Engineering bacterium for producing ansamitocin as well as construction method and application of engineering bacterium

By overexpressing the FtsH gene and optimizing the fermentation conditions, the yield and fermentation efficiency of ascenin are improved, the problems of insufficient yield and high production costs in the existing technology are solved, and the industrial development of anti-tumor drugs are promoted.

CN120158409APending Publication Date: 2025-06-17SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311731565.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-15
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

The prior art has shortcomings in increasing the yield of ascetin and reducing production costs, which has affected the industrial development of anti-tumor drugs.

Method used

By overexpressing the cell division protein FtsH gene, the yield of ascenin is improved, and fermentation efficiency and yield are improved through optimization of fermentation conditions and genetic engineering.

Benefits of technology

It has achieved an increase of 60.5% of the production of ascetin, saving production costs, improving fermentation efficiency, and promoting the industrial development and clinical application of anti-tumor drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158409A_ABST
    Figure CN120158409A_ABST
Patent Text Reader

Abstract

The invention relates to an engineering bacterium for producing ansamitocin as well as a construction method and application of the engineering bacterium. FtsH protein is over-expressed in the engineering bacterium. The relationship between FtsH and ansamitocin has not been researched and reported. The invention finds that the cell division protein FtsH is related to ansamitocin synthesis, the overexpression of the FtsH can improve the yield of the ansamitocin, the industrial production cost of the ansamitocin can be saved, and the fermentation efficiency can be improved. The method has important significance for realizing industrial development of antitumor drugs in China, expanding the application range and promoting clinical diagnosis and treatment of cancers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and relates to an engineered bacterium for producing ansamitocin, a construction method and an application thereof. Background Art

[0002] Ansamitocin belongs to the macrolide antibiotics, which is similar in structure to maytansine from plants and has strong anti-tumor activity. Ansamitocin is mainly produced by Actinosynnemapretiosum, and its structure consists of a lactam ring formed by a fatty chain at both ends of a specific 3-amino-5-hydroxybenzonic acid (AHBA) unit. Ansamitocin contains four components: P1, P2, P3 and P4. Among them, ansamitocin-P3 is the main product, and its activity is close to that of maytansine molecules.

[0003] The researchers connected the C-3 ester chain of ansamitocin to a disulfide bond to form the DM1 molecule, which can be coupled with a variety of antibodies after DTT2 reduction to form antibody-coupled drugs. By targeting tumor cells, the toxicity of ansamitocin to normal cells is greatly reduced. In 2013, Trastuzumab emtansine (T-DM1), an antibody-coupled drug developed by Roche with ansamitocin as the active group, was approved by the US FDA and obtained marketing authorization. As an effective drug for the treatment of breast cancer, it has broad market prospects.

[0004] Ning et al. systematically optimized the post-modification pathway of ansamitocin biosynthesis based on the strain Actinosynnemapretiosum ATCC31280 through metabolic engineering, knocked out the gene ansa30 encoding glycosyltransferase, and eliminated the accumulation of the byproduct carbamylated-glycosylated AP-3 (ACGP-3). On this basis, overexpression of the gene asm10 encoding methyltransferase significantly reduced the accumulation of the byproduct N-demethyl-AP-3 (PND-3). By adding 0.5mM methionine and 40mM valine, the AP-3 yield was successfully increased to 246mg / L, which is 5 times that of the starting strain. Based on traditional mutagenesis, Du et al. further increased the AP-3 yield by 60% by overexpressing the genes asmUdpg and asm13-17 responsible for encoding the supply of ansamitocin biosynthesis precursors. Summary of the invention

[0005] In view of the deficiencies of the prior art, the object of the present invention is to provide an engineered bacterium for producing ansamitocin and a construction method and application thereof.

[0006] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides an engineered bacterium for producing ansamitocin, wherein the engineered bacterium overexpresses FtsH protein.

[0008] FtsH protein belongs to the AAA+ (ATPases Associated with diverse cellular Activities) protein family, exists in many bacteria and green plants, and contains one or more ATP binding domains. FtsH protein maintains the homeostasis inside the cell by finding and degrading proteins that are marked as unnecessary or damaged, such as those that are misfolded or missynthesized. FtsH plays a vital role in the process of cell division. By degrading unnecessary proteins, it ensures the normal growth of intracellular proteins and cell division function. No research has yet reported the relationship between FtsH and ansamitocin. The present invention reports that the cell division protein FtsH is related to the synthesis of ansamitocin. Overexpression of the FtsH gene can increase the production of ansamitocin, save the cost of industrial production of ansamitocin, and improve fermentation efficiency. It is of great significance to realize the industrialization development of anti-tumor drugs in my country, expand the scope of use, and promote clinical diagnosis and treatment of cancer.

[0009] Preferably, the amino acid sequence of the FtsH protein is shown in SEQ ID NO:1.

[0010] SEQ ID NO: 1:

[0011] MDRKRLLRNPLLWIVAVVLLFYVFSVLFDEDRNYHQVTTSQALQQVRDGKVKEATIEDKEQKLKLVLNDGSTFENHGLLMASYPASATDEVFTLVDQAGNKPQVETKVTQDSLLTQMLLYLVPLGLLLLLLMWMMNNAQGGGNRVLNFGKSKAKQLSKDMPKTTFADVAGAEEAVEELYEIKDFLQNPGRYQALGAKIPKGVLLYGPPGTGKTLLARAVAGEAGVPFYSISGSDFVEMFVGVGASRVRDLFEQAKQNAPCIIFVDEIDAVGRHRGAGMGGGHDEREQTLNQLLVEMDGFDSRGGIILIAATNRPDILDPALLRPGRFDRQIPVSAPDLKGRKQILRVHAKGKPLAPDTDLDGLAKRTVGFSGADLANVINEAALLTARQNGTVIDGSALEESVDRVIGGPARKSRIISEKEKKITAYHEAGHALAAWAMPDIDPVYKVTILARGRTGGHTLSVPEEDKDLMTRSEMIARLVFALGGRSAEELVFHEPTTGASNDIEQATKIARAMVTEYGMSSRLGAVKYGQEQGEPFLGRNAGRQADYSLEVAHEIDEEVRKLIEAAHTEAYEVLNTYRDVLDDLTLELIDKETLHQKDLERIFAGVEKRPRITQFNDFGNRIPSTKPPVKTPGELARERGEPWPPVVEDQVEAEPAALPAPAPETPQGPAQPQQVPAGANGVQHPPQQVTPGSGPPNYGAPPGWTPATVPGSGGQPTTPAWRPDPADADKRNFDSDPDNRK。

[0012] Preferably, the nucleotide sequence of the FtsH gene is as shown in SEQ ID NO:2.

[0013] SEQ ID NO:2:

[0014] ATGGACCGCAAGCGCCTGCTTCGCAACCCGCTGCTGTGGATCGTGGCGGTGGTGCTCCTCTTCTACGTCTTCAGCGTGCTCTTCGACGAGGACCGGAACTACCACCAGGTCACGACCTCCCAAGCCCTCCAACAGGTGCGGGACGGGAAGGTCAAGGAAGCCACGATCGAGGACAAGGAGCAGAAGCTCAAACTCGTCCTCAACGACGGTTCCACCTTCGAGAACCACGGCCTCCTGATGGCCTCGTACCCGGCCAGCGCCACGGACGAGGTGTTCACCCTGGTCGACCAGGCGGGCAACAAGCCGCAGGTCGAGACCAAGGTGACCCAGGACTCCCTGCTCACGCAGATGCTCCTGTACCTGGTGCCGCTGGGGCTGCTGCTCCTGCTGCTGATGTGGATGATGAACAACGCCCAGGGTGGCGGGAACCGCGTCCTCAACTTCGGCAAGTCCAAGGCAAAGCAGCTCTCCAAGGACATGCCCAAGACGACGTTC

[0015] GCCGACGTCGCGGGAGCCGAGGAGGCGGTGGAGGAGCTCTACGAGATCA

[0016] AGGACTTCCTCCAGAACCCCGGCCGCTACCAGGCGCTCGGGGCGAAGATC

[0017] CCGAAGGGCGTCCTGCTCTACGGGCCCCCCGGCACCGGCAAGACCCTGCT

[0018] GGCCAGGGCCGTCGCCGGTGAGGCGGGCGTGCCGTTCTACTCGATCTCCG

[0019] GCTCGGACTTCGTCGAGATGTTCGTCGGCGTCGGCGCCTCGCGCGTGCGC

[0020] GACCTGTTCGAGCAGGCCAAGCAGAACGCGCCCTGCATCATCTTCGTCGA

[0021] CGAGATCGACGCGGTGGGCCGCCACCGCGGCGCGGGCATGGGCGGCGGG

[0022] CACGACGAGCGCGAGCAGACGCTCAACCAGCTGCTCGTGGAGATGGACG

[0023] GCTTCGACTCGCGCGGCGGGATCATCCTGATCGCGGCGACCAACCGGCCC

[0024] GACATCCTCGACCCCGCCCTGCTGCGCCCCGGCCGCTTCGACCGGCAGAT

[0025] CCCGGTGTCCGCGCCGGACCTGAAGGGCCGCAAGCAGATCCTCCGGGTGC

[0026] ACGCCAAGGGCAAGCCGTTGGCCCCTGACACCGACCTCGACGGCCTGGCC

[0027] AAGCGCACCGTCGGGTTCTCCGGAGCCGACCTGGCCAACGTCATCAACGA

[0028] GGCCGCGCTGCTCACCGCCCGCCAGAACGGCACCGTCATCGACGGCTCCG

[0029] CGCTGGAGGAGTCGGTCGACCGCGTCATCGGCGGTCCCGCCCGCAAGAGC

[0030] CGGATCATCTCCGAGAAGGAGAAGAAGATCACGGCCTACCACGAGGCGG

[0031] GCCACGCGCTGGCCGCGTGGGCGATGCCGGACATCGACCCGGTCTACAAG

[0032] GTCACCATCCTCGCCAGGGGGCGCACCGGCGGTCACACGCTGTCCGTCCC

[0033] CGAGGAGGACAAGGACCTGATGACCAGGTCCGAGATGATCGCCCGGCTGG

[0034] TGTTCGCGCTCGGTGGCCGCTCGGCGGAGGAGCTCGTCTTCCACGAGCCC

[0035] ACCACCGGCGCGTCCAACGACATCGAGCAGGCGACCAAGATCGCCCGCGC

[0036] GATGGTCACCGAGTACGGCATGAGCTCCCGCCTCGGCGCCGTCAAGTACG

[0037] GCCAGGAGCAGGGCGAGCCGTTCCTCGGCCGCAACGCCGGTCGCCAGGC

[0038] CGACTACTCGCTGGAGGTCGCGCACGAGATCGACGAGGAGGTGCGCAAG

[0039] CTCATCGAGGCCGCCCACACGGAGGCCTACGAGGTGCTGAACACCTACCG

[0040] CGACGTCCTCGACGACCTGACGCTGGAGCTGATCGACAAGGAGACGCTCC

[0041] ACCAGAAGGACCTGGAGCGGATCTTCGCGGGCGTCGAGAAGCGCCCCCG

[0042] GATCACCCAGTTCAACGACTTCGGCAACCGCATCCCGTCGACCAAGCCGC

[0043] CGGTCAAGACCCCCGGCGAGCTGGCCAGGGAGCGCGGCGAGCCGTGGCC

[0044] GCCGGTGGTCGAGGACCAGGTCGAGGCCGAGCCCGCTGCACTGCCCGCG

[0045] CCCGCACCCGAGACCCCGCAGGGACCGGCCCAGCCGCAGCAGGTCCCCG

[0046] CTGGCGCCAACGGCGTCCAGCACCCGCCGCAGCAGGTCACCCCCGGCTCG

[0047] GGGCCGCCCAACTACGGGGCGCCCCCCGGCTGGACCCCGGCCACCGTGCC

[0048] GGGCAGCGGGGGCCAGCCGACCACACCCGCGTGGCGGCCGGACCCGGCGGACGCGGACAAGCGGAACTTCGACTCGGACCCGGACAACCGCAAGTGA.

[0049] In a second aspect, the present invention provides a method for constructing an engineered bacterium for producing ansamitocin, the method comprising:

[0050] (1) performing PCR using the FtsH gene as a template to obtain a PCR product;

[0051] (2) After the vector is digested with restriction endonucleases, it is ligated with the PCR product and transferred into competent cells for sequencing and plasmid extraction to obtain a recombinant vector;

[0052] (3) transferring the recombinant vector into the conjugative transfer strain;

[0053] (4) The strain containing the recombinant vector is mixed with the mycelium of the recipient bacteria, cultured, and the positive conjugates are screened.

[0054] Preferably, the source of the FtsH gene includes Actinosynnemapretiosum ATCC 31280.

[0055] Preferably, the vector is pLQ646 containing a strong promoter.

[0056] Preferably, the strong promoter comprises kasOp.

[0057] Preferably, the nucleotide sequence of the vector is as shown in SEQ ID NO:3.

[0058] SEQ ID NO:3:

[0059]

[0060] TGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAG

[0061] CATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAAT

[0062] TGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCT

[0063] GCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGC

[0064] GCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGC

[0065] GGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAAT

[0066] CAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGC

[0067] CAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCC

[0068] CCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAAC

[0069] CCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTG

[0070] CGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCC

[0071] CTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTT

[0072] CGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTT

[0073] CAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCG

[0074] GTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAG

[0075] CAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTA

[0076] ACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGC

[0077] CAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACC

[0078] ACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGA

[0079] AAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCT

[0080] CAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAA

[0081] AGGATCTTCACCTAGATCCTTTTGGTTCATGTGCAGCTCCATCAGCAAAAG

[0082] GGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTGATCGT

[0083] GCTATGATCGACTGATGTCATCAGCGGTGGAGTGCAATGTCGTGCAATACG

[0084] AATGGCGAAAAGCCGAGCTCATCGGTCAGCTTCTCAACCTTGGGGTTACC

[0085] CCCGGCGGTGTGCTGCTGGTCCACAGCTCCTTCCGTAGCGTCCGGCCCCTC

[0086] GAAGATGGGCCACTTGGACTGATCGAGGCCCTGCGTGCTGCGCTGGGTCC

[0087] GGGAGGGACGCTCGTCATGCCCTCGTGGTCAGGTCTGGACGACGAGCCGT

[0088] TCGATCCTGCCACGTCGCCCGTTACACCGGACCTTGGAGTTGTCTCTGACA

[0089] CATTCTGGCGCCTGCCAAATGTAAAGCGCAGCGCCCATCCATTTGCCTTTG

[0090] CGGCAGCGGGGCCACAGGCAGAGCAGATCATCTCTGATCCATTGCCCCTG

[0091] CCACCTCACTCGCCTGCAAGCCCGGTCGCCCGTGTCCATGAACTCGATGG

[0092] GCAGGTACTTCTCCTCGGCGTGGGACACGATGCCAACACGACGCTGCATC

[0093] TTGCCGAGTTGATGGCAAAGGTTCCCTATGGGGTGCCGAGACACTGCACC

[0094] ATTCTTCAGGATGGCAAGTTGGTACGCGTCGATTATCTCGAGAATGACCAC

[0095] TGCTGTGAGCGCTTTGCCTTGGCGGACAGGTGGCTCAAGGAGAAGAGCCT

[0096] TCAGAAGGAAGGTCCAGTCGGTCATGCCTTTGCTCGGTTGATCCGCTCCCG

[0097] CGACATTGTGGCGACAGCCCTGGGTCAACTGGGCCGAGATCCGTTGATCTT

[0098] CCTGCATCCGCCAGAGGCGGGATGCGAAGAATGCGATGCCGCTCGCCAGT

[0099] CGATTGGCTGAGCTCATGAGCGGAGAACGAGATGACGTTGGAGGGGCAA

[0100] GGTCGCGCTGATTGCTGGGGCAACACGTGGAGCGGATCGGGGATTGTCTT

[0101] TCTTCAGCTCGCTGATGATATGCTGACGCTCAATGCCGTTTGGCCTCCGACT

[0102] AACGAAAATCCCGCATTTGGACGGCTGATCCGATTGGCACGGCGGACGGC

[0103] GAATGGCGGAGCAGACGCTCGTCCGGGGGCAATGAGATATGAAAAAGCCT

[0104] GAACTCACCGCGACGTATCGGGCCCTGGCCAGCTAGCTAGAGTCGACCTG

[0105] CAGGTCCCCGGGGATCGGTCTTGCCTTGCTCGTCGGTGATGTACTTCACCA

[0106] GCTCCGCGAAGTCGCTCTTCTTGATGGAGCGCATGGGGACGTGCTTGGCA

[0107] ATCACGCGCACCCCCCGGCCGTTTTAGCGGCTAAAAAAGTCATGGCTCTGC

[0108] CCTCGGGCGGACCACGCCCATCATGACCTTGCCAAGCTCGTCCTGCTTCTC

[0109] TTCGATCTTCGCCAGCAGGGCGAGGATCGTGGCATCACCGAACCGCGCCG

[0110] TGCGCGGGTCGTCGGTGAGCCAGAGTTTCAGCAGGCCGCCCAGGCGGCCC

[0111] AGGTCGCCATTGATGCGGGCCAGCTCGCGGACGTGCTCATAGTCCACGAC

[0112] GCCCGTGATTTTGTAGCCCTGGCCGACGGCCAGCAGGTAGGCCGACAGGC

[0113] TCATGCCGGCCGCCGCCGCCTTTTCCTCAATCGCTCTTCGTTCGTCTGGAA

[0114] GGCAGTACACCTTGATAGGTGGGCTGCCCTTCCTGGTTGGCTTGGTTTCAT

[0115] CAGCCATCCGCTTGCCCTCATCTGTTACGCCGGCGGTAGCCGGCCAGCCTC

[0116] GCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTG

[0117] AAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG

[0118] CTGACGCCGTTGGATACACCAAGGAAAGTCTACACGAACCCTTTGGCAAA

[0119] ATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAAT

[0120] GACCCCGAAGCAGGGTTATGCAGCGGAAAAGATCCGTCGACCTGCAGGCA

[0121] TGCAAGCTCTAGCGATTCCAGACGTCCCGAAGGCGTGGCGCGGCTTCCCC

[0122] GTGCCGGAGCAATCGCCCTGGGTGGGTTACACGACGCCCCTCTATGGCCC

[0123] GTACTGACGGACACACCGAAGCCCCGGCGGCAACCCTCAGCGGATGCCCC

[0124] GGGGCTTCACGTTTTCCCAGGTCAGAAGCGGTTTTCGGGAGTAGTGCCCC

[0125] AACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGTAGGGTCGCCGAC

[0126] ATGACACAAGGGGTTGTGACCGGGGTGGACACGTACGCGGGTGCTTACGA

[0127] CCGTCAGTCGCGCGAGCGCGAGAGTTCGAGCGCAGCAAGCCCAGCGACA

[0128] CAGCGTAGCGCCAACGAAGACAAGGCGGCCGACCTTCAGCGCGAAGTCG

[0129] AGCGCGACGGGGGCCGGTTCAGGTTCGTCGGGCATTTCAGCGAAGCGCCG

[0130] GGCACGTCGGCGTTCGGGACGGCGGAGCGCCCGGAGTTCGAACGCATCCT

[0131] GAACGAATGCCGCGCCGGGCGGCTCAACATGATCATTGTCTATGACGTGTC

[0132] GCGCTTCTCGCGCCTGAAGGTCATGGACGCGATTCCGATTGTCTCGGAATT

[0133] GCTCGCCCTGGGCGTGACGATTGTTTCCACTCAGGAAGGCGTCTTCCGGC

[0134] AGGGAAACGTCATGGACCTGATTCACCTGATTATGCGGCTCGACGCGTCGC

[0135] ACAAAGAATCTTCGCTGAAGTCGGCGAAGATTCTCGACACGAAGAACCTT

[0136] CAGCGCGAATTGGGCGGGTACGTCGGCGGGAAGGCGCCTTACGGCTTCGA

[0137] GCTTGTTTCGGAGACGAAGGAGATCACGCGCAACGGCCGAATGGTCAATG

[0138] TCGTCATCAACAAGCTTGCGCACTCGACCACTCCCCTTACCGGACCCTTCG

[0139] AGTTCGAGCCCGACGTAATCCGGTGGTGGTGGCGTGAGATCAAGACGCAC

[0140] AAACACCTTCCCTTCAAGCCGGGCAGTCAAGCCGCCATTCACCCGGGCAG

[0141] CATCACGGGGCTTTGTAAGCGCATGGACGCTGACGCCGTGCCGACCCGGG

[0142] GCGAGACGATTGGGAAGAAGACCGCTTCAAGCGCCTGGGACCCGGCAAC

[0143] CGTTATGCGAATCCTTCGGGACCCGCGTATTGCGGGCTTCGCCGCTGAGGT

[0144] GATCTACAAGAAGAAGCCGGACGGCACGCCGACCACGAAGATTGAGGGTT

[0145] ACCGCATTCAGCGCGACCCGATCACGCTCCGGCCGGTCGAGCTTGATTGC

[0146] GGACCGATCATCGAGCCCGCTGAGTGGTATGAGCTTCAGGCGTGGTTGGA

[0147] CGGCAGGGGGCGCGGCAAGGGGCTTTCCCGGGGGCAAGCCATTCTGTCCG

[0148] CCATGGACAAGCTGTACTGCGAGTGTGGCGCCGTCATGACTTCGAAGCGC

[0149] GGGGAAGAATCGATCAAGGACTCTTACCGCTGCCGTCGCCGGAAGGTGGT

[0150] CGACCCGTCCGCACCTGGGCAGCACGAAGGCACGTGCAACGTCAGCATG

[0151] GCGGCACTCGACAAGTTCGTTGCGGAACGCATCTTCAACAAGATCAGGCA

[0152] CGCCGAAGGCGACGAAGAGACGTTGGCGCTTCTGTGGGAAGCCGCCCGA

[0153] CGCTTCGGCAAGCTCACTGAGGCGCCTGAGAAGAGCGGCGAACGGGCGA

[0154] ACCTTGTTGCGGAGCGCGCCGACGCCCTGAACGCCCTTGAAGAGCTGTAC

[0155] GAAGACCGCGCGGCAGGCGCGTACGACGGACCCGTTGGCAGGAAGCACT

[0156] TCCGGAAGCAACAGGCAGCGCTGACGCTCCGGCAGCAAGGGGCGGAAGA

[0157] GCGGCTTGCCGAACTTGAAGCCGCCGAAGCCCCGAAGCTTCCCCTTGACC

[0158] AATGGTTCCCCGAAGACGCCGACGCTGACCCGACCGGCCCTAAGTCGTGG

[0159] TGGGGGCGCGCGTCAGTAGACGACAAGCGCGTGTTCGTCGGGCTCTTCGT

[0160] AGACAAGATCGTTGTCACGAAGTCGACTACGGGCAGGGGGCAGGGAACG

[0161] CCCATCGAGAAGCGCGCTTCGATCACGTGGGCGAAGCCGCCGACCGACGA

[0162] CGACGAAGACGACGCCCAGGACGGCACGGAAGACGTAGCGGCGTAGCGAGACACCCGGGAAGCCTG。

[0163] Preferably, the conjugation transfer strain includes Escherichia coli ET12567 / pUZ8002.

[0164] Preferably, restriction endonucleases include NdeI and EcoRI.

[0165] Preferably, the recipient bacteria includes Actinosynnemapretiosum ATCC 31280.

[0166] Preferably, the culturing time in step (4) is 3-7 days, for example 3 days, 4 days, 5 days, 6 days, 7 days, etc. Other specific values ​​within the above numerical range can be selected and will not be described in detail here.

[0167] In a third aspect, the present invention provides a use of the engineered bacteria for producing ansamitocin according to the first aspect in producing ansamitocin.

[0168] In a fourth aspect, the present invention provides a method for producing ansamycin, the production method comprising: fermenting using the engineered bacteria for producing ansamycin described in the first aspect.

[0169] Compared with the prior art, the present invention has the following beneficial effects:

[0170] FtsH protein belongs to the AAA+ (ATPases Associated with diverse cellular Activities) protein family, exists in many bacteria and green plants, and contains one or more ATP binding domains. FtsH protein maintains homeostasis inside the cell by finding and degrading proteins that are marked as unnecessary or damaged, such as those that are misfolded or missynthesized. FtsH plays a vital role in the process of cell division. By degrading unnecessary proteins, it ensures the normal growth of intracellular proteins and cell division function. No studies have reported the relationship between FtsH and ansamitocin. The present invention reports that the cell division protein FtsH is related to the synthesis of ansamitocin. Overexpression of the FtsH gene can increase the production of ansamitocin by 60.5%, which can save the industrial production cost of ansamitocin and improve fermentation efficiency. It is of great significance to realize the industrialization development of anti-tumor drugs in my country, expand the scope of use, and promote the clinical diagnosis and treatment of cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0171] Figure 1 This is a map of the expression vector containing the gene for the synthesis of the cell division protein FtsH.

[0172] Figure 2 This is a graph showing changes in the production of ansamitocin after expressing the gene that synthesizes the cell division protein FtsH. DETAILED DESCRIPTION

[0173] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0174] Example 1

[0175] Cloning of the gene fragment synthesizing the cell division protein FtsH

[0176] 1 mL of the culture medium of Acetinosynnemapretiosum ATCC 31280 was taken, and the total genomic DNA of ATCC 31280 was extracted using a bacterial genome extraction kit (Tiangen). The fragment with FtsH was amplified by Phanta Max Super-Fidelity DNA Polymerase (Nuoweizan) using primers FP-1 and RP-1, and the size was about 2.2 kb.

[0177] The sequence of primer FP-1 is shown in SEQ ID NO:4, and the sequence of primer RP-1 is shown in SEQ ID NO:5.

[0178] SEQ ID NO: 4: ATTACATATGGACCGCAAGCGCCTG.

[0179] SEQ ID NO: 5: ATATGAATTCTCACTTGCGGTTGTCCGGGT.

[0180] The amplification system is as follows:

[0181] Table 1

[0182] Reagents Volume / μL 2*PCR Mix buffer 25 dNTP 1 DNA polymerase 1 XM201 genomic DNA 1 FP-1 2 RP-1 2 50% DMSO 5 Sterile water 13 Total 50

[0183] PCR amplification conditions were: 95°C pre-denaturation for 10 min, 95°C denaturation for 30 s, 65°C annealing for 30 s, 72°C extension for 3.5 min, 30 cycles; 72°C extension for 10 min. The correctness of the bands was checked by agarose gel electrophoresis.

[0184] Example 2

[0185] Construction of recombinant vector by restriction enzyme ligation

[0186] The Streptomyces expression vector pLQ646 and the amplified FtsH fragment were cut with NdeI and EcoRI, and then expressed by Gel Extraction Kit (Omega) was used to recover the linearized pLQ646 and the PCR fragment containing FtsH. DNA Ligation Kit (Takara) was used to connect the fragment and the vector. The connection system was configured according to the following ratio:

[0187] Table 2

[0188] Reagents Volume / μL Solution I 5 Linearized pLQ646 1 FtsH fragment after enzyme digestion 4 Total 10

[0189] The above system was placed at 16°C for 60 min and then immediately transferred to ice.

[0190] Example 3

[0191] Transformation of ligation products and screening of positive clones

[0192] Thaw the competent E.coli DH5α stored at -80℃ on ice, add 10μL of assembly product to each tube, and continue to place on ice for 10min. Then transfer to a 42℃ water bath for heat shock for 90s. Place on ice again for 90s. Add 500μL of LB medium to each tube, place in a 37℃ shaker to recover and culture for 30min. Then spread on LB solid medium with apramycin, and culture at 37℃ for 12 hours.

[0193] After the single clones were grown, 8 single clones were picked and placed in LB liquid culture medium supplemented with apramycin, cultured at 37°C for 8 hours, and then amplified using primers FP-2 and RP-2 using Vazyme, 2* Rapid Taq Master Mix (Novozyme), and positive clones that could amplify a 2.2 kb fragment were screened.

[0194] The sequence of primer FP-2 is shown in SEQ ID NO:6, and the sequence of primer RP-2 is shown in SEQ ID NO:7.

[0195] SEQ ID NO:6:ATGGACCGCAAGCGCCTG.

[0196] SEQ ID NO:7: TCACTTGCGGTGTCCGGGT.

[0197] The configuration method of the verification PCR system is as follows:

[0198] Table 3

[0199] Reagents Volume / μL PCR Mix 10 50% DMSO 2 Forward Primer 1 Reverse primer 1 Bacterial liquid 1 <![CDATA[ddH2O]]> 5 Total 20

[0200] PCR amplification conditions were as follows: 95°C pre-denaturation for 10 min; 95°C denaturation for 30 s, 65°C annealing for 30 s, 72°C extension for 2 min, 30 cycles; 72°C extension for 10 min. The correctness of the bands was checked by agarose gel electrophoresis.

[0201] Example 4

[0202] Transformation of the recombinant vector into Escherichia coli conjugative transfer strain ET12567

[0203] Thaw the competent cells of E.coli ET12567 / pUZ8002 stored at -80℃ on ice, add 5μL of the constructed recombinant vector to each tube, and continue to place on ice for 10 minutes. Then transfer to a 42℃ water bath for heat shock for 90 seconds. Place on ice again for 90 seconds. Add 500μL of LB medium to each tube, place in a 37℃ shaker to recover and culture for 30 minutes. Then spread on LB solid medium with apramycin, and culture at 37℃ for 12 hours.

[0204] After the single clones were grown, 8 single clones were picked and placed in LB liquid culture medium supplemented with apramycin, cultured at 37°C for 8 hours, and then screened by Vazyme, 2* Rapid Taq Master Mix (Novagen) using primers FP-2 and RP-2 to amplify positive clones of 3.5 kb fragments.

[0205] Example 5

[0206] Actinomyces pretti - Escherichia coli indirect and transfer

[0207] Activate E. coli ET12567 / pUZ8002 containing the recombinant plasmid on an LB plate containing kanamycin, chloramphenicol and apramycin. After culturing overnight at 37°C, pick a single clone into 5 mL of LB (containing the above antibiotics at a dilution of 1:1000) and culture at 37°C. After 20 hours, collect 1 mL of bacteria by centrifugation, wash twice with LB, and resuspend in 500 μL of LB.

[0208] The strain of A. pretiosum ATCC31280 was spread on a solid YMG (0.4% yeast extract, 1% malt extract, 0.4% glucose, 1.5% agar) plate for activation and cultured at 30°C for 3 days. 2 The mycelia were cultured in 10.3% TSBY medium (3% tryptone soy broth, 0.5% yeast extract, 10.3% sucrose) at 30° C. for 16 h. 1 mL of mycelia were collected by centrifugation, washed twice with antibiotic-free LB, and resuspended in 500 μL of LB.

[0209] The mycelium resuspended in LB was mixed with E. coli in a ratio of 1:1 and evenly spread on a plate containing 10 mM Mg 2+ YMG plates were incubated at 37°C. After 12 hours, the plates were covered with sterile water containing 2 mg nalidixic acid and 2 mg apramycin. The plates were blown dry and incubated at 30°C until zygotes appeared.

[0210] Example 6

[0211] Screening of positive clones

[0212] The conjugate was streaked onto a YMG plate containing nalidixic acid and apramycin. After a single colony was grown, it was selected and cultured in TSBY medium with apramycin. Two days later, the bacterial solution, the ET strain transformed with the recombinant plasmid as a positive control, and the wild-type A. pretiosum ATCC31280 genome as a negative control were used for PCR verification. Positive clones that could amplify a 3.5kb fragment were screened using Vazyme, 2* RapidTaq Master Mix (Novozyme) and primers FP-2 and RP-2.

[0213] The configuration method of the verification PCR system is as follows:

[0214] Table 4

[0215] Reagents Volume / μL PCR Mix 10 50% DMSO 2 Forward Primer 1 Reverse primer 1 Bacterial liquid 1 <![CDATA[ddH2O]]> 5 Total 20

[0216] PCR amplification conditions were as follows: 95°C pre-denaturation for 10 min; 95°C denaturation for 30 s, 65°C annealing for 30 s, 72°C extension for 2 min, 30 cycles; 72°C extension for 10 min. The correctness of the bands was checked by agarose gel electrophoresis.

[0217] Example 7

[0218] Ansamitocin fermentation

[0219] Under normal conditions, Actinomycetes preciousi and its mutants are cultured in TSBY liquid medium or YMG solid medium at 30°C. During fermentation, the mycelium stored in a 20% glycerol tube is first activated in YMG solid medium supplemented with 10.3% sucrose and cultured at 30°C for 48h. Then, a 1cm 2 The mycelium was inoculated into S1 seed medium and cultured at 30°C, 220 rpm for 24 h; 1.5 mL of the culture was transferred into S2 seed medium and cultured at 30°C, 220 rpm for 24 h; 3 mL (10%) of the culture was transferred into fermentation medium and cultured at 25°C, 220 rpm for 10 days.

[0220] The formula of S1 seed culture medium is ( / L): 30 g tryptone soy broth, 5 g yeast extract, 103 g sucrose, pH 7.5. Dispense into 250 mL conical flasks, 30 mL per bottle.

[0221] The formula of S2 seed medium is ( / L): 30g tryptone soy broth, 8g yeast extract, 103g sucrose, 500μL / L isopropanol, 500μL / L isobutanol, pH 7.5. Dispense into 250mL Erlenmeyer flasks, 30mL per bottle.

[0222] The formula of the fermentation medium is ( / L): 16 g yeast extract, 10 g malt extract, 103 g sucrose, 12 mL / L isopropanol, 5 mL / L isobutanol, 2 mM MgCl2, 40 mM valine, pH 7.5. Dispense into 250 mL Erlenmeyer flasks, 30 mL per bottle.

[0223] Example 8

[0224] Ansamitocin detection and quantification

[0225] The method for determining the content of ansamitocin is as follows: the ansamitocin fermentation broth is mixed with 2 volumes of methanol, and after ultrasonication for 30 minutes, 1 mL is taken and centrifuged at 12,000 rpm for 1 minute. The supernatant is filtered through a 0.22 μM filter membrane and directly analyzed by HPLC.

[0226] The HPLC method for determining the content of ansamitocin is as follows: the instrument model is Agilent 1260 (Agilent, USA), the chromatographic column model is Agilent Eclipse Plus C18 column (4.6×250mm, 5μm). The mobile phase ratio is 45% A (5 / 1000 formic acid water): 55% B (acetonitrile), and the analysis time for each sample is 10 minutes. The detector is an ultraviolet detector, and the wavelength is set to 254nm. The results are as follows: Figure 2 shown.

[0227] The yield of ansamitocin after expressing the cell division protein FtsH synthesis gene. The empty vector control is the fermentation yield of the strain obtained after A. pretiosum was transferred into the backbone vector without genes, and the FtsH synthesis gene is the fermentation yield of the strain obtained after A. pretiosum was transferred into the cell division protein FtsH synthesis gene expression element. Figure 2 It can be seen that the ansamitocin production of the strain obtained after the cell division protein FtsH synthetic gene expression element was transferred was higher than that of the control group.

[0228] The applicant declares that the present invention illustrates an engineered bacterium for producing ansamitocin and its construction method and application through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned embodiments, that is, it does not mean that the present invention must rely on the above-mentioned embodiments to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

[0229] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0230] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. An engineered bacterium for producing ansamitocin, characterized in that: The FtsH protein is overexpressed in the engineered bacteria.

2. The engineered bacteria for producing ansamycin according to claim 1, characterized in that: The amino acid sequence of the FtsH protein is shown in SEQ ID NO:

1.

3. A method for constructing an engineered bacterium for producing ansamitocin, characterized in that: The construction method comprises: (1) performing PCR using the FtsH gene as a template to obtain a PCR product; (2) After the vector is digested with restriction endonucleases, it is ligated with the PCR product and transferred into competent cells for sequencing and plasmid extraction to obtain a recombinant vector; (3) transferring the recombinant vector into the conjugative transfer strain; (4) The strain containing the recombinant vector is mixed with the mycelium of the recipient bacteria, cultured, and the positive conjugates are screened.

4. The method for constructing ansamitocin-producing engineered bacteria according to claim 3, characterized in that: The sources of the FtsH gene include Actinosynnemapretiosum ATCC 31280.

5. The method for constructing ansamitocin-producing engineered bacteria according to claim 3 or 4, characterized in that: The vector is pLQ646 containing a strong promoter; Preferably, the strong promoter comprises kasOp.

6. The method for constructing an engineered bacterium for producing ansamitocin according to any one of claims 3 to 5, characterized in that: The conjugative transfer strain includes Escherichia coli ET12567 / pUZ8002.

7. The method for constructing an engineered bacterium for producing ansamitocin according to any one of claims 3 to 6, characterized in that: The restriction endonucleases include NdeI and EcoRI.

8. The method for constructing an engineered bacterium for producing ansamycin according to any one of claims 3 to 7, characterized in that: The recipient bacteria include Actinosynnemapretiosum ATCC 31280; Preferably, the culturing time in step (4) is 3-7 days.

9. Use of the engineered bacteria for producing ansamitocin according to claim 1 or 2 in producing ansamitocin.

10. A method for producing ansamitocin, characterized in that: The production method comprises: fermenting using the engineered bacteria for producing ansamitocin according to claim 1 or 2.