Cucumber CsEIN2 gene and application thereof in regulation and control of cucumber cold stress resistance
By gene editing the cucumber CsEIN2 gene, a cucumber cold-sensitive mutant with reduced cold tolerance was generated, which solved the problem of cucumber being sensitive to low temperature stress, significantly improved the cold damage index and reduced cold resistance.
Patent Information
- Application Number
- CN202510254756.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-06-17
AI Technical Summary
Cucumbers are sensitive to low temperature stress, which leads to the loss of green leaves of seedlings, shortening of internodes, and slow growth of plants. In severe cases, the plants are dry, stagnant and even die, limiting the possibility of long-season cultivation of cucumbers.
By identifying and using the cucumber CsEIN2 gene, CRISPR/Cas9 gene editing technology was used to perform site-directed mutations on the EIN2 gene to generate cucumber cold-sensitive mutants with reduced cold tolerance.
Through field hybrid pollination, molecular identification and phenotypic identification, it was proved that the CsEIN2 gene has a positive regulatory function in regulating the cold tolerance of cucumbers. When its function is lost or weakened, the cold damage index of cucumbers is significantly increased and the cold tolerance is reduced.
Smart Images
Figure BDA0005298038170000051 
Figure BDA0005298038170000052 
Figure BDA0005298038170000061
Abstract
Description
Technical Field
[0001] The present invention relates to the technical fields of plant genetic engineering and molecular breeding, and particularly relates to a cucumber CsEIN2 gene and its application in regulating cold tolerance of cucumbers. Background Art
[0002] Cucumber (Cucumis sativus L.) is an important vegetable crop widely cultivated in the world. Cucumber originated in tropical regions and prefers warm temperatures and is not cold-tolerant. The suitable growth temperature for cucumbers is: 25-30°C during the day and 13-15°C at night. When cucumbers encounter low temperatures during the seedling stage, they are prone to yellow and weak seedlings. After the seedlings are subjected to low-temperature stress, water-soaked spots appear on the leaves, chlorosis occurs, the internodes become shorter, the plant growth is slow, low temperature leads to an increase in deformed fruits and a decrease in the fruit setting rate. Seriously, the plants wither, stop growing, and even die. The long-season cultivation of cucumbers needs to span a long and cold winter, and low temperature is the key factor restricting the long-season cultivation of cucumbers, affecting the growth and development of cucumbers, limiting the cucumber planting distribution, and affecting the global cucumber yield. Breeding new cold-tolerant varieties suitable for long-season cultivation is the fundamental way to ensure stable and high yields of cucumbers.
[0003] Ethylene is a widely studied plant hormone that can regulate a variety of biological processes. Ethylene signals are perceived by a series of ethylene receptors, such as ethylene response 1 (ETR1), ETR2, ethylene response sensor 1 (ERS1), ERS2, and ethylene insensitive 4 (EIN4). Ethylene insensitive 2 (EIN2) is a key hub in the ethylene signal transduction pathway. The C-terminal domain of EIN2 (EIN2-CEND) is cleaved and rapidly translocated to the nucleus. Downstream of EIN2, ethylene insensitive 3 (EIN3) and EIN3 homologous gene (EIL1) regulate the transcriptional activation or inhibition of downstream ethylene-responsive genes. Currently, CsEIN3 and CsEIL have been homologously cloned in cucumbers, but there is no relevant report on the CsEIN2 gene. Summary of the Invention
[0004] The object of the present invention is to provide a cucumber CsEIN2 gene and its application in regulating cold tolerance of cucumbers in view of the above problems.
[0005] In order to achieve its object, the technical solution adopted by the present invention is:
[0006] The first aspect of the present invention provides an EIN2 protein, which is a protein with an amino acid sequence as shown in SEQ ID NO.5.
[0007] The second aspect of the present invention provides an EIN2 gene encoding the above-mentioned EIN2 protein.
[0008] The EIN2 gene is a DNA molecule as follows:
[0009] (a1) A DNA molecule with a coding region as shown in SEQ ID NO.4;
[0010] (a2) A DNA molecule as shown in SEQ ID NO.3.
[0011] The third aspect of the present invention provides a mutated EIN2 gene as described above. The mutation refers to a frameshift mutation caused by the insertion of a base A after the 32nd base at the 5'-end of the CDS sequence of the EIN2 gene shown in SEQ ID NO.4, or a frameshift mutation caused by the deletion of bases at positions 23-32 at the 5'-end of the CDS sequence of the EIN2 gene shown in SEQ ID NO.4.
[0012] The fourth aspect of the present invention provides the following applications of the above-mentioned EIN2 protein or the above-mentioned EIN2 gene or the above-mentioned mutated EIN2 gene:
[0013] (b1) Application in regulating cucumber cold tolerance;
[0014] (b2) Application in preparing cold-tolerant cucumbers;
[0015] (b3) Application in preparing cucumber cold-sensitive mutants.
[0016] For the above-mentioned applications, the regulation is that the EIN2 gene positively regulates cucumber cold tolerance. Inhibiting the expression and / or activity of the EIN2 gene in cucumbers will result in cucumbers being sensitive to cold stress and a decrease in cold tolerance;
[0017] The methods for inhibiting the EIN2 gene include gene editing and RNA interference.
[0018] For the above-mentioned applications, the EIN2 gene in the genome of the target cucumber is modified using gene editing technology to obtain gene-edited plants, and the function of the EIN2 gene in the gene-edited plants is lost or weakened.
[0019] For the above-mentioned applications, the EIN2 gene in the genome of the gene-edited plants undergoes the following mutations:
[0020] A frameshift mutation occurs due to the insertion of a base A after the 32nd base at the 5'-end of the CDS sequence of the EIN2 gene shown in SEQ ID NO.4, or
[0021] The base deletion at positions 23 - 32 from the 5'-end of the CDS sequence of the EIN2 gene shown in SEQ ID NO.4 results in a frameshift mutation.
[0022] Preferably, the CRISPR / Cas9 gene editing technology is used to perform site-directed mutagenesis on the EIN2 gene, and the target sequence of the CRISPR / Cas9 is as shown in SEQ ID NO.6.
[0023] The fifth aspect of the present invention provides a method for creating a cucumber cold-sensitive mutant. The method is a gene editing method, which uses the CRISPR / Cas9 gene editing technology to perform site-directed mutagenesis on the EIN2 gene to obtain a cold-sensitive cucumber mutant; the nucleotide sequence of the EIN2 gene is as shown in SEQ ID NO.3.
[0024] In the genome of the cold-sensitive cucumber mutant, a base A is inserted after the 32nd base from the 5'-end of the CDS sequence of the EIN2 gene, resulting in a frameshift mutation; or, in the genome of the cold-sensitive cucumber mutant, the base deletion at positions 23 - 32 from the 5'-end of the CDS sequence of the EIN2 gene results in a frameshift mutation; the CDS sequence of the EIN2 gene is as shown in SEQ ID NO.4, and the target sequence of the CRISPR / Cas9 is as shown in SEQ ID NO.6.
[0025] The beneficial effects of the present invention are as follows:
[0026] The cucumber CsEIN2 gene was identified for the first time. The CDS sequence of the cucumber CsEIN2 gene was cloned from a cucumber full-length cDNA library, and a gene editing vector pCas9-CsEIN2 targeting the CsEIN2 gene was constructed with this. Then, this plasmid was transformed into cucumbers to obtain gene-modified plants of CsEIN2. Through field cross-pollination, molecular identification, and phenotypic identification, it was proved that the CsEIN2 gene has the function of regulating cucumber cold stress tolerance and is a positive regulation. When the function of the CsEIN2 gene is lost or weakened, the cold injury index of cucumbers increases significantly, and the cold tolerance decreases. The present invention reveals for the first time that the cucumber CsEIN2 gene has the function of regulating cucumber cold tolerance.
[0027] The present invention not only lays an important foundation for revealing the genetic and biological mechanisms of cucumber cold tolerance, but also provides new gene resources for the cultivation of cold-tolerant cucumbers, and is of great significance for cucumber cold tolerance research and breeding of new low-temperature tolerant varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 It is a phylogenetic tree diagram of the amino terminus.
[0029] Figure 2 It is the structural map of the pKSE402 vector.
[0030] Figure 3 It is a comparison diagram of partial results of sequencing cucumber CsEIN2 mutant plants.
[0031] Figure 4 It is a comparison of cold tolerance between CsEIN2 mutants and wild-type seedlings: (A) Phenotypes of CsEIN2 mutants and wild-type seedlings after cold treatment; (B) Cold injury index of CsEIN2 mutants and wild-type seedlings after cold treatment. Specific implementation manners
[0032] The present invention will be further described below in conjunction with specific embodiments. The following embodiments are only used to illustrate the present invention and are not used to limit the scope of application of the present invention. Without departing from the spirit and essence of the present invention, any modification or replacement of the methods, steps or conditions of the present invention belongs to the scope of the present invention.
[0033] Unless otherwise specified, the reagent methods used in the following embodiments are all conventional methods; the reagents used, unless otherwise specified, are reagents that can be obtained from commercial channels.
[0034] The primer sequences used in the examples were all synthesized by Shanghai Bioengineering Co., Ltd.
[0035] Sources of experimental materials:
[0036] Cucumber 'CG104': It has strong growth potential, medium branching, relatively long internode length, large leaves, thick stems, the first female flower node is the 4th node, the female flower node rate is about 30%, the melon color is dark flower green, not bright, the fruit powder is light, the melon length is 18.9 cm, the handle length is 1.9 cm, the melon thickness is 4.1 cm, the cavity is 1.9 cm, the thorns are white and sparse, the tubercles are large, slightly ribbed, and there are few stripes. It is a cold-tolerant cucumber material. It is preserved in this laboratory and guaranteed to be distributed to the public for verification experiments within twenty years from the application date.
[0037] Example 1. Identification of Cucumber CsEIN2 Gene
[0038] Ethylene insensitive 2 (EIN2) is a key positive regulator in the ethylene signaling pathway and a hub gene in the ethylene signal transduction pathway.
[0039] In this embodiment, the Arabidopsis genome website ( https: / / www.arabidopsis.org / )Using the amino acid sequence of the EIN2 gene (Accession No. At5G03280) as an information probe, the CsaV3_6G039650 gene with 52% identity to the information probe was obtained through the BlastP program in the cucumber reference genome (http: / / cucurbitgenomics.org, Chinese Long genome v3), which is located on chromosome 6 of cucumber. Specific primer pairs for gene amplification were designed using the CsaV3_6G039650 gene sequence: forward primer (CsEIN2-F, SEQ ID NO.1) and reverse primer (CsEIN2-F, SEQ ID NO.2). Using fresh leaves of cucumber 'CG104' as materials, genomic DNA was extracted by the modified CTAB method. Using this genomic DNA as a template, PCR amplification was performed with the aforementioned specific primer pairs, and the amplification products were sent to a sequencing company for sequencing. The DNA sequence of the cucumber CsEIN2 gene obtained by sequencing is shown in SEQ ID NO.3, with a full length of 5625bp, containing 7 exons and 6 introns.
[0040] The sequences of the forward and reverse primers used for PCR amplification are as follows:
[0041] CsEIN2-F (SEQ ID NO.1): 5’-ATGGAATCTACGACATTG-3’;
[0042] CsEIN2-R (SEQ ID NO.2): 5’-CTATGAGCTATAAGGAAC-3’.
[0043] Take about 1g of cucumber leaf sample of 'CG104', put it into a mortar without RNase, add liquid nitrogen and grind it. Use the plant total RNA extraction kit of TIANGEN company to extract total mRNA. Using this mRNA as a template, the first strand of cDNA was synthesized using the transcription kit of Takara company (Japan). Subsequently, using the first strand of this cDNA as a template, PCR amplification was performed with the aforementioned forward primer (CsEIN2-F, SEQ ID NO.1) and reverse primer (CsEIN2-R, SEQ ID NO.2). After obtaining the CDS sequence of the cucumber CsEIN2 gene, it was cloned into a TA cloning vector. The CDS sequence of the cloned cucumber CsEIN2 gene is shown in SEQ ID NO.4, with a total of 3873bp, and its gene encodes a protein containing 1290 amino acids (the sequence is shown in SEQ ID NO.5).
[0044] Using the amino acid sequence shown in SEQ ID NO.5 to construct a phylogenetic tree with the amino-terminal sequences of pumpkin, melon, wheat, corn, Arabidopsis, soybean, and maize, as shown in Figure 1As shown in the figure, phylogenetic tree analysis shows that the cucumber CsEIN2 gene clusters with the EIN2 genes of other species in Cucurbitaceae, indicating that the CsEIN2 gene of cucumber is highly homologous to the EIN2 genes of other species, and proving that the fragment obtained by PCR amplification in this example is the cucumber CsEIN2 gene.
[0045] Example 2. Construction of Cucumber CsEIN2 Gene Editing Vector
[0046] For the CsEIN2 gene, target prediction was performed using the online website (http: / / skl.scau.edu.cn / ) for CRISPR / Cas9 technology. A specific site SEQ ID NO.6 (TTGCATACAACTCATCAGTC) was selected at the N-terminus of CsEIN2 to design sgRNA. The forward primer CsEIN2-sgRNA-F (SEQ ID No.7) and the reverse primer CsEIN2-sgRNA-R (SEQ IDNo.8) were used to prepare the Oligo dimer gRNA, and then the Oligo dimer was constructed into the pKSE402 vector backbone using the restriction enzyme BsaI and T4 ligase to obtain the pCas9-CsEIN2 vector. The vector pKSE402 for gene editing is from the research group of Huang Sanwen at the Chinese Academy of Agricultural Sciences. Its structural map is as Figure 2 shown, containing the Cas9 protein and the sgRNA expression cassette, which is modified on the basis of pKSE401 by inserting eGFP. When the vector is successfully transferred into plant cells, the eGFP sequence will be expressed and translated to produce green fluorescent protein, and the fluorescence emitted by eGFP can be seen under a fluorescence microscope. Furthermore, the luminescence situation of eGFP can be seen in vivo without damaging the plant, and the successfully transformed cell line or plant can be screened.
[0047] The nucleotide sequences of the sgRNA specific primers are as follows:
[0048] CsEIN2-sgRNA-F (SEQ ID NO.7): 5’-ATTGTTGCATACAACTCATCAGTC-3’;
[0049] CsEIN2-sgRNA-R (SEQ ID NO.8): 5’-AAACGACTGATGAGTTGTATGCAA-3’.
[0050] The specific operation steps are as follows:
[0051] (1) Annealing
[0052] PCR reaction system
[0053]
[0054] In the reaction system, CsEIN2-sgRNA-F is the Forwordoligo, and CsEIN2-sgRNA-R is the Reverseoligo.
[0055] PCR reaction program: React at 95°C for 4 minutes, and then cool to 20°C at a rate of 0.1°C decrease per second. After the reaction, dilute 10 times. The PCR reaction product is used in the next ligation reaction.
[0056] (2) Ligation:
[0057] Ligation system
[0058]
[0059] PCR instrument reaction program
[0060]
[0061] So far, the target sgRNA has been ligated to the vector through PCR amplification, restriction digestion, and ligation. The ligation product is transformed into competent Escherichia coli cells, and positive clones are screened to construct the cucumber CsEIN2 editing vector pCas9-CsEIN2. The correctly detected recombinant plasmid is transformed into the Agrobacterium tumefaciens strain EHA105, and genetic transformation is carried out using the cold-tolerant cucumber material 'CG104'.
[0062] Example 3. Obtaining of Transgenic Cucumber Plants
[0063] After transforming the constructed vector pCas9-CsEIN2 into Agrobacterium tumefaciens EHA105 in Example 2, cucumber transformation is carried out.
[0064] 1. Preparation and transformation of Agrobacterium tumefaciens competent cells
[0065] Take 100 μL of Agrobacterium tumefaciens competent cells and freeze-thaw them on ice. After adding 1 μg of plasmid DNA and gently mixing, place them on ice for 5 min, quickly freeze in liquid nitrogen for 5 min, then incubate in a 37°C water bath for 5 min. Add 700 μL of LB liquid medium, and resuscitate at 28°C and 200 rpm for 2 - 3 h. Then spread the bacterial solution evenly on a solid medium containing the corresponding antibiotic. Incubate inverted at 28°C for 2 - 3 d, and pick single colonies for PCR identification of positive clones.
[0066] 2. Cucumber genetic transformation
[0067] (1) Seed disinfection: Take 'CG104' cucumber seeds with plump grains and uniform size, soak them in 55°C warm water for 15 min to remove the seed coat. In a laminar flow hood, first wash with 75% absolute ethanol for 30 s, then soak in 6.5% NaClO solution for 15 min, gently shake during this period, and finally wash 5 times with sterile water.
[0068] (2) Seed germination: Transfer the disinfected seeds to the pre-prepared seed germination medium and place them in the dark at 28°C for about 1 day.
[0069] (3) Preparation of Agrobacterium liquid: Pick a single colony of positive Agrobacterium and place it in 1 mL of LB liquid medium containing kanamycin and rifampicin (50 mg / L). Incubate overnight at 28°C and 200 rpm. According to a ratio of 1:1000, add the cultured bacterial liquid to 5 mL of LB liquid medium containing kanamycin and rifampicin (50 mg / L). Incubate at 28°C and 200 rpm. When the OD value of the bacterial liquid is 0.6 - 0.8, centrifuge at 4000 rpm for 10 min to collect Agrobacterium. Resuspend the cells with IM liquid medium and dilute the bacterial liquid to an OD value of 0.2 - 0.3.
[0070] (3) Preparation of cucumber explants: Take the germinated seeds. In a laminar flow hood, cut off about 1 / 3 of the distal cotyledons, remove the hypocotyl, separate the two cotyledons, and a U-shaped wound will form at the proximal end of each cotyledon, thus obtaining the explants.
[0071] (4) Infection with Agrobacterium liquid: Place the cut cotyledon explants in a centrifuge tube containing the bacterial liquid. After ultrasonic treatment with an ultrasonic cleaner, evacuate the air and co-infect for 30 min.
[0072] (5) Co-culture: After the infection, spread the explants on filter paper to gently blot the attached bacterial liquid. Lay sterilized filter paper on the IM solid medium, and then evenly place the explants infected with the bacterial liquid on the medium. Culture in the dark at 25°C for 4 days.
[0073] (6) Differentiation culture: After 4 days of dark culture, insert the explants obliquely upward into the differentiation medium containing 100 mg / L kanamycin and culture under light for screening. Culture at 25°C for about 25 days, and observe the fluorescent buds using a fluorescence microscope.
[0074] (7) Elongation culture: Cut off the cotyledons of the well-growing fluorescent buds and place them in the elongation medium for culture under light.
[0075] (8) Rooting culture: Place the elongated fluorescent buds on the rooting medium to induce root formation.
[0076] (9) Transplanting: After strong roots have grown, acclimatize the plants in a light incubator and then transplant them to the greenhouse for growth.
[0077] Example 4. Identification of Transgenic Positive Lines of Cucumber
[0078] When the transgenic cucumbers in Example 3 grew in the greenhouse for one week, fresh plant leaves were taken, and DNA was extracted using the CTAB method. After PCR amplification of the sgRNA of the CsEIN2 gene and the Cas9 gene using the primer pairs of SEQ ID NO.9 and 10 and the primer pairs of SEQ ID NO.11 and 12 respectively, first-generation sequencing was performed. The sequencing results showed that 1 T0-generation heterozygous gene-edited plant was obtained. Table 1 lists the mutation positions of the gene-edited plant compared with the CDS sequence of the cucumber CsEIN2 gene shown in SEQ ID NO.4. A base (A) was added after the 32nd position of the sequence shown in SEQ ID NO.4 in the gene-edited plant, resulting in a frameshift mutation in the gene, premature termination of translation, encoding 16 amino acids, and the plant showed slow growth and reduced female flowers.
[0079] The Cas9 PCR primer sequences are as follows:
[0080] Csa9-F (SEQ ID NO.9): 5’-GACAAGAAGTACTCGATCGGC-3’;
[0081] Csa9-R (SEQ ID NO.10): 5’-GTCAGATCCTGATGGTGCTC-3’.
[0082] The sgRNA PCR primer sequences of the CsEIN2 gene are as follows:
[0083] EIN2-JC-F (SEQ ID NO.11): 5’-GTTGAAGCAAGGATGGATG-3’;
[0084] EIN2-JC-R (SEQ ID NO.12): 5’-ACCTGGGCAAGACCTCTTCCA-3’.
[0085] Table 1
[0086]
[0087] The CsEIN2 gene-edited plants at 1 month after transplantation flowered, and seeds were harvested 40 days after self-pollination; the T1-generation plants were screened, and the results are shown in Table 2. It was found that the offspring of the gene-edited plant #1-T0 were wild type, heterozygous mutation type, and homozygous mutation type ( Figure 3 showing a frameshift mutation with the insertion of a base A after the 32nd position of the CsEIN2 gene). The homozygous mutation types that could be screened out were insertion mutation (1bp) and deletion mutation (10bp). The function of the CsEIN2 homozygous mutation was completely lost, the seedling development was retarded, the plants were short, the growth was slow, there were no female flowers, and self-pollination could not be carried out for breeding.
[0088] Table 2
[0089]
[0090] Example 5. Phenotypic Identification of Transgenic Cucumber
[0091] 1. Molecular identification of hybrid progeny
[0092] The T1 homozygous mutant of CsEIN2 described in Example 4 has no female flowers and cannot self-pollinate and breed seeds. Moreover, the seedlings have slow development, short plants, slow growth, and the plants die later. Therefore, the #1-T0 mutant obtained in Example 4 was used as the male parent and crossed with cucumber 'CG104' as the female parent to obtain hybrid progeny. Since the previously constructed vector pCas9-CsEIN2 carries a GFP tag and has green fluorescence, fluorescent seeds (i.e., CsEIN2 heterozygous mutants, denoted as CsEIN2 CR ) were selected from the hybrid progeny of CG104(♀)×#1-T0(♂) for subsequent phenotype identification. The fluorescent seeds were sown in a seedling tray, divided into three replicates, with 8 individual plants in each replicate. After the cotyledons of the seedlings were flattened, DNA was extracted for sampling. The sgRNA of the CsEIN2 gene was amplified by PCR using the primers of SEQ ID NO.11 and 12, and then first-generation sequencing was performed. The sequencing results showed that all 24 plants were CsEIN2 heterozygous mutants, and the mutation type was the same as that of #1-T0. Next, a cold tolerance evaluation experiment was carried out.
[0093] 2. Cold tolerance evaluation
[0094] Cucumber 'CG104' (i.e., wild type) and CsEIN2 CR Cucumber seedlings were grown in an incubator (day: 28°C / 14h; night: 18°C / 10h) until they had two true leaves and one heart leaf, and then transferred to an artificial climate chamber for cold treatment at 4°C for 24h, and then recovered under normal growth conditions for 24h. There were 8 plants in each replicate, and three biological replicates were set up.
[0095] According to the degree of drying of the cotyledons and true leaves, the low-temperature injury was classified into six grades: Grade 0: No low-temperature injury symptoms were observed in the cotyledons and true leaves; Grade 1: The edges of the cotyledons or true leaves were dried; Grade 3: The dried area of the cotyledons and true leaves was less than 50%; Grade 5: Most of the cotyledons were dried, and the dried area of the true leaves was greater than 50% and less than 75%; Grade 7: All cotyledons were dried, and the dried area of the true leaves was greater than 75%; Grade 9: All cotyledons and true leaves were dried.
[0096] The cold injury index (CII) was calculated according to the low-temperature injury classification. The cold injury index can be used to measure the degree of injury of the seedlings. The calculation formula is:
[0097] CII = (0 × S0 + 1 × S1 + 3 × S3 + 5 × S5 + 7 × S7 + 9 × S9) / N × 9
[0098] Among them, "S0 - S9" represents the number of individual plants at each level, and "N" represents the total number of plants.
[0099] After low-temperature treatment, CsEIN2 CR and the chilling injury index of each experimental replicate of the wild type are shown in Table 3.
[0100] Table 3
[0101] CG104 <![CDATA[CsEIN2 CR <!-- 7 -->]]> Replicate 1 4.5 51.75 Replicate 2 6.75 60.75 Replicate 3 7.875 74.25 Mean 6.375 62.25
[0102] To sum up, as shown in Table 3, Figure 4 after the mutation of CsEIN2, the chilling injury index of transgenic plants increased significantly, and the cold tolerance decreased. The chilling injury traits of CsEIN2 CR seedlings were obvious.
Claims
1. An EIN2 protein, the amino acid sequence of which is shown in SEQ ID NO.
5.
2. An EIN2 gene encoding the EIN2 protein according to claim 1.
3. The EIN2 gene according to claim 2, characterized in that: The EIN2 gene is a DNA molecule of (a1) or (a2): (a1) a DNA molecule whose coding region is shown in SEQ ID NO.4; (a2) A DNA molecule as shown in SEQ ID NO.
3.
4. A mutant EIN2 gene, characterized in that: The mutation refers to a frameshift mutation caused by the insertion of a base A after the 32nd base from the 5' end of the CDS sequence of the EIN2 gene shown in SEQ ID NO.4, or a frameshift mutation caused by the deletion of bases from the 23rd to 32nd bases from the 5' end of the CDS sequence of the EIN2 gene shown in SEQ ID NO.
4.
5. Use of the EIN2 protein according to claim 1, the EIN2 gene according to claim 2 or 3, or the mutated EIN2 gene according to claim 4 in any of the following: (b1) Application in regulating cucumber cold stress tolerance; (b2) application in the preparation of cold-resistant cucumbers; (b3) Application in preparing cold-sensitive mutants of cucumber.
6. The use according to claim 5, characterized in that: The regulation is that the EIN2 gene positively regulates the cold tolerance of cucumbers. Inhibiting the expression and / or activity of the EIN2 gene in cucumbers will cause cucumbers to be sensitive to cold stress and have reduced cold tolerance; The method for inhibiting the EIN2 gene includes gene editing and RNA interference.
7. The use according to claim 6, characterized in that: The EIN2 gene in the target cucumber genome is modified using gene editing technology to obtain gene-edited plants, in which the function of the EIN2 gene is lost or weakened.
8. The use according to claim 7, characterized in that: The EIN2 gene in the genome of the gene-edited plant undergoes the following mutations: The CDS sequence of the EIN2 gene shown in SEQ ID NO.4 has a frameshift mutation caused by the insertion of a base A after the 32nd base at the 5' end, or, The CDS sequence of the EIN2 gene shown in SEQ ID NO.4 has a frameshift mutation due to a deletion of bases from positions 23 to 32 from the 5' end; Preferably, CRISPR / Cas9 gene editing technology is used to perform site-directed mutagenesis on the EIN2 gene, and the target sequence of the CRISPR / Cas9 is shown in SEQ ID NO.
6.
9. A method for creating a cold-sensitive mutant of cucumber, characterized by: The method is a gene editing method, which uses CRISPR / Cas9 gene editing technology to perform site-directed mutation on the EIN2 gene to obtain a cold-sensitive cucumber mutant; the nucleotide sequence of the EIN2 gene is shown in SEQ ID NO.
3.
10. The method according to claim 9, characterized in that: The CDS sequence of the EIN2 gene in the genome of the cold-sensitive cucumber mutant has a base A inserted after the 32nd base from the 5' end, resulting in a frameshift mutation; or, the CDS sequence of the EIN2 gene in the genome of the cold-sensitive cucumber mutant has a base deletion from the 23rd to 32nd base from the 5' end, resulting in a frameshift mutation; the CDS sequence of the EIN2 gene is shown in SEQ ID NO.4, and the target sequence of the CRISPR / Cas9 is shown in SEQ ID NO.6.