagent in DEX cannot be fully carried out, making it difficult to detect the antigen. In addition, in this document, since a multi-channel pipette is used to dispense the DEX solution into each micro-well, the operation is cumbersome.

[0018] An object of the present invention is to provide a method for processing a biological substance and a device for processing a biological substance that can hold a biological substance at a high concentration in a plurality of microcavities, each having a minute size of 1 nanoliter or less (hereinafter referred to as a microchamber), by a simple operation in digital biometrics. Another object of the present invention is to provide a method for detecting a reaction of a biological substance with high sensitivity and a device for detecting a reaction by such a simple operation.

[0019] Method for Solving Technical Problems

[0020] One embodiment of the present invention is described as follows.

[0021] [1] A method for processing a biological substance, which is a method for holding and / or concentrating a biological substance, characterized by comprising:

[0022] A flow cell preparation step of preparing a flow cell having a microchamber array device and a lid, the microchamber array device having a plurality of microchambers, each of which is a recess with one end open and has a volume of 1 nanoliter or less, and the lid communicating with the opening of the microchamber and defining a flow path provided in common for the plurality of microchambers;

[0023] A solvent preparation step of preparing a first solvent and a second solvent, both of which are aqueous and phase-separate when left standing at room temperature, the first solvent and the second solvent having the property that when phase separation occurs in the region surrounded by the microchamber and the flow path of the flow cell, the first solvent separates toward the microchamber side, and the property that the biological substance is preferentially partitioned into the first solvent compared to the second solvent;

[0024] A mixing step of mixing the biological substance in the first solvent and / or the second solvent;

[0025] A first inflow step of allowing either the first solvent or the second solvent to flow into the flow path so that the solvent fills the microchamber and the flow path;

[0026] A second inflow step of allowing the other of the first solvent and the second solvent to flow into the flow path so that the first solvent separates toward the microchamber side and the second solvent separates toward the flow path side while preventing the biological substance contained in the first solvent in the microchamber from diffusing into the second solvent and holding it in the microchamber, and / or causing the biological substance contained in the second solvent to move into the first solvent in the microchamber and be concentrated.

[0027] In one embodiment of the present invention, there are provided a plurality of microcavities each having a volume of 1 nanoliter or less, so that it can be suitably used for digital bioassay for retaining a single molecule of a biological substance and performing binarization. Further, after flowing either the first solvent or the second solvent into the flow path as a precursor solvent and retaining it in the microcavity, the other solvent of the first solvent and the second solvent is caused to flow into the flow path to flush out the precursor solvent remaining in the flow path. Therefore, the solvent can be retained in the microcavity by a single simple operation without using a pipette or the like. Further, since the first solvent and the second solvent are sufficiently in contact with each other, the biological substance is concentrated in the first solvent in the microcavity at a high concentration.

[0028] [2] The biological substance treatment method according to [1] above, characterized in that the first solvent and the second solvent are selected from the combinations shown in Nos. 1 to 12 of Table 1 below:

[0029]

Table 1

[0030]

[0031]

[0032] In this way, the solvent can be selected from a plurality of combinations of the first solvent and the second solvent.

[0033] [3] The biological substance treatment method according to [2] above, characterized in that the first solvent is an aqueous solution of dextran and the second solvent is an aqueous solution of polyethylene glycol.

[0034] In this way, by using an aqueous solution of dextran and an aqueous solution of polyethylene glycol having properties of being easily phase-separable, the first solvent (dextran) can be retained in the microcavity.

[0035] [4] The biological substance treatment method according to [1] above, characterized in that it includes a label attachment step in which a label that can improve the partitioning property with respect to the first solvent is attached to the biological substance.

[0036] In this way, by attaching a label that can improve the partitioning property with respect to the first solvent to the biological substance, even a biological substance having a low partitioning property with respect to the first solvent can be easily partitioned and retained in the first solvent.

[0037] [5] The biological substance treatment method according to [4] above, characterized in that the label is selected from the group consisting of a dextran-binding domain derived from "Leuconostoc mesenteroides" which is a lactic acid bacterium, dextran, a dextran-like molecular polymer, DNA, RNA, and their chemically modified molecules, and a nucleic acid-like molecular polymer.

[0038] By using such a tag, the partitioning of the biological substance into the first solvent (especially dextran) can be improved.

[0039] [6] The biological substance treatment method as described in [1] above is characterized in that, after the second inflow step, it further includes a sealed solvent inflow step in which a sealed solvent is allowed to flow into the flow path to flush out the solvent remaining in the flow path from the flow path.

[0040] In this way, by using the sealed solvent to seal the flow path, the first solvent can be prevented from flowing out of the microcavity.

[0041] [7] A reaction detection method includes a detection step of detecting the reaction of the biological substance that has been retained and / or concentrated by the biological substance treatment method as described in [1] above.

[0042] According to this embodiment, the reaction of the biological substance concentrated at a high concentration in the microcavity can be detected with high sensitivity through a simple operation.

[0043] [8] The reaction detection method as described in [7] above is characterized in that

[0044] The biological substance at least includes:

[0045] Target RNA,

[0046] crRNA, which contains a sequence complementary to a specific region of the target RNA,

[0047] Cas13, which forms a complex with the crRNA and becomes an activated complex and cleaves the target RNA when the crRNA is used as a guide RNA to bind to the target RNA,

[0048] A first RNA probe, which has a sequence that can be cleaved by the activated complex and is bound to a first fluorescent dye, and emits the first fluorescence when cleaved by the activated complex or a sequence-nonspecific ribonuclease, and

[0049] A second RNA probe, which does not have a sequence that can be cleaved by the activated complex and is bound to a second fluorescent dye that emits a fluorescence distinguishable from the first fluorescent dye, and emits the second fluorescence when cleaved by the sequence-nonspecific ribonuclease, and

[0050] The detection step includes:

[0051] A positive measurement step of measuring the microcavity that emits only the first fluorescence as a positive signal,

[0052] The suspicious positive measurement step measures the microchambers emitting both the first fluorescence and the second fluorescence as suspicious positive signals caused by the sequence-nonspecific ribonuclease.

[0053] Thus, by using at least two kinds of probes, it is possible to distinguish positive signals and suspicious positive signals and detect the target RNA more accurately.

[0054] [9] A biological substance processing device is a biological substance processing device for holding and / or concentrating biological substances, characterized by comprising:

[0055] A flow cell, which comprises: a microchamber array device having a plurality of microchambers, the microchambers being recesses with one end open and each being 1 nanoliter or less; a lid, which communicates with the openings of the microchambers and defines a flow path that can be provided in common with the plurality of microchambers,

[0056] The first solvent and the second solvent are both aqueous solvents that phase-separate when left standing at room temperature, have the property that when phase separation occurs in the region surrounded by the microchambers and the flow path of the flow cell, the first solvent separates toward the microchamber side, and have the property that the biological substance is preferentially partitioned into the first solvent compared to the second solvent,

[0057] A unit for mixing the biological substance in the first solvent and / or the second solvent,

[0058] A first inflow unit that allows either the first solvent or the second solvent to flow into the flow path so that the solvent fills the microchambers and the flow path,

[0059] A second inflow unit that allows the other solvent of the first solvent and the second solvent to flow into the flow path, causing the first solvent to phase-separate toward the microchamber side and the second solvent to phase-separate toward the flow path side, while preventing the biological substance contained in the first solvent in the microchambers from diffusing into the second solvent and keeping it in the microchambers, and / or causing the biological substance contained in the second solvent to move into and concentrate in the first solvent in the microchambers.

[0060] One embodiment of the present invention has a plurality of microcavities each of 1 nanoliter or less, so it can be suitably used for digital bioassays that hold and binarize a single molecule of a biological substance. Further, after flowing either the first solvent or the second solvent into the flow path as a preceding solvent and holding it in the microcavity, the other of the first solvent and the second solvent is flowed into the flow path to flush out the remaining preceding solvent in the flow path. Therefore, the solvent can be held in the microcavity by a single simple operation without using a pipette or the like. Further, since the first solvent and the second solvent are in sufficient contact, the biological substance is concentrated in the first solvent in the microcavity at a high concentration.

[0061]

[10] The biological substance processing device as described in [9] above, wherein the first solvent and the second solvent are selected from the combinations shown in Nos. 1 to 12 of Table 2 below:

[0062]

Table 2

[0063]

[0064] In this way, the solvent can be selected and used from various combinations of the first solvent and the second solvent.

[0065]

[11] The biological substance processing device as described in

[10] above, wherein the first solvent is an aqueous solution of dextran and the second solvent is an aqueous solution of polyethylene glycol.

[0066] In this way, by using an aqueous solution of dextran and an aqueous solution of polyethylene glycol, which have the property of being easily phase-separated, the first solvent (dextran) can be held in the microcavity.

[0067]

[12] The biological substance processing method as described in [9] above, wherein the biological substance has a label that can improve the partitionability to the first solvent.

[0068] In this way, by attaching a label that can improve the partitionability to the first solvent to the biological substance, even a biological substance that originally has low partitionability to the first solvent can be easily partitioned and held in the first solvent.

[0069]

[13] The biological substance processing device as described in

[12] above, wherein the label is selected from the group consisting of a dextran-binding domain derived from "Leuconostoc mesenteroides" which is a lactic acid bacterium, dextran, a dextran-like molecular polymer, DNA, RNA, and their chemically modified molecules, and a nucleic acid-like molecular polymer.

[0070] By using such a label, the partitionability of the biological substance to the first solvent (especially dextran) can be improved.

[0071]

[14] The biological substance processing device as described in [9] above is characterized by further comprising a sealing solvent.

[0072] In this way, by using the sealing solvent to seal the flow path, the outflow of the first solvent from the microcavity can be prevented.

[0073]

[15] A reaction detection device is characterized by further comprising a detection unit for detecting the reaction of the biological substance after being held and / or concentrated by using the biological substance processing device as described in [9] above.

[0074] According to an embodiment of the present invention, the reaction of the biological substance concentrated at a high concentration in the microcavity can be detected with high sensitivity through a simple operation.

[0075]

[16] The reaction detection device as described in

[15] above is characterized in that

[0076] the biological substance at least comprises:

[0077] target RNA,

[0078] crRNA, which contains a sequence complementary to a specific region of the target RNA,

[0079] Cas13, which forms a complex with the crRNA and becomes an activated complex and cleaves the target RNA when the crRNA is used as a guide RNA to bind to the target RNA,

[0080] a first RNA probe, which has a sequence that can be cleaved by the activated complex and is bound with a first fluorescent pigment, and emits the first fluorescence when cleaved by the activated complex or a sequence-nonspecific ribonuclease,

[0081] a second RNA probe, which does not have a sequence that can be cleaved by the activated complex and is bound with a second fluorescent pigment that can be distinguished from the first fluorescent pigment, emits the second fluorescence when cleaved by the sequence-nonspecific ribonuclease, and

[0082] the detection unit comprises:

[0083] a positive measurement unit that measures the microcavity emitting only the first fluorescence as a positive signal,

[0084] a suspicious positive measurement unit that measures the microcavity emitting both the first fluorescence and the second fluorescence as a suspicious positive signal caused by the sequence-nonspecific ribonuclease.

[0085] Thus, by using at least two kinds of probes, positive signals and suspicious positive signals can be identified and the target RNA can be detected more accurately.

[0086]

[17] A biological substance processing device is a biological substance processing device that uses a flow cell to hold and / or concentrate biological substances. The flow cell includes a microcavity array device and a flow path. The microcavity array device has a plurality of microcavities. Each microcavity is a recess with an open end and has a volume of 1 nanoliter or less. The flow path communicates with the opening of the microcavity and is provided in common with the plurality of microcavities. It is characterized by comprising:

[0087] The first solvent and the second solvent are both aqueous solvents that phase-separate when left standing at room temperature. They have the property that when phase separation occurs in the region surrounded by the microcavities and the flow path of the flow cell, the first solvent separates toward the microcavity side, and they have the property that the biological substance is preferentially partitioned into the first solvent compared to the second solvent.

[0088] A unit for mixing the biological substance in the first solvent and / or the second solvent.

[0089] A first inflow unit that allows either the first solvent or the second solvent to flow into the flow path so that the solvent fills the microcavities and the flow path.

[0090] A second inflow unit that allows the other of the first solvent and the second solvent to flow into the flow path, causing the first solvent to phase-separate toward the microcavity side and the second solvent to phase-separate toward the flow path side, while preventing the biological substance contained in the first solvent in the microcavities from diffusing into the second solvent and keeping it in the microcavities, and / or causing the biological substance contained in the second solvent to move into the first solvent in the microcavities and be concentrated.

[0091] [Other technical feature 1] A reaction detection method for detecting target RNA, characterized by comprising:

[0092] A step of preparing the following substances:

[0093] Target RNA

[0094] crRNA, which contains a sequence complementary to a specific region of the target RNA

[0095] Cas13, which forms a complex with the crRNA and becomes an activated complex and cleaves the target RNA when the crRNA is used as a guide RNA to bind to the target RNA.

[0096] A first RNA probe, which has a sequence capable of being cleaved by the activation complex and is bound to a first fluorescent pigment, emits the first fluorescence when cleaved by the activation complex or a sequence-nonspecific ribonuclease.

[0097] A second RNA probe, which does not have a sequence capable of being cleaved by the activation complex and is bound to a second fluorescent pigment that emits fluorescence distinguishable from the first fluorescent pigment, emits the second fluorescence when cleaved by the sequence-nonspecific ribonuclease;

[0098] A reaction step, in which a cleavage reaction of the target RNA by the complex and an accompanying cleavage reaction of the first RNA probe are carried out, and / or a cleavage reaction of the first RNA probe and the second RNA probe by a sequence-nonspecific ribonuclease contained in the environment is carried out;

[0099] A positive measurement step, in which only the case of emitting the first fluorescence is measured as a positive signal; and

[0100] A suspicious positive measurement step, in which the case of emitting both the first fluorescence and the second fluorescence is measured as a suspicious positive signal caused by the sequence-nonspecific ribonuclease.

[0101] 〔Other technical feature 2〕A reaction detection device for detecting a target RNA, characterized by comprising:

[0102] The target RNA,

[0103] A crRNA, which contains a sequence complementary to a specific region of the target RNA,

[0104] Cas13, which forms a complex with the crRNA and becomes an activation complex to cleave the target RNA when the crRNA is used as a guide RNA to bind to the target RNA,

[0105] A first RNA probe, which has a sequence capable of being cleaved by the activation complex and is bound to a first fluorescent pigment, emits the first fluorescence when cleaved by the activation complex or a sequence-nonspecific ribonuclease.

[0106] A second RNA probe, which does not have a sequence capable of being cleaved by the activation complex and is bound to a second fluorescent pigment that emits fluorescence distinguishable from the first fluorescent pigment, emits the second fluorescence when cleaved by the sequence-nonspecific ribonuclease, and,

[0107] A reaction unit that performs the cleavage reaction of the target RNA caused by the complex and the accompanying cleavage reaction of the first RNA probe, and / or performs the cleavage reaction of the first RNA probe and the second RNA probe caused by a sequence-nonspecific ribonuclease contained in the environment.

[0108] A positive measurement unit that measures the case of emitting only the first fluorescence as a positive signal.

[0109] A suspicious positive measurement step that measures the case of emitting both the first fluorescence and the second fluorescence as a suspicious positive signal caused by the sequence-nonspecific ribonuclease.

[0110] Effects of the Invention

[0111] According to the present invention, it is possible to provide a biological substance processing method and a biological substance processing and holding device that can hold biological substances in a plurality of microcavities by simple operations even in microcavities with a minute size of 1 nanoliter or less each in digital bioassays. In addition, according to the present invention, it is possible to provide a reaction detection method and a reaction detection device that can detect the reaction of biological substances with high sensitivity by such simple operations. Brief Description of the Drawings

[0112] Figure 1 It is an exploded perspective view showing an embodiment of a flow cell used in the present invention.

[0113] Figure 2 It is a side sectional view of the above flow cell.

[0114] Figure 3 It is a side sectional view showing the step of concentrating biological substances using the above flow cell.

[0115] Figure 4 It is a side sectional view showing the step of concentrating biological substances using the above flow cell.

[0116] Figure 5 It is a diagram for explaining a method for detecting a target RNA using Cas13.

[0117] Figure 6 It is an example of an image obtained by measuring the fluorescence of a flow cell in the above system using Cas13.

[0118] Figure 7 It is a diagram showing the outline and results of an experiment of a femtoliter DEX droplet array system in an example.

[0119] Figure 8It is a diagram showing the diameter and volume of the DEX reactor formed in the above-mentioned flying microcavity array.

[0120] Figure 9 It is a diagram showing a conic curve and a presumed connection line.

[0121] Figure 10 It is a diagram showing the results of digital bioassay of EcALP performed by the DEX droplet system of the embodiment.

[0122] Figure 11 It is a diagram showing the digital RNA counting experiment using Cas13 performed by the DEX droplet system.

[0123] Figure 12 It is a chart showing the experimental results of the dual reporter system that suppresses suspicious positive signals.

[0124] Figure 13 It is a diagram showing a model of the concentration factor in digital determination using DEX droplets.

[0125] Figure 14 It is a diagram showing the incubation period dependence of the concentration of ALP-DBD.

[0126] Figure 15 It is a diagram showing the experimental results of the reactor for forming dextran in a microcavity with the ratio of diameter to depth changed.

[0127] Figure 16 It is a diagram showing the outline and results of an antibody concentration experiment using a tag that can increase the distribution ratio to DEX.

[0128] Figure 17 It is a diagram showing the partition coefficients of ALP and ALP-DBD partitioning into ATPS for DEX / PEG.

[0129] Figure 18 It is a diagram showing the results of an experiment in which a biological substance is placed only in DEX when the first solvent is DEX and the second solvent is PEG.

[0130] Figure 19 It is a diagram showing the results of an experiment using PEG as the first solvent and DEX as the second solvent.

[0131] Figure 20 It is a diagram showing the results of an experiment in which the first solvent is PEG and the second solvent is phosphoric acid.

[0132] Figure 21 It is a conceptual diagram explaining the system for concentrating target DNA by DBD-capture DNA.

[0133] Explanation of reference numerals

[0134] 1 Flow cell

[0135] 10 Base

[0136] 11 Microcavity array device

[0137] 12 Bottom surface

[0138] 13 Side surface

[0139] 14 Microcavity

[0140] 20 Cover

[0141] 21 Cover body

[0142] 22 Solvent inlet

[0143] 23 Solvent outlet

[0144] 24 Chip

[0145] 30 Spacer

[0146] 40 Flow path

[0147] 50 First solvent (aqueous dextran solution)

[0148] 60 Second solvent (aqueous polyethylene glycol solution)

[0149] 70 Sealing solvent (oil)

[0150] E Enzyme

[0151] S Substrate

[0152] P Product Detailed implementation manners

[0153] 1. Biomaterial processing method

[0154] Hereinafter, a biomaterial processing method according to an embodiment of the present invention will be described. The present invention is a biomaterial processing method for holding and / or concentrating a biomaterial, and includes a flow cell preparation step, a solvent preparation step, a mixing step, and a first inflow step. Hereinafter, each step will be described in order. It should be noted that in this embodiment, although examples of the biomaterial are the enzyme E and the substrate S, the present invention is not limited thereto, and various biomaterials can be used.

[0155] (1) Flow cell preparation step

[0156] The flow cell preparation step is a step of preparing a flow cell that includes a plurality of microcavities each having a volume of 1 nanoliter or less, and a flow path for the solvent to flow located above the plurality of microcavities.

[0157] Based on Figure 1 and Figure 2 , the flow cell 1 used in this embodiment will be described. Figure 1 is an exploded perspective view of the flow cell 1, Figure 2 is a side sectional view of the flow cell 1.

[0158] As Figure 1 shown, the flow cell 1 is a chip composed of a base 10, a lid 20, and a spacer 30. The base 10 is composed of a microcavity array device 11, and on the surface of the microcavity array device 11, a plurality of microcavities 14 as minute spaces are provided. The microcavity array device 11 is a plate-like member (substrate) formed of glass, acrylic resin, or the like. The microcavity 14 is a recess formed on the surface of the microcavity array device 11 and having one end open. As Figure 2 shown, the microcavity 14 is a space portion defined by a bottom surface 12 and a side surface 13. Each of the microcavities 14 has a volume of 1 nanoliter or less, and as described below, accommodates a first solvent and concentrates a biological substance in the first solvent. It should be noted that in the case of detecting the reaction of 1 molecule of a biological substance by digital biometry, although it also depends on the molecular weight of the biological substance, etc., the volume of the microcavity 14 is generally 10 picoliters or less, preferably 1 picoliter or less, more preferably 100 femtoliters or less, and particularly preferably 50 femtoliters or less. There is no particular limitation on the lower limit of the microcavity 14, and it is preferably above zeptoliter, more preferably above 1 attoliter. It should be noted that when a biological substance or the like reacts inside the microcavity, the microcavity becomes a reactor, so in this specification, the microcavity is sometimes also referred to as a "reactor". The case where a biological substance does not react in the microcavity, for example, the case where only the biological substance is concentrated in the microcavity without reacting and the case of preventing the leakage of the biological substance from the microcavity, are also included in the present invention. In addition, when a biological substance reacts in such a reactor, the flow cell can also be called a "reactor chip". In addition, in a flat chip such as this embodiment, the microcavity can also be called a "well". In addition, the microcavity 14 is not limited to the shape of a hole as in this embodiment, and may be other shapes such as a groove. In addition, as long as it can perform aqueous bilayer separation and form a liquid shape, it is also included as a microcavity.

[0159] It should be noted that these figures are schematic diagrams showing the flow cell 1, and for easy understanding, a figure showing a reduced number of microcavities 14 is shown. In fact, in the flow cell 1 used in experiments, etc., the number of microcavities 14 is about 500,000 to 5,000,000, for example, 1,000,000.

[0160] The microcavity 14 can be formed on the surface of the microcavity array device 11 by using microfabrication techniques such as photolithography. The processing method of photolithography is to prepare the microcavity array device 11 coated with a photoresist such as a fluorine-based resin, dispose a photomask having a target pattern thereon, and irradiate ultraviolet light to transfer the pattern of the photomask onto the photoresist. Thereafter, the photoresist is etched using an etching solution to fabricate the microcavity array device 11 having the shape of the target pattern formed thereon.

[0161] The microcavity 14 is preferably cylindrical as shown in the figure. In addition, the diameter of the microcavity 14 (the diameter of the bottom surface 12 in the figure) is in the range of 1 to 100 μm, preferably in the range of 5 to 20 μm. Further, the depth of the microcavity 14 (the height of the side surface 13) is in the range of 1 to 100 μm, preferably in the range of 5 to 20 μm. From the viewpoint of processing accuracy, the ratio of the microcavity 14 expressed as "diameter (the diameter of the bottom surface 12 in the figure) / depth (the height of the side surface 13)" is preferably 5 or less, more preferably 2 or less. In addition, from the viewpoint of the retention of the solvent in the microcavity 14, this ratio is preferably 1.5 or less. If this ratio is greater than 1.5, the depth becomes shallower compared to the diameter of the microcavity 14, and it is difficult to accommodate the solvent (dextran aqueous solution 50). In addition, if this ratio is greater than 1.5, the dextran aqueous solution 50 in the microcavity 14 will be washed away by other solvents (polyethylene glycol aqueous solution 60), and it is difficult to retain the dextran aqueous solution 50 in the microcavity 14. The lower limit of this ratio is not particularly limited, and is preferably 0.1 or more, more preferably 0.5 or more.

[0162] As Figure 1 shown, the cover 20 is composed of a cover body 21, a solvent inlet 22, and a solvent outlet 23. The cover body 21 is a plate-like member made of glass, resin, or the like. On a part of the cover body 21, a solvent inlet 22 penetrating from the upper surface to the lower surface of the cover body 21 is provided. In addition, on another part of the cover body 21, a solvent outlet 23 penetrating from the upper surface to the lower surface of the cover body 21 is provided. They are openings for allowing the solvent to flow in and out, respectively.

[0163] The spacer 30 is a component disposed between the base 10 and the lid 20 and is used to seal the base and the lid over the entire side. The spacer 30 has a shape in which its outer edge portion is square when viewed from above and an opening portion is formed inside the outer edge. The spacer 30 is made of double-sided tape, rubber, or the like. And a flow path 40 is formed in a portion surrounded by the upper surface of the microcavity array device 11 of the base 10, the lower surface of the lid body 21 of the lid 20, and the inner wall surface of the spacer 30. The flow path 40 forms a closed space without communicating with the outside except for the solvent inlet 22 and the solvent outlet 23. In addition, the flow path 40 is a space portion that communicates with the openings of the concave portions constituting the microcavities 14, communicates with all of the plurality of microcavities 14, and is a space portion provided in common with these plurality of microcavities 14. It should be noted that in order to prevent the attachment of biological substances, the surfaces of the base 10 and the lid 20 facing the flow path 40 can be surface-treated in advance with a blocking liquid such as a surfactant.

[0164] The volume of the flow path 40 can be appropriately set according to the properties of the solvent or biological substances, etc. For example, it is in the range of 1 to 100 μl, preferably in the range of 5 to 50 μl, and more preferably in the range of 7 to 8 μl. The ratio of the total volume of the plurality of microcavities 14 to the volume of the flow path 40 can be appropriately set, but is preferably in the range of 1:50 to 1:200, and particularly preferably about 1:100. By setting the above volume ratio within this range, droplets can be efficiently formed in the microcavities 14.

[0165] (2) Solvent preparation step

[0166] The solvent preparation step is a step of preparing two solvents (a first solvent and a second solvent) that are both aqueous. These solvents, when left standing at room temperature (30 °C), will spontaneously phase-separate when the critical concentration is exceeded respectively. In addition, it has the property that biological substances are preferentially distributed into the first solvent compared to the second solvent. In other words, biological substances move more easily into the first solvent than the second solvent. More specifically, it means that when the first solvent and the second solvent are mixed with biological substances, the first solvent and the second solvent undergo phase separation, and when the biological substances reach the distribution equilibrium, the concentration of biological substances in the first solvent is higher compared to the concentration of biological substances in the second solvent. In other words, the "distribution coefficient" defined by the following formula is greater than 1.

[0167] Distribution coefficient = Concentration of biological substances dissolved in the first solvent when reaching distribution equilibrium / Concentration of biological substances dissolved in the second solvent

[0168] Among them, the above-mentioned partition coefficient is preferably 10 or more, more preferably 50 or more. The higher the partition coefficient, the easier it is for the biological substance to preferentially move into the first solvent and concentrate in the first solvent in the state where the first solvent is separated from the first solvent phase. It should be noted that in this specification, the property of preferentially partitioning a biological substance into one of two solvents undergoing phase separation is sometimes expressed as "partitionability".

[0169] It should be noted that in the case where the specific gravity of the first solvent is greater than the specific gravity of the second solvent, through phase separation, the first solvent separates into the lower layer and the second solvent separates into the upper layer.

[0170] The first solvent is preferably an aqueous dextran solution, and the second solvent is preferably an aqueous polyethylene glycol solution. An aqueous dextran solution is a solution in which dextran is dissolved in a good solvent such as water, methanol, ethanol, benzene, or chloroform. Similarly, an aqueous polyethylene glycol solution is a solution in which polyethylene glycol is dissolved in a good solvent such as water, methanol, ethanol, benzene, or chloroform. In the present embodiment, an aqueous dextran (DEX) solution is used as the first solvent, and an aqueous polyethylene glycol (PEG) solution is used as the second solvent.

[0171] The weight average molecular weight (MW) of the dextran used in the first solvent can be appropriately set, for example, in the range of 100,000 to 1,000,000, preferably in the range of 300,000 to 700,000. In the case where the dextran-binding domain derived from "Leuconostoc mesenteroides" (ロイコノストック·メセンテロイデス), which is a lactic acid bacterium, is used as a tag and attached to a biological substance as described below, the dextran is preferably derived from this lactic acid bacterium. The concentration of the dextran contained in the aqueous dextran solution 50 can be appropriately set, for example, in the range of 1 to 10 wt% (w / w), more preferably in the range of 4 to 6 wt% (w / w).

[0172] The weight average molecular weight (MW) of the polyethylene glycol used in the second solvent can be appropriately set, for example, in the range of 10,000 to 100,000, preferably in the range of 20,000 to 50,000. The concentration of the polyethylene glycol contained in the aqueous polyethylene glycol solution 60 can be appropriately set, for example, it can be exemplified in the range of 1 to 10% (w / w), particularly more preferably in the range of 4 to 6% (w / w). The aqueous dextran solution 50 and the aqueous polyethylene glycol solution 60 of the present embodiment exceed the critical concentration.

[0173] It should be noted that the first solvent and the second solvent in this embodiment can use the following combinations. It should be noted that from the top to "polyU aqueous solution (aqueous solution of polyuridylic acid)" in the following table is segregative liquid-liquid phase separation (LLPS), and the ones below in the table are coacervation LLPS (Liquid-Liquid Phase Separation). In such coacervation LLPS, it includes not only the nucleic acids or natural mutant proteins exemplified in No. 1 to 12 in the following table, but also various polymers.

[0174]

Table 3

[0175]

[0176] (3) Mixing step

[0177] In the mixing step, the biological substance is mixed into the first solvent and / or the second solvent. That is, the biological substance can be mixed into the first solvent, or into the second solvent, or into both solvents. In this embodiment, instead of mixing the biological substance into dextran as the first solvent, the enzyme E and the substrate S as the biological substances are mixed into polyethylene glycol as the second solvent and used.

[0178] (4) First inflow step

[0179] In this step, the first solvent is allowed to flow into the flow path 40 and the first solvent is held in the microcavity. Hereinafter, with reference to Figure 3 , Figure 4 , the steps after the first inflow step will be described.

[0180] As Figure 3 (a) shows, the tip 24 of the pipette is inserted into the solvent inlet 22 of the lid 20, and the dextran aqueous solution 50 as the first solvent is allowed to flow into the flow path 40 first. Thereby, the dextran aqueous solution 50 fills the inside of the microcavity 14 and the inside of the flow path 40. The dextran aqueous solution 50 overflowing from the inside of the flow path 40 flows out from the solvent outlet 23 of the lid 20.

[0181] (5) Second inflow step

[0182] In this step, the second solvent 60 is caused to flow into the flow path 40 and the first solvent 50 held in the microchamber 14 is brought into contact with the second solvent 60. Thereby, the biological substance contained in the second solvent 60 is moved into the first solvent 50 in the microchamber 14. Further, in this step, if the first solvent 50 remains in the flow path 40, it is flushed out of the flow path 40. It should be noted that the concentration of the dextran aqueous solution 50 in the microchamber 14 hardly changes due to the contact with the polyethylene glycol aqueous solution 60 and remains at the concentration in the first solvent introduction step. Herein, examples of "contact" include a case where two aqueous solutions are mixed and left standing (incubated) at a certain temperature and for a certain time, and a case where the state after stirring is maintained. The flow rate when the second solvent 60 flows into the flow path 40 can be appropriately set, for example, it can be set to 0.1 μl / second to 10 μl / second. The time (contact time) for bringing the second solvent 60 into contact with the first solvent 50 can be appropriately set according to the properties of these solvents or biological substances, etc., and is usually 1 minute or more, preferably 5 minutes or more, more preferably 10 minutes or more. If the contact time is 10 minutes or more, the biological substance in the second solvent 60 is easily and sufficiently concentrated into the first solvent 50 in the microchamber 14. The upper limit of the contact time is not particularly limited, and is usually 120 minutes or less, more preferably 60 minutes or less. If the contact time is 60 minutes or less, the biological substance concentrated into the first solvent 50 in the microchamber 14 is not easily diffused into the second solvent 60.

[0183] This step will be described according to this embodiment. As shown in Figure 3 (b), the polyethylene glycol aqueous solution 60 as the second solvent is caused to flow into the flow path 40 from the solvent inlet 22 of the lid 20. Thereby, the dextran aqueous solution 50 remaining in the flow path 40 is flushed out to the outside from the solvent outlet 23. Since the dextran and the polyethylene glycol exceed the critical concentration, the dextran aqueous solution 50 and the polyethylene glycol aqueous solution 60 are phase-separated. Thereby, a layer of dextran having a larger specific gravity is formed in the lower layer (inside the microchamber 14), and a layer of polyethylene glycol having a smaller specific gravity is formed in the upper layer (inside the flow path 40). Thus, in the method of this embodiment, compared with the conventional method using a pipette, the dextran aqueous solution 50 can be held in the plurality of microchambers 14 by a simple operation of introducing the dextran aqueous solution 50 into the flow path 40.

[0184] The polyethylene glycol aqueous solution 60 contains the enzyme E and the substrate S as biological substances. And both of these enzyme E and substrate S have a higher partition coefficient for the dextran aqueous solution 50 compared with the polyethylene glycol aqueous solution 60. Therefore, as shown in Figure 3As shown in (c), when the polyethylene glycol aqueous solution 60 comes into contact with the dextran aqueous solution 50 held in the microchamber 14, the enzyme E and the substrate S in the polyethylene glycol aqueous solution 60 move into the dextran aqueous solution 50 and are concentrated within the microchamber 14. The biological substances in the dextran aqueous solution 50 concentrated within the microchamber 14 are difficult to diffuse into the polyethylene glycol aqueous solution 60 within the flow path 40 due to the difference in partitioning, and thus are maintained in a state concentrated within the dextran aqueous solution 50. Since the dextran aqueous solution 50 and the polyethylene glycol aqueous solution 60 are sufficiently in contact within the microchamber 14 or the flow path 40, the biological substances are concentrated at a high concentration in the dextran aqueous solution 50 within the microchamber 14. It should be noted that, although in Figure 3 the enzyme E and the substrate S as biological substances are mixed in the polyethylene glycol aqueous solution 60 and both are introduced into the flow path 40 at the same time, it is not limited thereto. For example, it is also possible to first introduce the polyethylene glycol aqueous solution in which only the enzyme E is mixed into the flow path 40 and make it move into the dextran aqueous solution 50 within the microchamber 14, and then introduce the polyethylene glycol aqueous solution in which only the substrate S is mixed into the flow path 40 so that the substrate S moves into the microchamber 14 and reacts with the enzyme E. The same applies to the detection reagent. These biological substances can be mixed together into the polyethylene glycol aqueous solution and introduced into the flow path 40, or can be mixed in a polyethylene glycol aqueous solution different from the biological substances and introduced into the flow path 40 separately from the biological substances.

[0185] (6) Sealing solvent inflow step

[0186] In this step, the sealing solvent 70 is made to flow into the flow path 40 to flush out the remaining second solvent 60 within the flow path 40 from the flow path 40. Examples of the sealing solvent 70 include hydrophobic solvents such as silicone oil, perfluorocarbon oil, perfluoropolyether oil, halogen-based solvents, saturated hydrocarbon solvents, unsaturated hydrocarbon solvents, and aromatic hydrocarbon solvents. The sealing solvent 70 is preferably a solvent having a higher hydrophobicity than the first solvent 50 and the second solvent 60. In addition, in order to prevent the diffusion of biological substances, the partitioning of the biological substances of the sealing solvent 70 is lower than that of the dextran aqueous solution 50.

[0187] This step will be described according to the present embodiment. As shown in Figure 4 (d), the sealing solvent 70 is made to flow into the flow path 40 from the solvent inlet 22 of the lid 20. As a result, the remaining polyethylene glycol aqueous solution 60 within the flow path 40 is flushed out to the outside from the solvent outlet 23. Thus, as shown in Figure 4As shown in (e), the flow path 40 is filled with the sealed solvent 70, and the biological substances (enzyme E, substrate S) are maintained in the dextran aqueous solution 50 in the microchamber 14 to carry out an enzyme-substrate reaction and generate the product P. That is, the solvent contained in the microchamber 14 becomes a reactor for the biological reaction. In this way, by sealing the inside of the flow path 40 with the sealed solvent 70, it is possible to prevent the diffusion of biological substances from the microchamber 14 to the flow path 40 and maintain them in a concentrated state, while also preventing the evaporation of the solvent. Through this, the biological substances are concentrated in the dextran aqueous solution 50 in the microchamber 14, and the reaction of the biological substances can proceed. It should be noted that this step of sealing the space 40 with the sealed solvent 70 is optional. In the case where the biological substances have properties such as being easily movable to the dextran aqueous solution 50, the sealed solvent 70 may not be required. In addition, the type of the sealed solvent is arbitrary, or air or the like can be used to seal instead of the sealed solvent.

[0188] (7) Variant 1

[0189] Although in the above-described embodiment, the enzyme E and the substrate S as biological substances are mixed in the polyethylene glycol aqueous solution 60 as the second solvent and concentrated in the microchamber 14, the method of the present invention is not limited thereto, and the biological substances may also be mixed in the dextran aqueous solution 50 as the first solvent. In this case, the flow cell preparation step and the solvent preparation step are the same as those in the above-described embodiment, but in the mixing step, the biological substances are mixed in the dextran aqueous solution 50, which is different from the above-described embodiment. The order of the subsequent steps is the same as that in the above-described embodiment, but in the first inflow step, the dextran aqueous solution 50 containing the biological substances is maintained in the microchamber 14. In the second inflow step, the polyethylene glycol aqueous solution 60 is filled in the flow path 40 above the dextran aqueous solution 50 located in the microchamber 14. Therefore, the biological substances contained in the dextran aqueous solution 50 are difficult to move to the polyethylene glycol aqueous solution 60 and maintain the state of being held in the dextran aqueous solution 50. Through this, a state in which the biological substances are concentrated and held in the microchamber 14 can be obtained. Further, an embodiment in which the biological substances are mixed in both the first solvent and the second solvent is also possible.

[0190] (8) Variant 2

[0191] Although in the above-described embodiment, the dextran aqueous solution 50 as the first solvent is allowed to flow in the first inflow step, and then the polyethylene glycol aqueous solution 60 as the second solvent is allowed to flow in the second inflow step, the present invention is not limited thereto, and it can also be carried out in the reverse order.

[0192] That is, in this modified example, in the first inflow step, the polyethylene glycol aqueous solution 60 as the second solvent is caused to flow in, and then in the second inflow step, the dextran aqueous solution 50 as the first solvent is caused to flow in. Even in this order, the first solvent can be retained in the microchamber 14 and the biological substance can be concentrated therein.

[0193] (9) Modified Example 3

[0194] Preferably, a step of attaching a label (label attachment step) that can improve the partitioning property with respect to the first solvent to the biological substance is further provided. As such a label, a dextran-binding domain of dextransucrase (EC 2.4.1.5) can be cited. As dextransucrase, an enzyme derived from a genus of Lactobacillus such as Leuconostoc (Leuconostoc) or Streptococcus (Streptococcus) can be used, and for example, an enzyme derived from "Leuconostoc mesenteroides" is preferably used. Such a label can be introduced into the biological substance by genetic recombination or the like when the biological substance is a protein. At this time, the label can be introduced into an arbitrary position such as the C-terminus or N-terminus of the protein.

[0195] As such tags, the following can be enumerated in addition: nucleic acids such as DNA and RNA, chemically modified molecules obtained by chemically modifying these nucleic acids, nucleic acid-like molecular polymers that are analogs of these chemically modified nucleic acid molecules, dextran itself, dextran-like molecular polymers, etc. As the nucleic acid-like molecular polymers, polymers in which any one or more of the base, sugar, and phosphate in natural DNA or RNA are modified can be enumerated. As such bases, bases obtained by modifying natural-type adenine, guanine, cytosine, thymine, and uracil can be enumerated. For example: N-methyladenine, N-benzoyladenine, 2-methylthioadenine, 2-aminoadenine, 7-methylguanine, N-isobutyrylguanine, 5-fluorocytosine, 5-bromocytosine, 5-methylcytosine, 4-N-methylcytosine, 4-N,N-dimethylcytosine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, or 5,6-dihydrouracil, etc. In addition, as such sugars, sugars obtained by modifying natural-type ribose and deoxyribose can be enumerated. For example: 2-fluoro-2-deoxyribose, 2-chloro-2-deoxyribose, 2-O-methylribose, 2-O-methoxyethylribose, morpholino, etc. Further, as the phosphate, phosphates obtained by modifying natural-type phosphate groups can be enumerated. For example, thiophosphate esters, methylphosphonates, methoxypropylphosphonates, etc. As the dextran-like molecular polymers, the following can be enumerated: cationized dextran, carboxymethyl dextran, diethylaminoethyl dextran, etc. In this modification example, even when the partitionability of the biological substance to the first solvent is low, the partitionability of the biological substance to the first solvent can be improved by the method of introducing such tags.

[0196] (10) Modification Example 4

[0197] In the above-described embodiment, after supplying the first solvent, a certain amount of the second solvent is supplied into the flow path 40 of the flow cell 1 to concentrate and analyze the biological substance, but the present invention is not limited thereto. For example, the second solvent can also be continuously supplied into the flow path 40 of the flow cell 1 by the continuous flow method to concentrate and analyze the biological substance. In this case, considering that the second solvent may cause the outflow and diffusion of the first solvent in the microcavity 14, it is preferable to supply a mixed solvent in which the first solvent is mixed with the second solvent as the second solvent. The ratio of the first solvent to the second solvent in this mixed solvent can be appropriately set. For example, it can be set to 0.1:1 to 1:1 by volume ratio, etc.

[0198] 2. Reaction Detection Method

[0199] Next, the reaction detection method will be described. The reaction detection method includes a detection step of detecting the reaction of the biological substance that has been retained and / or concentrated by the above-described biological substance treatment method. In the above-described embodiment, since the enzyme E and the substrate S are concentrated in the microchamber 14 in the biological substance treatment method, the enzyme-substrate reaction is detected in the detection step. The detection method used in the detection step can be appropriately set according to the type of biological substance, and detection methods using a confocal microscope, a fluorescence microscope, an image sensor, etc. can be used. In particular, in digital bioassay, a system using an image sensor can be preferably used. As an example of such a system, it includes: a light source that irradiates light to the flow cell 1, an image sensor that receives the light emitted due to the biological reaction in the flow cell 1, and image analysis software that analyzes the image obtained using the image sensor and evaluates the reaction of each microchamber 14. Then, the number of microchambers 14 in which a biological reaction can be observed among the plurality of microchambers 14 is counted by the image analysis software, whereby digital analysis of the biological reaction can be performed.

[0200] 3. Biological Substance Treatment Device

[0201] Next, the biological substance treatment device will be described. The biological substance treatment device is a device for implementing the above-described biological substance treatment method. Specifically, the flow cell 1, a first solvent (in this embodiment, a dextran aqueous solution 50), and a second solvent (in this embodiment, a polyethylene glycol aqueous solution 60) are used. Further, units such as pipettes (mixing unit, first inflow unit, second inflow unit) for implementing the mixing step, the first inflow step, and the second inflow step are provided.

[0202] 4. Reaction Detection Device

[0203] Next, the reaction detection device will be described. The reaction detection device is a unit (equivalent to a detection unit) for implementing the detection step in the above-described reaction detection method. As such a device, the above-described confocal microscope, fluorescence microscope, image sensor, etc. can be cited.

[0204] 5. Biological Substance

[0205] As the biological substance, various substances can be cited. For example, nucleic acids such as DNA and RNA, peptides, proteins, etc. They can be of natural origin or artificially synthesized. As a specific example of the biological substance, enzymes, substrates, antibodies, antigens, polymerases, receptors, ribosomes, hormones, cytokines, etc. can be cited. These biological substances can use substances derived from various organisms such as viruses, prokaryotes, and eukaryotes.

[0206] DNA and RNA have a higher partitioning property for the dextran aqueous solution 50 compared to the polyethylene glycol aqueous solution 60, so they are easily concentrated in the microcavity 14. In particular, double-stranded DNA with a double helix has a very high partitioning property for the dextran aqueous solution 50. Proteins have different partitioning properties for the dextran aqueous solution 50 depending on their properties. It should be noted that for biomolecules with a low partitioning property for the dextran aqueous solution 50, the above-mentioned tags can be attached to improve their partitioning property for the dextran aqueous solution 50.

[0207] The reaction of biomolecules can be detected, for example, by measuring the fluorescence generated in the biological reaction. As the fluorescent dyes (reporter dyes) used for measuring the fluorescence of probes for DNA and RNA, FAM, Cy3 (registered trademark), Cy5 (registered trademark), FITC (fluorescein isothiocyanate), TRITC (tetramethylrhodamine B isothiocyanate), TexasRed (registered trademark), rhodamine, TAMRA, etc. can be listed. Only one reporter dye can be used, or two or more can be used in combination. When two or more reporter dyes are used, if different reactions of biomolecules emit fluorescence, two or more biological reactions can be detected in one microcavity.

[0208] Furthermore, it is preferable to use a quenching molecule in combination, which absorbs light at the fluorescence wavelength of these reporter dyes. In this case, when the reporter dye and the quenching molecule are close to each other, the fluorescence of the reporter dye is absorbed by the quenching molecule due to fluorescence resonance energy transfer (FRET), but if the two are separated, the fluorescence of the reporter dye can be detected. Therefore, by combining the reporter dye and the quenching molecule, reactions such as cleavage of the probe can be detected with higher sensitivity. As such a quenching molecule, BHQ (registered trademark), TAMRA, etc. can be listed. The reporter dye and the quenching molecule can be used by binding to the 5'-end and 3'-end of the probe for DNA and RNA, respectively.

[0209] This embodiment can be used for the concentration of various biomolecules or the detection of reactions, and is particularly suitable for the detection of pathogenic microorganisms such as influenza virus. As a method for detecting pathogenic microorganisms, the method described in Japanese Unexamined Patent Application Publication No. 2022-031760 can be exemplified. For example, an enzyme present on the surface or inside of a pathogenic microorganism and a substance that is its substrate are used as biomolecules, and the product of the enzyme-substrate reaction is detected by an optical method or the like using the above-mentioned flow cell 1. As a combination of such an enzyme and a substrate, the combinations described in Table 1 etc. of Japanese Unexamined Patent Application Publication No. 2022-031760 can be appropriately adopted.

[0210] As a detection system using fluorescence, various systems can be used. For example, enzyme-linked immunosorbent assay (ELISA) described in International Publication No. 2016 / 047068 can be adopted.

[0211] Furthermore, a system for detecting pathogenic microorganisms by targeting RNA derived from pathogenic microorganisms is also effective. This will be described in detail below.

[0212] In this system, the reaction of specifically cleaving RNA using Cas13 is utilized. Specifically, as Figure 5 (a) shows, as biological substances, it at least includes target RNA ("Target" in the figure), crRNA for its detection, Cas13, and two RNA probes (the first probe and the second probe in the figure). The target RNA is RNA having a sequence specific to the pathogenic microorganism to be detected. For example, in SARS-CoV-2, etc., RNA containing genes such as ROF1ab gene, N gene, S gene, etc. can be used. The crRNA contains a sequence complementary to a specific region of the target RNA and can form a complex with Cas13. This complex binds to the target RNA with the crRNA as the guide RNA to become an activated complex and cleaves the target RNA.

[0213] One of the two RNA probes (the first RNA probe) has a sequence that can be cleaved by this activated complex and binds a first fluorophore ("F" in the figure) and a quenching molecule ("Q" in the figure). When the RNA of the first RNA probe is cleaved, the distance between the first fluorophore F and the quenching molecule Q becomes farther, and fluorescence of the fluorophore F (first fluorescence) is generated. On the other hand, the other of the two RNA probes (the second RNA probe) does not have a sequence that can be cleaved by the activated complex and binds a second fluorophore ("C" in the figure) and a quenching molecule ("Q" in the figure). This second fluorophore C emits fluorescence that can be distinguished from the first fluorophore F, for example, emits fluorescence with a wavelength different from that of the first fluorophore F. When the RNA of the second RNA probe is cleaved, the distance between the second fluorophore C and the quenching molecule Q becomes farther, and fluorescence of the fluorophore C (second fluorescence) is generated.

[0214] In an environment such as a detection sample or a chip, there are sequence-nonspecific ribonucleases, that is, ribonucleases (RNases) that cleave RNA regardless of the sequence, and they will contaminate the reaction system. As Figure 5 (b) shows on the left side, if there is RNase, both of the two probes (the first probe and the second probe) are cleaved, and fluorescence of both the first fluorophore F and the second fluorophore C (first fluorescence, second fluorescence) is emitted simultaneously. On the other hand, as Figure 5As shown on the right side of (b), when there is an activated complex obtained by binding of the complex of Cas13 and crRNA to the target RNA, only the first RNA probe is cleaved and only the fluorescence of the first fluorochrome F (first fluorescence) is emitted. Therefore, when only the first fluorescence is detected in one microchamber 14, it can be determined that it is a positive signal generated by the complex of Cas13. On the other hand, when both the first fluorescence and the second fluorescence are detected in one microchamber 14, it can be determined that it is a suspected positive signal generated by a sequence-nonspecific ribonuclease. It should be noted that in the present embodiment, only one type of probe is used for detecting the suspected positive, but the present invention is not limited thereto, and two or more types of probes can be used. By increasing the types of probes for detecting the suspected positive, the recognition of the suspected positive can be improved and the detection accuracy of the target can be enhanced.

[0215] The detection sample (including the target RNA) containing these biological substances (crRNA, Cas13, two types of RNA probes) is mixed in the first solvent or the second solvent and introduced into the flow cell 1. In the examples described below, it is mixed into the second solvent (60% polyethylene glycol aqueous solution) and introduced. These biological substances have a higher partition coefficient for the first solvent (50% dextran aqueous solution) than for the second solvent (60% polyethylene glycol aqueous solution), so they are partitioned into the 50% dextran aqueous solution held in the microchamber 14 and concentrated.

[0216] In the microchamber 14 where the complex of Cas13 exists, only the first RNA probe is cleaved, generating the first fluorescence of the first fluorochrome F ( Figure 6 on the right side). Therefore, by measuring the microchambers 14 that emit only the first fluorescence, the positive signal can be measured (positive measurement step, positive measurement unit).

[0217] On the other hand, if the detection sample contains a sequence-nonspecific ribonuclease, it will be held in several of the microchambers 14. In the microchambers 14 containing the sequence-nonspecific ribonuclease, both the first RNA probe and the second RNA probe are cleaved, emitting two types of fluorescence, namely the first fluorescence of the first fluorochrome F and the second fluorescence of the second fluorochrome C ( Figure 6 on the left side). Therefore, by measuring the microchambers 14 that emit two types of fluorescence, the suspected positive signal can be measured (suspected positive measurement step, suspected positive measurement unit).

[0218] In this way, the suspected positive signal can be excluded and the detection sensitivity of the target RNA can be improved.

[0219] (1) Variant 6: Capture of the target DNA by the DBD-capture DNA

[0220] By binding the DNA for capture to dextran or a dextran-binding domain (DBD), a complementary DNA can be bound to the DNA for capture and concentrated in an aqueous dextran solution 50. Figure 21 (a) is a schematic diagram showing the state after the capture DNA is bound to the DBD. As Figure 21 (b) shows, the DBD-capture DNA is concentrated in the aqueous dextran solution 50. In this figure, as the target DNA, the target DNA-FAM conjugated with the fluorescent dye FAM is used. Since the DNA for capture has a sequence complementary to the target DNA, after binding to it, the target DNA-FAM is also concentrated in the aqueous dextran solution 50, and the target DNA can be detected by detecting the fluorescence of FAM.

[0221] Examples

[0222] Hereinafter, the present invention will be specifically described based on examples, but these examples do not limit the purpose of the present invention. In addition, in the following examples, "%" represents a mass basis (mass percentage) unless otherwise specified.

[0223] An aqueous two-phase system (ATPS) of dextran (DEX) and polyethylene glycol (PEG) can preferentially partition nucleic acid polymers such as DNA into the DEX-rich phase. Therefore, experiments were conducted focusing on this system. First, based on the existing femto-liter microcavity array device (FRAD) developed for digital bioassays, a system in which uniformly shaped DEX-rich droplets (hereinafter simply referred to as DEX droplets) are arranged was developed. In addition, a tagging system that can partition proteins, which are originally difficult to concentrate in the DEX-rich phase, into DEX droplets (DEX droplet) was developed. Then, by concentrating tagged enzymes such as alkaline phosphatase or Cas13 on-chip, a highly sensitive digital bioassay exceeding the theoretical LOD of the total reaction volume was performed. The following is a detailed description.

[0224] 1. Materials and methods

[0225] (1) Chemical substances

[0226] Polyethylene glycol (MW: 35 kDa), dextran (MW: 450 - 650 kDa) derived from the genus Leuconostoc, TRITC-DEX (dextran (DEX: MW: 500 kDa) labeled with tetramethylrhodamine B isothiocyanate (TRITC), purchased from Merck (Sigma-Aldrich) in Germany. Fluorinert-FC40 and FC43 (3M, USA), fluorescein diphosphate (FDP) (AAT Bioquest, USA), SYBR Gold (Thermo Fisher SCIENTIFIC, USA), SURFLON S-386 (AGC Seimi Chemical Co., Ltd., Japan), BSA (bovine serum albumin: NEW ENGLAND Biolabs, USA), and Forblin Y-LVAC25 / 6 (Solvay, Belgium), fluorescein di-β-galactopyranoside (FDG) (Abcam, UK), were provided by their respective suppliers, respectively.

[0227] (2) Proteins and RNAs

[0228] Throughout the experiment, a highly active variant of alkaline phosphatase (ALP) from Escherichia coli, ALP (D101S), was used and is referred to simply as "ALP" or "EcALP" for brevity. To prepare an ALP tag (ALP-DBD) with the dextran-binding domain (DBD) of dextransucrase from Leuconostoc mesenteroides (Suwannarangsee, S.; Moulis, C.; Potocki-Veronese, G.; Monsan, P.; Remaud-Simeon, M.; Chulalaksananukul, W., Search for a dextransucrase minimal motif involved in dextran binding. FEBS Lett 2007, 581(24), 4675-80.), a gene fusion was made between the c-terminus of ALP and DBD. The proteins of ALP or ALP-DBD were prepared by the in-vitro TXTL system (PURExpress, NEW ENGLAND Biolabs, USA) reported in the following paper (Ueno, H.; Kato, M.; Minagawa, Y.; Hirose, Y.; Noji, H., Elucidation and control of low and high active populations of alkaline phosphatase molecules for quantitative digital bioassay. Protein Sci 2021, 30(8), 1628-1639.). β-galactosidase (Wako, Japan) and anti-β-galactosidase IgY antibody (Abcam, UK) were purchased from their respective suppliers.

[0229] In digital RNA counting detection, Cas13a of Leptotrichia wadei was utilized. According to the report of the following paper, Cas13 protein was purified with slight modification (Kellner, M.J.; Koob, J.G.; Gootenberg, J.S.; Abudayyeh, O.O.; Zhang, F., SHERLOCK: nucleic acid detection with CRISPR nucleases. Nat Protoc 2019, 14(10), 2986-3012.). Since the DBD obtained from dextransucrase might attach to the size exclusion chromatography (SEC) column, size exclusion chromatography was omitted in the purification step. The target RNA for digital RNA counting detection using Cas13 was designed to be 3000 nt in order to encode the S gene fragment of SERS-CoV-2 and be efficiently concentrated in the DEX-enriched phase. The DNA encoding the designed RNA was synthesized by SYNTHGO Corporation in the United States. RNA was prepared using the ScriptMax Thermo T7 transcription kit (TOYOBO, Japan) and the NucleoSpin RNA purification kit (Macherey-Nagel) according to the synthesized DNA. The crRNA was synthesized using the device of Synthgo Corporation.

[0230] The sequences of each RNA are shown below.

[0231] (1) Target RNA

[0232] GGGUAACAUCACUAGGUUUCAAACUUUACUUGCUUUACAUAGAAGUUAUUUGACUCCUGGUGAUU CUUC UUCAGGUUGGACAGCUGGUGCUGC

[0233] GUGACCGAGGACUUCGAGCUGGAAGCCAACGAGAUCGGCAAGUUCCUGGACUUCAA

[0234] CGAAAACAAAAUCAAGGACCGGAAAGAGCUGAAAAAGUUCGACACCAACAAGAUCU

[0235] AUUUCGACGGCGAGAACAUCAUCAAGCACCGGGCCUUCUACAAUAUCAAGAAAUAC

[0236] GGCAUGCUGAAUCUGCUGGAAAAGAUCGCCGAUAAGGCCAAGUAUAAGAUCAGCCU

[0237] GAAAGAACUGAAAGAGUACAGCAACAAGAAGAAUGAGAUUGAAAAGAACUACACCA

[0238] UGCAGCAGAACCUGCACCGGAAGUACGCCAGACCCAAGAAGGACGAAAAGUUCAAC

[0239] GACGAGGACUACAAAGAGUAUGAGAAGGCCAUCGGCAACAUCCAGAAGUACACCCA

[0240] CCUGAAGAACAAGGUGGAAUUCAAUGAGCUGAACCUGCUGCAGGGCCUGCUGCUGA

[0241] AGAUCCUGCACCGGCUCGUGGGCUACACCAGCAUCUGGGAGCGGGACCUGAGAUUC

[0242] CGGCUGAAGGGCGAGUUUCCCGAGAACCACUACAUCGAGGAAAUUUUCAAUUUCGA

[0243] CAACUCCAAGAAUGUGAAGUACAAAAGCGGCCAGAUCGUGGAAAAGUAUAUCAACU

[0244] UCUACAAAGAACUGUACAAGGACAAUGUGGAAAAGCGGAGCAUCUACUCCGACAAG

[0245] AAAGUGAAGAAACUGAAGCAGGAAAAAAAGGACCUGUACAUCCGGAACUACAUUGC

[0246] CCACUUCAACUACAUCCCCCACGCCGAGAUUAGCCUGCUGGAAGUGCUGGAAAACCU

[0247] GCGGAAGCUGCUGUCCUACGACCGGAAGCUGAAGAACGCCAUCAUGAAGUCCAUCG

[0248] UGGACAUUCUGAAAGAAUACGGCUUCGUGGCCACCUUCAAGAUCGGCGCUGACAAG

[0249] AAGAUCGAAAUCCAGACCCUGGAAUCAGAGAAGAUCGUGCACCUGAAGAAUCUGAA

[0250] GAAAAAGAAACUGAUGACCGACCGGAACAGCGAGGAACUGUGCGAACUCGUGAAAG

[0251] UCAUGUUCGAGUACAAGGCCCUGGAAUAAGCGGCCGCACUCGAGGCCCGAAAGGAA

[0252] GCUGAGUUGGCUGCCUGCCACCGCUGAGCAUAUA

[0253] (2) crRNA

[0254] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGCAGCACCAGCUGUCCA ACCUGAAGAAG

[0255] (※The underline indicates the complementary sequence between the target RNA and crRNA.)

[0256] (3) Femtosecond microcavity array device (FRAD)

[0257] According to the report of the paper, a FRAD composed of multiple microcavities arranged by using fine processing of photolithography was fabricated (the above-mentioned paper by Ueno, H., etc.). The flow cell was assembled using a FRAD (equivalent to a microcavity array device), a top glass with holes for the inlet and outlet (equivalent to the cover), and a double-sided adhesive (~80 μm) as a spacer. The top glass of the flow cell microcavity was pre-coated with CYTOP 809M to avoid non-specific binding of biomolecules.

[0258] (4) Photography using a microscope

[0259] Confocal fluorescence images were obtained using a laser scanning confocal microscope TCS SP8 X (Leica Microsystems, Germany) equipped with a white light laser (Leica Microsystems, Germany). The fluorescence signal of TRITC-DEX was obtained using a HyD detector (Leica Microsystems, Germany). Confocal fluorescence images were analyzed using Fiji, an image processing package of ImageJ. Further, epi-fluorescence images were obtained using an epi-fluorescence microscope (ECLIPSE Ti2, Nikon or Olympus IX83, Olympus Corporation) equipped with an sCMOS camera (Zyla sCMOS or Andor neo, Andor Technology) and an LED light source (X-Cite TURBO or X-Cite XYLIS, Excelitastechnologies). Epi-fluorescence images were obtained using Fiji (an image processing package of ImageJ) and a custom macro.

[0260] (5) Formation of a uniform DEX reactor using FRAD

[0261] A DEX solution with a labeled concentration of 5.5% (w / w) containing 0.1% (w / w) of TRITC-DEX was injected into the flow cell microcavity. Then, PEG with a labeled concentration (5.0% (w / w)) was injected, and the excess amount of DEX solution was allowed to flow out of the flow path. The DEX solution remained in each micron-sized hole on the FRAD, forming DEX droplets with a uniform shape. In the DNA concentration experiment, a DNA solution in 5% (w / w) PEG containing 12.5 ng / μl of λ-DNA stained with x1 SYBR gold was injected into the flow cell.

[0262] (6) Digital bioassay of ALP-DBD using the DEX droplet system

[0263] Before measurement, to prevent non-specific binding of ALP molecules to the surface of the flow cell, a blocking solution (Tween 20 0.2% (w / v)) was injected into the flow cell microcavity. Then, an ALP buffer solution mixed with 4% (w / w) DEX and 0.1% (w / w) TRITC-DEX was injected into the flow cell microcavity pretreated with the blocking solution. Then, ALP or ALP-DBD was introduced into the ALP buffer solution containing 4% (w / w) PEG. After incubation for 10 minutes, the PEG solution was rinsed with FC40 oil, and then, fluorin oil for preventing evaporation was injected.

[0264] (7) Digital RNA quantification of Cas13a using the DEX droplet system

[0265] To distinguish the RNA cleavage reaction by LwaCas13a from non-specific ribonucleases, a self-quenched probe was prepared. LwaCas13a preferentially cleaves AU, UU, CU, GU dinucleotide motifs and shows lower activity towards the remaining motifs (Gootenberg, J.S.; Abudayyeh, O.O.; Kellner, M.J.; Joung, J.; Collins, J.J.; Zhang, F., Multiplexed and portable nucleic acid detection platform with Cas13 (Cas13-based multiplex portable nucleic acid detection platform), Cas12a, and Csm6. Science 2018, 360(6387), 439-444.). The FAM-AU-BHQ1 (5'-6FAM-taAUgc-BHQ1-3') as a self-quenched probe for cleavage by Cas13 and the Cy5-AC-BHQ3 (5'-Cy5-taACgc-BHQ3-3') as a self-quenched probe for non-specific ribonucleases were both purchased from Fasmac in Japan. It should be noted that the capital letters in the probe names represent ribonucleotides (i.e., RNA), and the lowercase letters represent deoxyribonucleotides (i.e., DNA).

[0266] The steps for digital RNA counting by Cas13 using DEX droplets are as follows. First, a blocking solution containing 0.5 mg / ml BSA, 0.06% (w / w) S-386, 500 nM FAM-AU-BHQ1, and 500 nM Cy5-AC-BHQ3 was prepared in Cas13 buffer (20 mM HEPES-NaOH, pH 6.8, 60 mM NaCl, 6 mM MgCl 2) was injected into the flow cell microcavity. Then, a DEX mixture (5.5% (w / w) DEX, 0.1% (w / w) TRITC-DEX in Cas13 buffer) was injected into the flow cell, and a PEG mixture (5% (w / w) PEG, 0.06% (w / w) S-386in Cas13 buffer) was flowed into the flow cell. After a 10-minute incubation, the following components were injected into the PEG mixture. That is: 45nM LwaCas13a-DBD, 22.5nM crRNA, 3μM FAM-AU-BHQ1, 10μM Cy5-AU-BHQ3, 2U / ml RNase inhibitor and 0.06% (w / w) S-386.

[0267] Further, sealing oil (a 1:1 mixture of FC43 and forblin Y-LVAC25 / 6) was introduced. After incubation at room temperature for 30 minutes, fluorescence images were obtained using an epifluorescence microscope. After the blocking solution was injected, the reaction mixture (labeled amount of target RNA, 45nM LwaCas13a-DBD, 22.5nM crRNA, 3μM FAM-AU-BHQ1, 10μM Cy5-AU-BHQ3, 2U / ml RNase inhibitor, and 0.06% S-386 in Cas13 buffer) was injected for digital bioassay without DEX droplets. Finally, sealing oil (a 1:1 mixture of FC43 and forblin Y-LVAC25 / 6) was injected into the flow cell microcavity.

[0268] 2. Results

[0269] (1) Femtosecond DEX droplet array system (Experimental Example 1)

[0270] An overview and results of experiments using the DEX droplet array system are given in Figure 7 . (a) is a conceptual diagram of the concentration of biomolecules using a conventional DEX-enriched phase in a test tube (left) and DEX droplets in DEX / PEG ATPS on a femtoliter microcavity array device (FRAD) (right). (b) is a schematic diagram of the process of forming DEX droplets on a FRAD. (c) is a confocal image of DEX droplets formed on a FRAD. When the DEX solution was introduced into the flow cell microcavity, the DEX droplets were stained by adding 0.1% (w / w) TRITC-DEX to 5.5% (w / w) DEX. (d) is an image of the state of concentration of fluorescently stained λ-DNA in DEX droplets on the chip, which was taken at regular intervals every hour.

[0271] In the preparation of uniform DEX droplets of femtoliter size, FRAD that can display one million micro-sized reactors (diameter: 4.4 μm, height: 3.2 μm) was used. As Figure 7 (b) shows, the configuration sequence is as follows. First, the DEX solution is injected into the flow cell microchamber equipped with the FRAD system at the bottom, and the reactors are filled with the DEX solution. After that, the PEG solution is introduced into the flow cell microchamber, and the excess DEX solution is washed away. As a result, as Figure 7 (c) shows, DEX-enriched droplets are formed in each reactor of FRAD under the PEG solution. When the concentrations of DEX and PEG are set to 4.0 - 5.5 wt%, the formation of DEX droplets is confirmed.

[0272] Figure 8 is a graph showing the diameter and volume of the DEX reactors formed in the femtoliter microchamber array device. In (a) of this graph, it represents the diameter of the DEX reactor obtained by analyzing the confocal microscope image of the TRITC-DEX fluorescence of Figure 7 , and (b) in the graph represents the volume of the reactor. μ and σ in the upper left of the graph represent the mean value and standard deviation obtained by Gaussian fitting. It can be seen that the DEX droplets formed in the reactor show a relatively high volume uniformity of 73 ± 3.6 fL (cv = 4.9%). In this way, by using a simple procedure of the FRAD system, uniform DEX droplets of femtoliter volume can be fabricated.

[0273] Figure 9 shows a quadratic curve and a presumed connection line. The circle (A) represents the dilution point where the DEX / PEG ATPS becomes a mixed solution, which is determined by titration. The line (A - A) represents the result of fitting using the following formula. That is: [PEG] = C 1 exp(C 2 [DEX] 0.5 +C 3 [DEX] 3 ).

[0274] The circle (B) shows the concentration after mixing 5.5% (w / w) DEX containing 0.03% (w / w) TRITC-DEX and 5.0% (w / w) PEG at a ratio of 1:125, and shows the intersection point with the quadratic curve in the concentration of the mixed DEX-enriched phase (4.9% (w / w)). The line (B - B) represents the connection line connecting the two circles (B).

[0275] Regarding the initial concentrations of DEX and PEG, considering concentrations sufficient to cause phase separation and maintaining a suitable viscosity for handling the solution with high reproducibility, 5.5 wt% of DEX and 5.0 wt% of PEG were used. Considering the ratio of the total reaction volume of FRAD to the flow path (1:100 or more in this embodiment), when the flow path solution was replaced with a PEG solution, the final concentration of DEX in the flow path microcavity should be approximately 0.05 wt% or less. It has actually been confirmed that phase separation occurred when 5.5 wt% of DEX and 5.0 wt% of PEG were mixed at a ratio of 1:125 in a conventional test tube ( Figure 9 ). Under this condition, the DEX concentration in the DEX-enriched phase was 4.9 wt%. Therefore, after injecting 100 times the amount of PEG solution into the flow path, it was possible to conveniently form DEX-enriched droplets on FRAD.

[0276] The ability of the array-like DEX droplets to concentrate DNA molecules was verified. According to a previous report related to the ATPS of the DEX / PEG system (Nakatani, N.; Sakuta, H.; Hayashi, M.; Tanaka, S.; Takiguchi, K.; Tsumoto, K.; Yoshikawa, K., Specific Spatial Localization of Actin and DNA in a Water / Water Microdroplet: Self-Emergence of a Cell-Like Structure. Chembiochem 2018, 19(13), 1370 - 1374.), double-stranded DNA molecules with a length of kbp were effectively concentrated in the DEX-rich phase. To test this phenomenon on the device, DNA molecules with a length of 48 kbp were introduced into the flow cell together with 5.5 wt% of PEG. As Figure 7 (d) shows, the DNA molecules were highly concentrated over time, showing the same efficiency of concentration as that of the DEX enrichment prepared in a test tube.

[0277] (2) Digital bioassay of alkaline phosphatase using the DEX droplet system (Experimental Example 2)

[0278] It was investigated whether the DEX droplet array system could be utilized in a standard digital bioassay using alkaline phosphatase (ALP) derived from Escherichia coli, EcALP. Although DNA and RNA molecules are preferentially partitioned into the DEX-rich phase, the efficiency of concentrating some globular proteins in the DEX-rich phase is not high. To efficiently concentrate EcALP, a gene fusion of the dextran-binding domain (DBD) derived from Leuconostoc mesenteroides dextran sucrase 25 with EcALP was performed.

[0279] Figure 10 , is a figure showing the results of a digital bioassay of EcALP using the DEX droplet system. In (a) of this figure, ALP derived from Escherichia coli (ALP-DBD) having a DBD at the C-terminus is shown. The structure was modeled by AlphaFold. In (b) of the figure, the distribution coefficients (DC) of ALP and ALP-DBD in DEX / PEG ATPS are shown. The error bars in the figure represent s.d. (n = 3). In (c) of the figure, a schematic diagram of an existing digital bioassay (left) and a digital bioassay using DEX droplets (right) is shown.

[0280] The DBD is a relatively small protein (14 kDa) and has a high affinity for dextran (Kd: 2.79×10 -9 M) (Wu, S.C.; Wang, C.; Chin, J.; Wong, S.L., A bio-coupling approach using a dextran-binding domain to immobilize an engineered streptavidin to Sephadex for easy preparation of affinity matrix. Sci Rep 2019, 9(1), 3359.). The distribution coefficient (DC) of EcALP (ALP-DBD) tagged with DBD in the DEX-rich phase formed in a normal test tube was measured ( Figure 17 ).

[0281] Figure 17 , is a figure explaining the distribution coefficients of ALP and ALP-DBD partitioning into ATPS for DEX / PEG. Figure 17 (a), is a schematic diagram of the experimental protocol for estimating the distribution coefficient.Figure 17 (b) is a histogram of the fluorescence intensity emitted by fluorescein, which is the product obtained by the hydrolysis of FDP by ALP. In the upper left and lower left are the histograms of ALP in the DEX-enriched phase and PEG-enriched phase collected. In the upper right is the histogram of ALP-DBD in the DEX-enriched phase and PEG-enriched phase after dilution 10,000 times, and in the upper left is the histogram after dilution 100 times.

[0282] ALP-DBD was placed in a test tube mixed with 5.5 wt% DEX / 5 wt% PEG at a ratio of 1:125, and centrifuged to separate the PEG-enriched phase at the upper part and the DEX-enriched phase at the lower part. Then, aliquots of each phase were taken and the ALP concentration was measured. To measure the EcALP concentration, a standard digital bioassay for ALP was used. In principle, DC is defined as C DEX / C PEG , where C DEX and C PEG represent the concentrations of ALP-DBD in the DEX- and PEG-enriched phases, respectively.

[0283] (3) Quantification of the partition coefficient of ALP-DBD

[0284] To separate the lower DEX-enriched phase from the upper PEG-enriched phase, 0.04% (w / w) DEX, 0.001% TRITC-DEX, 5% (w / w) PEG, 0.5 nM ALP or ALP-DBD, and ALP reaction buffer (ALP buffer; 1 M diethanolamine, pH 9.25, 1 mM MgCl 2 , 0.02% (w / v), Tween20) were appropriately mixed and centrifuged at 15,000 rpm for 3 minutes. Then, aliquots were sampled from each phase. After dilution with the ALP reaction mixture (10 μM Alexa647, 1 mM FDP, 1 M diethanolamine, pH 9.25, 1 mM MgCl 2 , 0.02% (w / v), Tween20), the ALP concentration in the sample was quantified by digital bioassay. The results are shown in Figure 10 (b).

[0285] As shown in Figure 10 (b), the DC for intact EcALP is 1.9, and the DC for ALP-DBD is 385. EcALP is prone to concentrate slightly in the DEX-enriched phase, but when the DBD tag is attached, it can be concentrated at a ratio of about 203 times more. This means that the enzyme tagged with DBD is efficiently partitioned into the DEX-rich phase. It should be noted that EcALP is a homodimeric enzyme, so ALP-DBD must contain 2 DBDs.

[0286] Digital biometrics was performed using an ALP-DBD and DEX droplet array system. The ALP-DBD molecules were mixed into a 5.5 wt% PEG solution and introduced into the flow cell microchambers of the FRAD of a reactor filled with a 5 wt% DEX solution. After incubation for 10 minutes, an oil solution was introduced to seal the DEX droplets ( Figure 10 (c)).

[0287] Figure 10 (d) shows fluorescence images of digital biometrics of ALP-DBD at 20 fM and 100 fM without DEX droplets (top) and with DEX droplets (bottom). For comparison, experiments without using DEX / PEG solution were also performed (upper section). Digital biometrics using DEX droplets showed a significantly higher number of positive responders at each concentration of ALP-DBD.

[0288] Figure 10 (e) shows the relationship between the frequency of positive reactors (P positive ) and [ALP-DBD]. The circles on the straight line of “+DEX droplets” represent P positive of digital biometrics using DEX droplets, and the circles on the straight line of “-DEX droplets” represent P positive of the measurement without DEX droplets. The circles represent the average value of P positive (n = 3), and the error bars represent s.d. (standard deviation). The dashed line represents the theoretical value of P positive obtained based on the total volume of the reactor. The straight line of “+DEX droplets” and the red line of “-DEX droplets” respectively represent the fits used to determine the proportionality coefficient compared to [ALP]. It was 1.9×10 -3 [ / fM] in the measurement using DEX droplets and 3.2×10 -5 [ / fM] in the measurement without using DEX droplets. The enrichment factor determined as the ratio of their coefficients was 59.

[0289] In this figure, the probabilities of positive reaction reactors are shown for cases with and without the use of DEX / PEG in an ATPS. The data points for droplets without DEX dropped sharply to near the theoretical line estimated based on the ALP-DBD concentration, but the data points for droplets containing DEX clearly showed higher values. The data points were fitted according to an equation consisting of a concentration-dependent term and an independent term. The concentration factor was obtained as the ratio of the concentration coefficients. As a result, the concentration factor of the DEX droplets was 59 times that of the measurement without using DEX droplets. Thus, it was confirmed that the DEX droplet system can efficiently concentrate proteins labeled with DBD without using additional external equipment or external force.

[0290] (4) Digital bioassay for detecting RNA using a DEX droplet system with Cas13

[0291] The concentrating power of DEX droplets was investigated using a digital RNA detection assay in a more practical form. Cas13 is a crRNA-mediated ribonuclease that shows trans-cleavage RNase activity (referred to as collateral activity or collateral effect) by recognizing target RNA through a complementary sequence on the crRNA pre-loaded on the Cas13 protein.The collateral activity of Cas13 is high enough to be easily detected using a self-quenched fluorescent reporter RNA, so highly sensitive RNA detection methods using Cas13 proteins have been developed (Kellner, M.J.; Koob, J.G.; Gootenberg, J.S.; Abudayyeh, O.O.; Zhang, F., SHERLOCK: nucleic acid detection with CRISPR nucleases (using CRISPR nucleases for nucleic acid detection). Nat Protoc 2019, 14(10), 2986-3012., Liu, T.Y.; Knott, G.J.; Smock, D.C.J.; Desmarais, J.J.; Son, S.; Bhuiya, A.; Jakhanwal, S.; Prywes, N.; Agrawal, S.; Derby, M.D.D.; Switz, N.A.; Armstrong, M.; Harris, A.R.; Charles, E.J.; Thornton, B.W.; Fozouni, P.; Shu, J.; Stephens, S.I.; Kumar, G.R.; Zhao, C.Y.; Mok, A.; Iavarone, A.T.; Escajeda, A.M.; McIntosh, R.; Kim, S.E.; Dugan, E.J.; Pollard, K.S.; Tan, M.X.; Ott, M.; Fletcher, D.A.; Lareau, L.F.; Hsu, P.D.; Savage, D.F.; Doudna, J.A.; Consortium, I.T., Accelerated RNA detection using tandem CRISPR nucleases (using tandem CRISPR nucleases to accelerate RNA detection). Nat Chem Biol 2021, 17(9), 982-988., Mahas, A.; Wang, Q.C.; Marsic, T.; Mahfouz, M.M., A Novel Miniature CRISPR-Cas13 System for SARS-CoV-2 Diagnostics (a novel miniature CRISPR-Cas13 system for SARS-CoV-2 diagnosis). Acs Synthetic Biology 2021, 10(10), 2541-2551.).

[0292] Also reported are Cas13-based digital assays for RNA detection (Tian, T.; Shu, B.; Jiang, Y.; Ye, M.; Liu, L.; Guo, Z.; Han, Z.; Wang, Z.; Zhou, X., An Ultralocalized Cas13a Assay Enables Universal and Nucleic Acid Amplification-Free Single-Molecule RNA Diagnostics. ACS Nano 2021, 15(1), 1167-1178., Shinoda, H.; Taguchi, Y.; Nakagawa, R.; Makino, A.; Okazaki, S.; Nakano, M.; Muramoto, Y.; Takahashi, C.; Takahashi, I.; Ando, J.; Noda, T.; Nureki, O.; Nishimasu, H.; Watanabe, R., Amplification-free RNA detection with CRISPR-Cas13. Commun Biol 2021, 4(1), 476.).

[0293] For example, for the detection of SARS-COVID-19, a Cas13-based high-speed digital bioassay was developed using a FRAD system with a reactor showing a volume of 3 fL. In this system, SARS-COVID-19 RNA can be rapidly detected within several minutes. However, the total volume of the reactor is proportionally very small, and as a result, unless a sedimentation (Dropdown) concentration step using magnetic beads and an external magnetic system is employed, the LOD will be limited to 10 fM or more (Shinoda, H.; Iida, T.; Makino, A.; Yoshimura, M.; Ishikawa, J.; Ando, J.; Murai, K.; Sugiyama, K.; Muramoto, Y.; Nakano, M.; Kiga, K.; Cui, L.; Nureki, O.; Takeuchi, H.; Noda, T.; Nishimasu, H.; Watanabe, R., Automated amplification-free digital RNA detection platform for rapid and sensitive SARS-CoV-2 diagnosis. Commun Biol 2022, 5(1), 473.). Thus, the trade-off between detection time and detection sensitivity is also one of the technical problems of digital bioassays using Cas13. In the present embodiment, by using a DEX droplet array, in the digital detection of SARS-COVID-19 RNA, the detection sensitivity was improved by performing on-chip concentration without using external equipment.

[0294] Figure 11 , which shows a figure of a digital RNA counting experiment using Cas13 with a DEX droplet system. In the figure, (a) is a schematic diagram of RNA detection using the Cas13 system, showing the detection method used in the digital counting of RNA molecules (3000 nt) encoding the SARS-CoV-2 S gene using Cas13. As the fluorescent reporter substrate, a synthetic oligonucleotide having an AU sequence at the cleavage site of Cas13 was used. In the preliminary experiment, there were two technical problems. One was that even in the absence of target RNA, according to the following Figure 12Calculations were also able to observe suspiciously positive signals at a frequency of 0.015%. The suspiciously positive reaction enhances fluorescence over time, so it is not caused by fluorescent impurities in the solution or on the device. It is thought that this is due to the contamination of non-specific ribonucleases from the sample or the environment. When another type of reporter oligonucleotide without the recognition sequence of Cas13 was added, fluorescence could be emitted regardless of whether it had the recognition sequence of Cas13. The reporter designed with the recognition site of Cas13 emits green fluorescence, and the reporter without the recognition site emits red fluorescence. In this way, the dual reporter system can easily identify the collateral activity of Cas13 as a green fluorescence signal and the accompanying activity of non-specific ribonucleases that generate two fluorescence signals.

[0295] Figure 11 (b) is a schematic diagram of the conventional digital biometric assay (upper part) and the digital biometric assay using the DEX droplet system of the present embodiment (lower part). In the conventional method, the Cas13 / crRNA / target RNA complex was mixed with the self-quenching probe and injected into the flow cell microcavity. However, in the assay using DEX droplets, the target RNA was concentrated using a DEX reactor, and then Cas13 / crRNA and the self-quenched probe were introduced into the flow cell microcavity.

[0296] Figure 12 shows the experimental results of the dual reporter system for suppressing suspiciously positive signals. The reporter with the recognition site of Cas13 and the reporter without the recognition site of Cas13 were designed to emit FAM fluorescence and Cy5 fluorescence, respectively. In the absence of target RNA, the fluorescence intensities of FAM and Cy5 obtained from the Cas13-based digital biometric assay were plotted two-dimensionally. Reactors emitting FAM fluorescence above the threshold (horizontal dashed line) are false positive signals. Under the condition of low-concentration target RNA, these false positive reactors have a relatively strong impact on P positive Among them, reactors with a Cy5 fluorescence intensity greater than or equal to the threshold can be excluded from the analysis as false positive signals. From this figure, it can be seen that in the dual reporter system, suspiciously positive signals are suppressed to about 40% compared to positive signals. There may be multiple reasons for the origin of the remaining suspicious positives.

[0297] Another technical problem found in the preliminary experiment was that the frequency of the positive reaction reactor was not as high as expected based on the partition coefficient of RNA for the DEX enrichment phase. It can be assumed that although the target RNA molecules are temporarily concentrated in the DEX solution, the exposed part of the target RNA after binding to the Cas13 protein will be digested by the activated Cas13, and the target RNA-Cas13 complex will be released from the DEX-droplet. Based on this assumption, the Cas13a was tagged with the DBD repeated twice. As a result, the frequency of the positive reaction increased significantly, which is a result supporting the above assumption.

[0298] Figure 11 (c) are fluorescence images with and without DEX droplets obtained when the target RNA molecules are 3 fM and 30 fM. The upper part is the result of the measurement without using DEX droplets, and the lower part is the result of the measurement using DEX droplets. Obviously, in the measurement using DEX droplets, more fluorescent reactants were detected compared with the measurement without using ATPS.

[0299] Figure 11 (d) shows the probability (P positive ) of the positive reactor compared with the experimentally determined target RNA concentration in the measurement with (+DEX droplets) or without (-DEX droplets) DEX droplets. The black line represents the theoretical P positive estimated from the total reactor volume. The circles are the average values of P positive (n = 3), and the error bars represent s.d. The solid line is the fitting curve used to determine the proportionality coefficient compared with [target RNA]. The proportionality coefficient is 7.5×10 -4 [ / fM] in the measurement using DEX droplets and 2.4×10 -5 in the measurement without DEX droplets. The enrichment factor can be estimated to be 31 based on the ratio of these coefficients. The dashed line represents the limit of detection (LOD), and its concentration is equivalent to the average value of the false positive signals observed in the absence of target RNA + 3 s.d.

[0300] From this figure, it can be seen that regardless of the presence or absence of DEX droplets, except for the data point of 0.3 fM without DEX droplets, the data points show sufficient linearity with respect to the target concentration in each measurement. This data point of 0.3 fM without DEX droplets is P positiveThe point was strongly affected by the suspected positive reaction reactor. Based on the linear fit of the data points, the concentration factor determined by ATPS was 31. As a result, the limit of detection (LOD) was 0.089 fM, which is a lower value than the theoretical LOD of 0.47 fM estimated from the total reactor capacity. In this way, ATPS can improve the LOD beyond the theoretical limit through its concentration power.

[0301] In the past, a flow-focusing microfluidic system was reported as a method for preparing monodisperse DEX droplets (Mastiani, M.; Seo, S.; Jimenez, SM; Petrozzi, N.; Kim, MM, Flow regime mapping of aqueous two-phase system droplets in flow-focusing geometries. Colloid Surface A 2017, 531, 111-120., Zhang, QQ; Chen, JQ; Gai, HW, High-throughput-generating water-in-water droplet for monodisperse biocompatible particle synthesis. J Mater Sci 2019, 54(24), 14905-14913., Zhou, C.; Zhu, P.; Han, X.; Shi, R.; Tian, ​​Y.; Wang, L., Microfluidic generation of ATPS droplets by transient double emulsion technique. LabChip 2021, 21(14), 2684-2690.). However, in order to avoid the natural fusion of droplets, the droplets often solidify, which will damage the fluidity of the droplets or the internal water and, which are important for the concentration of biomolecules in the DEX droplets. In addition, due to the large size of DEX droplets made using microfluidic systems, digital bioassays using enzyme activity are difficult to implement in practice.

[0302] In this embodiment, a new method for using FRAD to prepare regular-shaped DEX droplets with a volume in femtoliter units was established. The femtoliter-scale DEX droplets developed in the embodiment were loaded into microcavities so that they could be arranged on micron-sized holes (cavities) without solidification. Therefore, it was confirmed that the droplets maintained the original properties of the DEX-enriched phase droplets.

[0303] In the embodiment, taking advantage of the function of DEX droplets to concentrate biomolecules from a PEG-enriched medium, on-chip concentration of DNA, RNA, and proteins, and subsequent digital bioassays were performed. Under these conditions, when proteins were given DBD, more than 30-fold concentration of ALP molecules and Cas13 / RNA complexes was achieved. As a result, Cas13 achieved sub-femtomolar detection in digital RNA counting without using off-chip concentration methods or external devices such as magnetic systems or electrodes. Such digital bioassays using DEX droplets are characterized by enabling a novel design strategy for mobile systems equipped with highly sensitive digital bioassays, greatly enhancing the expectations for realizing a portable diagnostic system in the field of home healthcare.

[0304] Figure 13 , a model of the concentration factor in digital assays using DEX droplets is shown. Among them, the relationship between the concentration coefficient and the partition coefficient in the test tube in digital bioassays using DEX droplets was modeled. The partition coefficient obtained in the test tube is given by the following formula.

[0305]

[0306] (where C DEX and C PEG represent the concentrations of the target in the DEX-enriched phase and the PEG-enriched phase. And the number of molecules in the solution is conserved.)

[0307] Due to the conservation of the number of molecules in the solution, it becomes the following formula.

[0308] C PEG ·V PEG +C DEX ·V DEX =C 0 ·V 0 ,

[0309] (where C 0 represents the initial concentration of the target. V 0 , V DEX , V PEGRepresent the total volume, the volume of DEX in the microcavity, and the volume of the PEG-rich phase in the flow channel ( Figure 7 (a), (b)).)

[0310] The concentration factor can be expressed as C DEX / C 0 .

[0311]

[0312] Among them, the volume ratio of PEG to DEX is defined as follows.

[0313]

[0314] R DEX / PEG , which is 1 / 125 in the digital biometric assay of droplets using DEX. It can be seen that V PEG is much larger than V DEX . Therefore, this can represent V 0 ≈V PEG .

[0315] The conclusion is that the enrichment factor can be expressed as follows.

[0316]

[0317] The partition coefficient of ALP-DBD in the test tube can be estimated to be 385, and the partition coefficient of RNA is relatively small at 164. The enrichment factor of ALP-DBD deduced from the model is 90, and the enrichment factor in the digital Cas13 assay can be estimated to be at least 68. Both are higher than the experimental values. According to the ratio of the reactor volume (the total amount of DEX droplets) to the flow cell volume, which is about 1 / 100, the upper limit of the enrichment is about 100( Figure 13 ).

[0318] In this system, both the volume ratio of the reactor volume to the flow cell volume and the partition coefficient of the protein with the attached DBD tag are the main determinants of the enrichment factor. Although the larger the flow cell volume, the higher the enrichment rate, the enrichment also requires a longer time.

[0319] Figure 14 , which is a graph showing the incubation time dependence of the enrichment of ALP-DBD. It shows the time dependence of the enrichment of ALP-DBD in the digital biometric assay using DEX droplets. The incubation time represented by the horizontal axis indicates the time from the injection of PEG containing 400 fM of ALP-DBD to the rinsing with FC40. The enrichment factor shown on the vertical axis is determined based on the ratio of the probability of the positive reaction reactor.

[0320] As can be seen from the figure, in this embodiment, most of the enzyme molecules are concentrated within 10 minutes. If the thickness of the flow cell microcavity is doubled, the concentration step requires more than 4 times the time. Therefore, by continuously introducing the buffer solution, an exponential increase in the concentration step can be avoided. It is also important that increasing the partition coefficient of the DBD protein is a beneficial strategy. It is considered that in addition to introducing more DBDs into the enzyme, developing a DBD with higher affinity is also effective.

[0321] Furthermore, in order to reduce the false positive signals in the highly sensitive digital RNA counting detection using the Cas13 protein, a dual reporter system was developed. The false positive signals that can be identified by the dual reporter system may originate from non-specific ribonucleases mixed in from the sample or the environment. Since ribonucleases are ubiquitous in biological samples, it is considered that this method can be effective in the digital RNA counting analysis of various clinical samples.

[0322] 4. Experiment on changing the ratio of the diameter / depth of the microcavity

[0323] Microcavities with changed ratios of diameter and depth were prepared, and an attempt was made to form a dextran reactor in the microcavities. The diameter of the microcavity was fixed at 3 μm, and the depth was changed by etching to fabricate multiple FRADs with different depths of the microcavity. The height of the flow path 40 for the solvent to flow through was 80 μm. An aqueous dextran solution was allowed to flow at about 1 μl / second. The results are shown in Figure 15 . As the ratio of the diameter to the depth increases, the dextran does not fill the entire microcavity and there are some residues.

[0324] 5. Antibody concentration experiment using a tag with an increased partition ratio for DEX

[0325] A tag (DBD tag) that can increase the partition ratio for dextran was conjugated to an antibody, and the antibody was concentrated into the dextran formed in the microcavity in the polyethylene glycol phase. Then, a polyethylene glycol phase containing an antigen against the antibody (here β-galactosidase: βgal) and a fluorescent substrate was introduced. After that, FC40 and fluorin oil were introduced for sealing. After 10 minutes, a fluorescence microscope was used to count the number of bright spots by digital quantification. The result was that the number of bright spots was approximately 108 times that in the case where neither dextran nor antibody was present. This result indicates that the antigen can be concentrated by the antibody concentrated in the dextran, and almost all of the antigen in the solution can be concentrated into the reactor. The detailed content of the experiment and the results are presented below.

[0326] To demonstrate the scalability of chip-based concentration methods for label-free proteins, a DEX droplet system containing IgY (Ab-DBD) with a DBD tag was developed. As a model for the target protein, β-galactosidase, a homotetrameric enzyme, was used. IgY molecules against β-galactosidase were labeled with DBD to produce Ab-DBD and introduced into DEX droplets. β-Galactosidase molecules added to the PEG solution were injected into the flow cell microchamber together with a fluorescent substrate. After a 10-minute incubation, the DEX droplets were sealed with oil, and digital bioassays of β-galactosidase were performed. Additionally, for comparison, digital bioassays without using DEX droplets and / or Ab-DBD were also performed.

[0327] Figure 16 , is a diagram showing on-chip concentration of a label-free enzyme using DEX droplets with Ab-DBD. (a) in the figure represents a schematic diagram of on-chip concentration of β-galactosidase enzyme. To efficiently capture the enzyme, antibody molecules against β-galactosidase were loaded into the DEX droplets before enzyme concentration. (b) in the figure is a fluorescence image of digital bioassays in the case of without DEX droplets and Ab-DBD (-, -), with DEX droplets but without Ab-DBD (+, -), and with DEX droplets and Ab-DBD (+, +). The bar graph on the right shows the number (%) of positive reaction reactors and P positive , enrichment factor relative to the condition of (-, -). (+, -) is 6.0, and (+, +) is 108.

[0328] From this result, it can be seen that the digital bioassay (with DEX droplets, without Ab-DBD: middle section) showed a higher number of positive reactions compared to the conventional bioassay (without DEX droplets, without Ab-DBD: upper section). On the other hand, with DEX droplets and Ab-DBD (lower section), there was a significantly higher number of positive reactions. This result indicates that the enrichment factor of DEX droplets and Ab-DBD is 108-fold, a value very close to the theoretical maximum of 125-fold. This enrichment factor is higher than the experimental results of DBD-ALP or DBD-Cas13. It is considered that this higher concentrating power is due to the fact that when the number of DBDs in the complex of β-galactosidase and Ab-DBD is 4 or more, the partition coefficient of the complex in the DEX enrichment phase becomes higher compared to DBD-ALP or DBD-Cas13 where the number of DBDs is 1.

[0329] 6. Experiment where the first solvent is DEX, the second solvent is PEG, and the biological substance is placed only in DEX

[0330] In the above experiment, biological substances such as ALP were mixed in PEG as the second solvent. An experiment was conducted to confirm whether the measurement could also be performed when the biological substance was mixed in the first solvent (DEX).

[0331] (1) Mix in such a way that the final concentration of DEX (~550 kDa) is 5%, TRITC-DEX is 0.1%, and Lambda DNA is 5 nM. The commercial product (product number 52194) purchased from TRITC-DEX or MERCK was diluted with ultrapure water (MQ) for adjustment. Lambda DNA was purchased from Nippon Gene and prepared by dilution with MQ.

[0332] (2) Flow 15 μL of the mixed solution into the flow cell.

[0333] (3) Flow 80 μL of 5.5% PEG (~35 kDa) containing SybrGold for fluorescently staining DNA into the flow cell to wash away the DEX in the flow path on the microcavity. SybrGold is a commercial product (S11494) purchased from ThermoFisher SCIENTIFIC and was mixed in the PEG solution to a concentration of x1.

[0334] (4) Using a laser scanning confocal microscope TCS SP8 X (Leica Microsystems, Germany) equipped with a white light laser (Leica Microsystems, Germany) and using a HyD detector (Leica Microsystems, Germany), observe the fluorescence of SybrGold and TRITC-DEX. The results are shown in Figure 18 as follows.

[0335] The upper part of the figure shows the fluorescence of TRITC-DEX and DNA fluorescently stained with SybrGold, and the lower part shows only the fluorescence of DNA. As shown in this figure, when PEG is flowed in after flowing in DEX added with the biological substance (DNA), the DNA remains in the DEX formed in the microcavity, and fluorescent microcavities can be confirmed.

[0336] 7. Experiment of interchanging DEX and PEG (an experiment showing that PEG can be used as the first solvent to be retained in the microcavity first, and then washed with DEX as the second solvent)

[0337] When using Figure 3In the experiment described below, DEX was used as the first solvent and PEG was used as the second solvent. After introducing DEX into the microcavity, it was rinsed with PEG. An experiment was conducted to confirm whether measurement was also possible when the first solvent was changed to PEG and the second solvent was changed to DEX.

[0338] (1) DEX and PEG were mixed such that their respective final concentrations (Final) were 10% / 10%, and centrifuged at 13,000 rpm for 5 minutes.

[0339] (2) Syringes were used to aspirate through injection needles inserted into the upper and lower sides of each container (Eppendorf tube) to separately recover the phase-separated PEG phase (upper phase) and DEX phase (lower phase).

[0340] (3) FITC-PEG was mixed into the recovered PEG phase described above to a concentration of 0.2%, and 15 μL was flowed into the flow path of the flow cell. FITC-PEG was purchased from Creative PEGWorks and diluted with MQ for preparation.

[0341] (4) 80 μL of the recovered DEX phase described above was flowed into the flow path to flush out the PEG in the flow path on the microcavity.

[0342] (5) Using a laser scanning confocal microscope TCS SP8 X (Leica Microsystems, Germany) equipped with a white light laser (Leica Microsystems, Germany) and a HyD detector (Leica Microsystems, Germany), the fluorescence of FITC-PEG was observed. The results are shown in Figure 19 as follows.

[0343] As shown in this figure, even when PEG was introduced as the first solvent into the flow path of the flow cell and then rinsed with DEX as the second solvent, microcavities emitting fluorescence from FITC-PEG could be confirmed. This indicates that PEG was retained in the microcavity.

[0344] 8. Results when the first solvent is PEG and the second solvent is phosphoric acid

[0345] In the above experiment, PEG was used as the first solvent and DEX was used as the second solvent, and an experiment was also conducted to confirm whether other solvents could also be used for measurement.

[0346] (1) They were mixed such that the final concentration of PEG (∼35 kDa) was 10% and the final concentration of FITC-PEG was 0.1%.

[0347] (2) Flow 15 μL of the mixed solution into the flow path of the flow cell.

[0348] (3) Flow 80 μL of phosphoric acid (K 3 PO 4 ) 1 M to wash away the PEG in the flow path on the microchamber.

[0349] (4) Use a laser scanning confocal microscope TCS SP8 X (Leica Microsystems, Germany) equipped with a white light laser (Leica Microsystems, Germany), and use a HyD detector (Leica Microsystems, Germany) to capture the fluorescence of FITC-PEG. The results are shown in Figure 20 .

[0350] As shown in this figure, even when phosphoric acid is used as the second solvent, microchambers emitting fluorescence derived from FITC-PEG can be confirmed. Not limited to such a combination of DEX and PEG, it can be confirmed that microreactors are formed by phase separation.

Claims

1. A method for treating a biological substance, which is a method for treating a biological substance by holding and / or concentrating the biological substance, characterized in that, comprising: A flow cell preparation step, in which a flow cell having a microcavity array device and a cover is prepared. The microcavity array device has a plurality of microcavities. Each microcavity is a recess with an open end and has a volume of 1 nanoliter or less. The cover communicates with the opening of the microcavity and defines a flow path commonly provided for the plurality of microcavities; A solvent preparation step, in which a first solvent and a second solvent, both of which are aqueous and will phase-separate when left standing at room temperature, are prepared. The first solvent and the second solvent have the properties that when phase separation occurs in the region surrounded by the microcavities and the flow path of the flow cell, the first solvent separates toward the microcavity side, and the biological substance is preferentially partitioned into the first solvent compared to the second solvent; A mixing step, in which the biological substance is mixed in the first solvent and / or the second solvent; A first inflow step, in which either the first solvent or the second solvent is allowed to flow into the flow path so that the solvent fills the microcavities and the flow path; A second inflow step, in which the other of the first solvent and the second solvent is allowed to flow into the flow path while the first solvent phase-separates toward the microcavity side and the second solvent phase-separates toward the flow path side, so that the biological substance contained in the first solvent in the microcavity does not diffuse into the second solvent and remains in the microcavity, and / or so that the biological substance contained in the second solvent moves into the first solvent in the microcavity and is concentrated.

2. The method for treating a biological substance according to claim 1, characterized in that, the first solvent and the second solvent are selected from the combinations shown in No. 1 to 12 of Table 1 below: 【Table 1】 3. The method for treating a biological substance according to claim 2, characterized in that, the first solvent is an aqueous solution of dextran, and the second solvent is an aqueous solution of polyethylene glycol.

4. The method for treating a biological substance according to claim 1, characterized in that, it includes a label attachment step, in which a label that can improve the partitionability to the first solvent is attached to the biological substance.

5. The method for treating a biological substance according to claim 4, characterized in that, the label is selected from the group consisting of a dextran-binding domain derived from "Leuconostoc mesenteroides" which is a lactic acid bacterium, dextran, dextran-like molecular polymers, DNA, RNA and their chemically modified molecules, and nucleic acid-like molecular polymers.

6. The method for treating a biological substance according to claim 1, characterized in that, after the second inflow step, it further includes a sealed solvent inflow step, in which a sealed solvent is allowed to flow into the flow path to flush out the solvent remaining in the flow path from the flow path.

7. A reaction detection method, comprising a detection step of detecting a reaction of a biological substance that has been retained and / or concentrated by the biological substance treatment method as described in claim 1.

8. The reaction detection method as described in claim 7, wherein, the biological substance at least comprises: target RNA, crRNA, which comprises a sequence complementary to a specific region of the target RNA, Cas13, which forms a complex with the crRNA and becomes an activated complex and cleaves the target RNA when the crRNA is used as a guide RNA to bind to the target RNA, a first RNA probe, which has a sequence that can be cleaved by the activated complex and is bound to a first fluorescent dye, and emits a first fluorescence when cleaved by the activated complex or a sequence-nonspecific ribonuclease, and a second RNA probe, which does not have a sequence that can be cleaved by the activated complex and is bound to a second fluorescent dye that emits a fluorescence distinguishable from the first fluorescent dye, and emits a second fluorescence when cleaved by the sequence-nonspecific ribonuclease, and the detection step comprises: a positive measurement step, in which a microcavity that emits only the first fluorescence is measured as a positive signal, and a suspected positive measurement step, in which a microcavity that emits both the first fluorescence and the second fluorescence is measured as a suspected positive signal caused by the sequence-nonspecific ribonuclease.

9. A biological substance treatment device, which is a biological substance treatment device for retaining and / or concentrating a biological substance, wherein, it comprises: a flow cell, which has a microcavity array device and a flow path, wherein the microcavity array device comprises a plurality of microcavities, each of the microcavities is a recess with one end open and has a volume of 1 nanoliter or less, and the flow path communicates with the opening of the microcavity and is provided in common with the plurality of microcavities, a first solvent and the second solvent, both the first solvent and the second solvent are aqueous and will phase-separate when standing at room temperature, and have the properties that: when phase separation occurs in the region surrounded by the microcavity and the flow path of the flow cell, the first solvent separates toward the microcavity side, and the biological substance is preferentially partitioned into the first solvent compared with the second solvent, a unit for mixing the biological substance in the first solvent and / or the second solvent, a first inflow unit, which allows either the first solvent or the second solvent to flow into the flow path so that the solvent fills the microcavities and the flow path, A second inflow unit that allows the other solvent of the first solvent and the second solvent to flow into the flow path, such that while the first solvent and the second solvent are phase-separated with the first solvent toward the microcavity side and the second solvent toward the flow path side, by bringing the first solvent into contact with the second solvent, the biological substance contained in the first solvent in the microcavity is not diffused into the second solvent and is retained in the microcavity, and / or such that the biological substance contained in the second solvent moves into the first solvent in the microcavity and is concentrated.

10. The biological substance processing device according to claim 9, wherein: the first solvent and the second solvent are selected from the combinations shown in Nos. 1 to 12 of Table 2 below: 【Table 2】 11. The biological substance processing device according to claim 10, wherein: the first solvent is an aqueous solution of dextran and the second solvent is an aqueous solution of polyethylene glycol.

12. The biological substance processing device according to claim 9, wherein: the biological substance has a tag that can improve the partitioning property with respect to the first solvent.

13. The biological substance processing device according to claim 12, wherein: the tag is selected from the group consisting of a dextran-binding domain derived from "Leuconostoc mesenteroides" which is a lactic acid bacterium, dextran, a dextran-like molecular polymer, DNA, RNA, and their chemically modified molecules, and a nucleic acid-like molecular polymer.

14. The biological substance processing device according to claim 9, wherein: it further comprises a sealing solvent.

15. A reaction detection device further comprising a detection unit that detects the reaction of the biological substance held and / or concentrated using the biological substance processing device according to claim 9.

16. The reaction detection device according to claim 15, wherein: the biological substance at least comprises: target RNA, crRNA which contains a sequence complementary to a specific region of the target RNA, Cas13 which forms a complex with the crRNA and becomes an activated complex and cleaves the target RNA when the crRNA is used as a guide RNA to bind to the target RNA, a first RNA probe which has a sequence that can be cleaved by the activated complex and is bound to a first fluorescent dye, and emits the first fluorescence when cleaved by the activated complex or a sequence-nonspecific ribonuclease, a second RNA probe which does not have a sequence that can be cleaved by the activated complex and is bound to a second fluorescent dye that emits a fluorescence distinguishable from the first fluorescent dye, and emits the second fluorescence when cleaved by the sequence-nonspecific ribonuclease, and the detection unit comprises: a positive measurement unit that measures a microcavity that emits only the first fluorescence as a positive signal, a suspected positive measurement unit that measures a microcavity that emits both the first fluorescence and the second fluorescence as a suspected positive signal caused by the sequence-nonspecific ribonuclease.

17. A biological substance processing device is a biological treatment device that uses a flow cell to hold and / or concentrate a biological substance. The flow cell has a microcavity array device and a flow path. The microcavity array device includes a plurality of microcavities, each of which is a recess with an open end and has a volume of 1 nanoliter or less. The flow path is connected to the opening of the microcavity and is provided in common with the plurality of microcavities. It is characterized in that it comprises: a first solvent and a second solvent, both of which are aqueous and phase-separate when left standing at room temperature. The first solvent has the property of separating toward the microcavity side when phase separation occurs in the region surrounded by the microcavity and the flow path of the flow cell, and the biological substance has a property of preferentially partitioning into the first solvent compared to the second solvent. a unit for mixing the biological substance in the first solvent and / or the second solvent; a first inflow unit that allows either the first solvent or the second solvent to flow into the flow path so that the solvent fills the microcavities and the flow path; a second inflow unit that allows the other of the first solvent and the second solvent to flow into the flow path, causing the first solvent to phase-separate toward the microcavity side and the second solvent to phase-separate toward the flow path side, while preventing the biological substance contained in the first solvent in the microcavities from diffusing into the second solvent and being retained in the microcavities, and / or causing the biological substance contained in the second solvent to move into the first solvent in the microcavities and be concentrated.

Citation Information

Patent Citations

  • Methods and kits for detecting pathogenic microorganisms

    JP2022031760A

  • Microscopic substance detection method and device for detecting microscopic substance

    WO2018181488A1