Screening of ribosome binding sequence and application of ribosome binding sequence in construction of inositol recombinant bacteria

By constructing and optimizing the ribosome binding sequence (RBS) screening library, the problem of low gene expression regulation efficiency in inositol fermentation production was solved, and the construction and efficient fermentation production of inositol high-yield strains were achieved.

CN120158447APending Publication Date: 2025-06-17HANGZHOU OUHE BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311501384.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2022-11-29
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

The prior art is difficult to achieve efficient gene expression regulation in inositol fermentation production, resulting in low inositol production efficiency and low conversion rate or yield.

Method used

By constructing a ribosome binding sequence (RBS) screening library, the expression cassette of IPS and IMP genes is optimized and applied to the construction of inositol recombinant strains to improve the fermentation production efficiency of inositol.

Benefits of technology

The construction of the high-yield strain of inositol was achieved. The yield of strain OH-MI4 reached 53g/L after fermentation of 96 hours, which significantly improved the production efficiency of inositol.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158447A_ABST
    Figure CN120158447A_ABST
Patent Text Reader

Abstract

According to the invention, an RBS sequence for coordinating key genes of an inositol metabolic pathway is obtained by constructing an RBS screening library and a high-throughput screening method, and a recombinant strain for fermentation production of inositol is constructed by using the RBS sequence. The yield of the inositol fermentation strain is greatly improved, and the method has important economic value and scientific research value for inositol production.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of the application with the application date of November 29, 2022, application number 202211518107.6, and invention title "Screening of Ribosome Binding Sequences and Their Application in the Construction of Inositol Recombinant Bacteria". Technical Field

[0002] The present invention belongs to the field of biotechnology, and particularly relates to a gene regulatory element for the inositol metabolic pathway and the construction of inositol-producing strains. Background Art

[0003] Inositol is a precursor for the synthesis of scyllo-inositol and glucuronic acid, widely distributed in animals and plants, and is a growth factor for animals and microorganisms. Inositol has multiple cis-trans isomers, and the naturally occurring isomer is cis-1,2,3,5-trans-4,6-cyclohexanehexol. There are several different ways to produce inositol. First, inositol hexaphosphate is hydrolyzed under acidic / alkaline conditions to produce inositol, but the disadvantage is that acids / alkalis are prone to cause environmental pollution. Second, inositol is produced from rice bran and cake meal. Phytate calcium is extracted from rice bran or bran and hydrolyzed under pressure to produce inositol, but the disadvantages are low production efficiency, high requirements for production equipment, and easy environmental pollution. Third, inositol is produced by an in vitro four-enzyme cascade reaction, but the disadvantage is the high cost of preparing enzymes. First, starch is catalyzed by α-glucan (or maltodextrin) phosphorylase and phosphoglucomutase to obtain glucose-6-phosphate (G-6-P), and then inositol-3-phosphate synthase (IPS) and inositol monophosphatase (IMP) are cascaded to catalyze to obtain inositol, but the disadvantages are that the enzymes are unstable and the production cost of the enzymes is high. Fourth, inositol is produced by an in vitro three-enzyme catalysis. The three enzymes are polyphosphate glucokinase (PPGK), inositol-3-phosphate synthase, and inositol monophosphatase, but the disadvantages are complex product separation and purification, high production cost of the enzymes, and unstable enzymes. Fifth, inositol is produced by fermentation. Glucose is used as the starting material, phosphorylated to produce glucose-6-phosphate, cyclized and isomerized by inositol-3-phosphate synthase to produce inositol-3-phosphate, and then catalyzed by inositol monophosphatase to produce inositol. The main challenge is to balance the metabolic flux of glucose-6-phosphate between cell growth and product formation.

[0004] According to literature and patent reports, the production of inositol by fermentation mainly involves overexpressing ips (encoding inositol-1-phosphate synthase), imp (encoding inositol monophosphatase), and glpK (encoding glycerol kinase), and knocking out competing metabolic pathways to obtain recombinant strains. However, after the metabolic pathway in the recombinant strain is modified, the natural metabolic pathway is changed, and the overexpressed genes need to be metabolically regulated to adapt to the new metabolic pathway system, thereby improving the production efficiency of inositol. Otherwise, the conversion rate or yield will be low. For example, during the fermentation of inositol by recombinant strains, insufficient expression of IPS will limit the synthesis of products, and the commonly used gene expression detection methods cannot meet the requirements of high-throughput screening. Therefore, providing an efficient high-throughput screening method to facilitate the regulation of gene expression during the transformation of recombinant bacteria, while obtaining gene elements suitable for inositol metabolic regulation, constructing a highly coordinated bacterial metabolic pathway, and obtaining strains with improved transformation efficiency are urgent problems to be solved in the fermentation production of inositol. Summary of the Invention

[0005] Starting from the ribosome binding sequence (RBS) that regulates gene expression, the present invention constructs a screening library of ribosome binding sequences, obtains ribosome binding sequences capable of regulating the expression of ips and imp genes, constructs expression cassettes of ips and imp genes, and applies them to construct inositol recombinant strains for the fermentation production of inositol.

[0006] One aspect of the present invention: A RBS screening library is constructed. First, a plasmid for blue-white screening is constructed. The target gene ips is linked to the lacZα through designed nucleotide bases. The translated fusion protein (IPS-LacZα) can be used for color screening by binding to the LacZω fragment on the genome. This plasmid expresses ips (encoding inositol-1-phosphate synthase), imp (encoding inositol monophosphatase), and glpK (encoding glycerol kinase), and places the above genes under the regulation of RBS. The RBS library is established by using primers containing eight degenerate bases, using the above expression plasmid as a template, and constructing the library by PCR amplification. The host strain with the lacZα fragment knocked out is used as the chassis strain for blue-white screening. The constructed RBS region library is transformed into the chassis strain and spread on a plate containing IPTG and X-Gal for screening.

[0007] Another aspect of the present invention: A chassis strain for inositol fermentation is constructed, and the following gene operations are carried out during the construction of the strain:

[0008] 1) Knock out pgi encoding glucose phosphate isomerase;

[0009] 2) Knock out zwf encoding glucose-6-phosphate dehydrogenase;

[0010] 3) Knock out pykF or pykA encoding pyruvate kinase;

[0011] 4) The ips, imp, and glpK genes were transferred.

[0012] Those skilled in the art can understand that gene knockout can be carried out in a manner known in the prior art, so that the activity of the enzyme is reduced or inactivated. The knockout operation targets the endogenous enzyme gene of the starting microorganism, so that the activity of the above endogenous enzyme in the microorganism is reduced or inactivated.

[0013] Those skilled in the art can understand that the international enzyme number of pyruvate kinase is EC2.7.1.40, also known as phosphopyruvate kinase and pyruvate phosphotransferase. There are usually two types of pyruvate kinases in bacteria, namely type I pykF pyruvate kinase (PykF) and type II pyruvate kinase (PykA). Moreover, there are multiple isozymes of this enzyme in the same organism. Those skilled in the art can understand that gene knockout of any of its isozymes will affect the further metabolism of pyruvate.

[0014] Those skilled in the art can understand that knocking out the pgi, zwf, and pykF genes can increase the accumulation of inositol, and knocking out the isozymes genes thereof will have the same or similar effects.

[0015] Another aspect of the present invention: The screened RBS is used for the regulation of ips and imp, and is constructed in the production strain for inositol fermentation to obtain a high-yield inositol strain.

[0016] Genes can be expressed individually or in tandem. In an embodiment of the present application, the ips gene, imp gene, and glpK gene are expressed in tandem. The ips gene and the imp gene are connected by the nucleotide sequence shown in Sequence 3. IPS and LacZα are fused and expressed by connecting with a linker peptide. The nucleotide sequence of the linker peptide is as shown in Sequence 5, and the corresponding amino acid sequence is as shown in Sequence 4.

[0017] The overexpressed genes of the present invention can exist in the form of plasmids or be integrated into the genome. One or more genes related to by-products on the genome can be replaced.

[0018] In the present invention, LacZα is connected behind the target protein through a short peptide, so that the expression level of the target gene can be accurately screened by the blue-white screening strategy. At the same time, the chassis strain is constructed into a △lacZα genotype, and the library is directly screened in the chassis strain, avoiding the problem of poor consistency of gene elements after the construction of industrial strains during the screening process of gene elements.

[0019] An embodiment of the present application discloses a method for screening ribosome binding sequences of genes, which includes constructing a strain lacking the lacZα gene, establishing a ribosome binding sequence library, transferring the ribosome sequence screening library into the strain lacking the lacZα gene, inoculating the transformants into a medium containing X-gal, and screening the ribosome binding sequences according to the color change. It is characterized in that the ribosome binding sequence library is constructed by recombining the ribosome binding sequence with the target gene to construct a target gene expression cassette, and fusing the target gene with the lacZ gene. Preferably, the fusion of the ribosome binding sequence is carried out by the PCR method. More preferably, the target gene is the key gene for inositol production, inositol-1-phosphate synthase gene (ips) and / or inositol monophosphatase gene (imp).

[0020] Optimizing the RBS sequence relying on the blue-white screening strategy: The principle of blue-white screening is that two catalytically inactive fragments, lacZα and lacZω, combine near each other to form an enzyme with β-galactosidase activity, which can catalyze the decomposition of the chromogenic agent X-Gal (5-bromo-4-chloro-3-indolyl galactoside) to obtain a blue substance (as Figure 5 shown). Optimization of the soluble expression of IPS. Here, lacZα is fused with the target protein for expression, and the expression level of the IPS protein is judged according to the color development result.

[0021] In one embodiment, the present application used several forward mutations in the RBS region, and after verification, a high-inositol-producing strain OH-MI4 was obtained. It was deposited with the patent depositary on November 14, 2022, with the deposit number CCTCC NO: M20221796, the classification name Escherichia coli BW25113, the depositary unit is the China Center for Type Culture Collection, and the deposit address is Wuhan University, Wuhan, Hubei, China. After fermentation verification, the use of the plasmid containing this sequence significantly increased the inositol yield. The yield of strain OH-MI4 reached 53 g / L after 96 h fed-batch fermentation. Brief Description of the Drawings

[0022] Figure 1 It is: the principle of blue-white screening of ribosome binding sequence (RBS);

[0023] Figure 2 It is: the map of p-IPS-lacZα-IMP-glpK;

[0024] Figure 3 It is: the schematic diagram of the position of ribosome binding sequence (RBS);

[0025] Figure 4 It is: the fermentation of transformants M1, M2, M3, M4, M5, M6, M7;

[0026] Figure 5are: fermentation of OH-MI4, OH-MI5 and OH-MI6;

[0027] Figure 6 a is: the liquid chromatography spectrum of the standard sample;

[0028] Figure 6 b is: the liquid chromatography spectrum of the fermentation broth. Specific Embodiments

[0029] The present invention is further illustrated by the following embodiments, but any embodiment or combination thereof should not be construed as limiting the scope or implementation manner of the present invention. The scope of the present invention is defined by the appended claims. Combining this specification and the general knowledge in the art, those of ordinary skill in the art can clearly understand the scope defined by the claims. Without departing from the spirit and scope of the present invention, those skilled in the art can make any modifications or changes to the technical solutions of the present invention, and such modifications and changes are also included within the scope of the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods; the reagents, materials, etc. used, unless otherwise specified, can all be obtained from commercial channels.

[0031] In the following embodiments, DH5α is a product of masterbio (https: / / www.masterbio.shop / ), and the product number is TSC-C14.

[0032] In the following embodiments, the restriction enzyme DpnⅠ is a product of NEB (http: / / www.neb-china.com / ), and the catalog number is R0176V.

[0033] In the following embodiments, the plasmids pTrc99a-Kan, pMal-c4X and pKD46 are products of miaolingbio (http: / / www.miaolingbio.com / ), and the product numbers are P8575, P1362 and P0098 respectively.

[0034] In the following embodiments, the kits used for one-step cloning and PCR are products of Vazyme, and the product numbers are C112-01 and P505-d1 respectively.

[0035] In the following embodiments, the product purification kit and gel extraction kit are products of Axygen, and the product numbers are AP-PCR-250 and AP-GX-250G respectively.

[0036] In the following embodiments, the bacterial genomic DNA extraction kit is a product of Tiangen Biochemical Technology (Beijing) Co., Ltd., and the product number is DP302.

[0037] In the following examples, the antibiotics and conventional reagents are all products of Sangon Biotech (Shanghai) Co., Ltd. (https: / / www.sangon.com / ).

[0038] In the following examples, the codon optimization and synthesis of foreign genes, primer synthesis, and sequencing work were completed by Tsingke Biotechnology Co., Ltd.

[0039] The plasmid pOH5899 used in the following examples was constructed and stored in the laboratory.

[0040] The primers used in the present invention are shown in the following table:

[0041]

[0042]

[0043]

[0044]

[0045]

[0046] Using Escherichia coli BW25113 as the starting strain, gene editing was carried out by a two-step homologous recombination method. The specific operation method refers to the following literature: Kaemwich, Jantama, Xueli, et al. Eliminating side products and increasing succinate yields in engineered strains of Escherichia coli C [J]. Biotechnology & Bioengineering, 2008(101)5: 881-893. Knock out the glucose isomerase gene pgi and the glucose-6-phosphate dehydrogenase gene zwf to reduce the consumption of glucose-6-phosphate, the precursor of inositol. Knock out the pyruvate kinase gene pykF to reduce the consumption of phosphoenolpyruvate and improve the efficiency of the glucose phosphotransfer system (PTS).

[0047] Example 1. Construction of the △pgi knockout cassette and the BW25113△pgi strain

[0048] 1.1. Construction of the △pgi knockout cassettes pgi-1 and pgi-2

[0049] 1) Using plasmid pOH5899 as a template, PCR amplification was performed with the primer pair Sp-pgi-cat-up / Sp-pgi-SacB-down, and verified by agarose gel electrophoresis to obtain a single target band pgi-cat-SacB;

[0050] The amplification system was: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each of each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA Polymerase (2.5 U / μl) 1 μl, distilled water 20 μl, with a total volume of 50 μl.

[0051] The amplification conditions were: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 1 minute (30 cycles); extension at 72°C for 5 minutes (1 cycle).

[0052] 2) After purifying and recovering the above single target band pgi-cat-SacB, the methylated plasmid template was digested with the restriction enzyme DpnⅠ at 37°C for 30 minutes.

[0053] 3) The fragment pgi-cat-SacB after digesting the template was purified and verified by sequencing to obtain the first recombinant fragment pgi-1 of the △pgi genotype.

[0054] 4) Using the Escherichia coli BW25113 genome as a template, amplification was performed with primers pgi-up-F and pgi-up-R, verified by agarose gel electrophoresis, digested with DpnⅠ for the template, purified and recovered to obtain the pgi-up fragment.

[0055] The amplification system was: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each of each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA Polymerase (2.5 U / μl) 1 μl, distilled water 19 μl, with a total volume of 50 μl.

[0056] The amplification conditions were: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 0.5 minute (30 cycles); extension at 72°C for 5 minutes (1 cycle).

[0057] 5) Using the Escherichia coli BW25113 genome as a template, amplify with primers pgi-down-F and pgi-down-R, verify by agarose gel electrophoresis, digest the template with DpnⅠ, purify and recover to obtain the pgi-down fragment.

[0058] The amplification system is as follows: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each of each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA Polymerase (2.5 U / μl) 1 μl, distilled water 19 μl, with a total volume of 50 μl.

[0059] The amplification conditions are: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 0.5 minutes (30 cycles); extension at 72°C for 5 minutes (1 cycle).

[0060] 6) Using pgi-up and pgi-down as templates, perform overlapping PCR amplification with primers pgi-up-F and pgi-down-R, verify by agarose gel electrophoresis, digest the template with DpnⅠ, purify and recover to obtain the pgi-2 fragment.

[0061] The amplification system is as follows: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each of each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA Polymerase (2.5 U / μl) 1 μl, distilled water 19 μl, with a total volume of 50 μl.

[0062] The amplification conditions are: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 1 minute (30 cycles); extension at 72°C for 5 minutes (1 cycle).

[0063] 1.2 Construction of BW25113△pgi Strain

[0064] 1) Prepare the chassis strain BW25113 into chemically competent cells using a conventional preparation method, referring to the following book: J. Sambrook, D.W. Russell. Molecular Cloning: A Laboratory Manual [M]. Science Press, 2002.

[0065] 2) The plasmid pKD46 was transformed into the chassis strain, cultured at 30°C for 10-12 h, and the transformants were picked and inoculated into LB medium, and ampicillin and arabinose were added (final concentrations were 50 mg / L and 2 g / L, respectively).

[0066] 3) The inoculated strain was prepared into a competent state for electroporation transformation, and ampicillin and arabinose (final concentrations were 50 mg / L and 2 g / L, respectively) were added during the competent state culture.

[0067] 4) The first recombinant fragment pgi-1 was electroporated into competent cells, and plated on a chloramphenicol and ampicillin double-resistant plate, and cultured overnight at 30°C. The transformants were picked and inoculated into LB medium, and ampicillin, chloramphenicol and arabinose (final concentrations of 50 mg / L, 25 mg / L, and 2 g / L, respectively) were added to prepare electroporation competent cells.

[0068] 5) The transformants were prepared into competent cells for electroporation transformation and added with ampicillin, chloramphenicol and arabinose (final concentrations were 50 mg / L, 25 mg / L and 2 g / L, respectively) during the competent cell culture.

[0069] 6) The second recombinant fragment pgi-2 was transformed into the competent cells by electroporation, and 500uL of the incubated bacterial solution was inoculated into a 30mL Erlenmeyer flask containing sucrose culture medium, and cultured at 37°C, 250rpm for 18-24h.

[0070] 7) After cultivation, there is a probability that flocculent precipitation will appear in the triangular flask. Take 20uL from the shake flask and streak it on a plate containing sucrose, and culture it at 37°C overnight. The next day, pick the monoclonal colony on the plate and copy it to the LB plate, chloramphenicol resistance plate, and ampicillin resistance plate. Select the monoclonal colony that grows on the LB plate but cannot grow on the chloramphenicol resistance plate and ampicillin resistance plate, and use primers pgi-VF and pgi-VR for colony PCR. The amplification length is 1000bp for the positive strain. The PCR product was sequenced and verified to obtain the BW25113△pgi strain.

[0071] The colony PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 1 minute (30 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0072] Example 2: Construction of Δzwf knockout cassette and BW25113 Δpgi Δzwf strain

[0073] 2.1 Construction of △zwf knockout cassettes zwf-1 and zwf-2

[0074] 1) Using plasmid pOH5899 as a template, PCR amplification was carried out using primers Sp-zwf-cat-up and Sp-zwf-SacB-down, and verified by agarose gel electrophoresis to obtain a single target band zwf-cat-SacB.

[0075] 2) After purifying and recovering the above single target band zwf-cat-SacB, the template was digested with DpnⅠ at 37 °C for 30 minutes.

[0076] 3) The fragment zwf-cat-SacB after digesting the template was purified and verified by sequencing to obtain the first recombinant fragment zwf-1 of the △zwf genotype.

[0077] 4) Using the Escherichia coli BW25113 genome as a template, amplification was carried out using primers zwf-up-F and zwf-up-R, verified by agarose gel electrophoresis, the template was digested with DpnⅠ, purified and recovered to obtain the zwf-up fragment.

[0078] 5) Using primers zwf-down-F and zwf-down-R, amplification was carried out using the Escherichia coli BW25113 genome as a template, verified by agarose gel electrophoresis, the template was digested with DpnⅠ, purified and recovered to obtain the zwf-down fragment.

[0079] 6) Using primers zwf-up-F and zwf-down-R, overlapping PCR amplification was carried out using zwf-up and zwf-down as templates, verified by agarose gel electrophoresis, the template was digested with DpnⅠ, purified and recovered to obtain the second recombinant fragment zwf-2 fragment of the △zwf genotype.

[0080] The construction method refers to part 1.1 of Example 1.

[0081] 2.2 Construction of BW25113△pgi△zwf strain

[0082] The BW25113△pgi strain was made competent, electrotransformed with the first recombinant fragment zwf-1, screened for chloramphenicol resistance, the correct transformants were made competent and transformed with the second recombinant fragment zwf-2, and the correct transformants were named BW25113△pgi△zwf strain.

[0083] The transformation and screening method refers to part 1.2 of Example 1.

[0084] Example 3: Construction of △pykF knockout cassette and BW25113△pgi△zwf△pykF strain

[0085] 3.1 Construction of △pykF knockout cassettes pykF-1 and pykF-2

[0086] 1) Using plasmid pOH5899 as a template, PCR amplification was performed using primers Sp-pykF-cat-up and Sp-pykF-SacB-down. After verification by agarose gel electrophoresis, a single target band pykF-cat-SacB was obtained.

[0087] 2) The above single target band pykF-cat-SacB was purified and recovered, and DpnⅠ was added to digest the template plasmid at 37°C for 30 minutes.

[0088] 3) The digested fragment pykF-cat-SacB was purified and verified by sequencing to obtain the first recombinant fragment pykF-1 of the △pykF genotype.

[0089] 4) Using the Escherichia coli BW25113 genome as a template, PCR amplification was performed using primers pykF-up-F and pykF-up-R. After verification by agarose gel electrophoresis, the template was digested with DpnⅠ, purified and recovered to obtain the pykF-up fragment.

[0090] 5) Using the Escherichia coli BW25113 genome as a template, PCR amplification was performed using primers pykF-down-F and pykF-down-R. After verification by agarose gel electrophoresis, the template was digested with DpnⅠ, purified and recovered to obtain the pykF-down fragment.

[0091] 6) Using primers pykF-up-F and pykF-down-R, overlap PCR amplification was performed with pykF-up and pykF-down as templates. After verification by agarose gel electrophoresis, the template was digested with DpnⅠ, purified and recovered to obtain the pykF-2 fragment.

[0092] The construction method refers to part 1.1 of Example 1.

[0093] 3.2 Construction of Escherichia coli BW25113△pgi△zwf△pykF strain

[0094] The BW25113△pgi△zwf strain was made into competent cells and electrotransformed with the first recombinant fragment pykF-1. Chloramphenicol resistance screening was carried out. The correct transformants were made into competent cells and electrotransformed with the second recombinant fragment pykF-2. The transformants were screened and verified by sequencing to obtain the Escherichia coli BW25113△pgi△zwf△pykF strain.

[0095] The transformation and screening method refers to part 1.2 of Example 1.

[0096] Example 4: Construction of △lacZα expression cassette and construction of RBS screening strain

[0097] 4.1 Construction of lacZα knockout cassettes lacZ-1 and lacZ-2

[0098] 1) Using plasmid pOH5899 as a template, PCR amplification was performed with primers Sp-lacZ-cat-up and Sp-lacZ-SacB-down, and verified by agarose gel electrophoresis to obtain a single target band lacZ-cat-SacB;

[0099] 2) The above single target band lacZ-cat-SacB was purified and recovered, and DpnⅠ was added to digest the template at 37 °C for 30 minutes.

[0100] 3) The fragment lacZ-cat-SacB after digesting the template was purified and verified by sequencing to obtain the first recombinant fragment lacZ-1 of the △lacZα genotype.

[0101] 4) Using the Escherichia coli BW25113 genome as a template, amplification was performed with primers lacZ-up-F and lacZ-up-R, verified by agarose gel electrophoresis, purified and recovered after adding DpnⅠ to digest the template to obtain the fragment lacZ-up.

[0102] 5) Using the Escherichia coli BW25113 genome as a template, amplification was performed with primers lacZ-down-F and lacZ-down-R, verified by agarose gel electrophoresis, purified and recovered after adding DpnⅠ to digest the template to obtain the fragment lacZ-down.

[0103] 6) Using primers lacZ-up-F and lacZ-down-R, overlap PCR amplification was performed with lacZ-up and lacZ-down as templates, verified by agarose gel electrophoresis, purified and recovered after adding DpnⅠ to digest the template to obtain the second recombinant fragment lacZ-2.

[0104] The construction method refers to Section 1.1 of Example 1.

[0105] 4.2 Construction of RBS screening strains

[0106] The BW25113△pgi△zwf△pykF strain obtained in Example 3 was made into competent cells, electrotransformed with the first recombinant fragment lacZ-1, and screened for chloramphenicol resistance. The correct transformants were made into competent cells, electrotransformed with the second recombinant fragment lacZ-2, and the transformants were screened and verified by sequencing to obtain the RBS screening strain BW25113△pgi△zwf△pykF△lacZα.

[0107] The transformation and screening method refers to Section 1.2 of Example 1.

[0108] Example 5. Synthesis of p-IPS-IMP Overexpression Plasmid

[0109] 1) Obtain the IPS gene sequence (GeneID: 3662676) from Trypanosoma brucei brucei TREU927 and the IMP gene sequence (GeneID: 915157) from Escherichia coli str. K-12 substr. MG1655 on the NCBI website.

[0110] 2) Submit the sequences to Tsingke Biological Company for codon optimization according to Escherichia coli codon preference. The optimized sequence of the IPS gene is shown as Sequence 1, and the optimized sequence of the IMP gene is shown as Sequence 2.

[0111] 3) The codon-optimized IPS and IMP genes are artificially synthesized and ligated to the plasmid pTrc-99a (Kan). An RBS (shown as Sequence 3) is used for ligation between the two genes to obtain the plasmid p-IPS-IMP.

[0112] Example 6. Construction of p-IPS-IMP-glpK Plasmid

[0113] 1) Use primers piig-pd-F and piig-pd-R to perform PCR amplification with the Escherichia coli BW25113 genome as the template. Verify by agarose gel electrophoresis, and after digesting the template with DpnⅠ, purify and recover to obtain the glpK fragment.

[0114] 2) Use primers piig-zt-F and piig-zt-R to amplify with the plasmid pTrc-IPS-IMP as the template. Verify by agarose gel electrophoresis, and after digesting the template with DpnⅠ, purify and recover to obtain the linearized vector pTrc-IPS-IMP.

[0115] 3) Connect the linearized vector pTrc-IPS-IMP and the glpK fragment by one-step cloning. Transform the resulting recombinant plasmid into Escherichia coli DH5α, spread the resulting transformed bacterial solution on an LB plate containing kanamycin resistance (final concentration 50 mg / L), culture overnight at 37°C, pick the transformants and verify with primers piig-yz-F and piig-yz-R. The correct PCR product band size is 1000 bp. Purify and sequence the PCR product. Inoculate the transformants with correct sequencing results into an LB liquid medium containing kanamycin resistance (final concentration 50 mg / L) for culture, preserve the bacteria, extract the plasmid to obtain the p-IPS-IMP-glpK plasmid.

[0116] Example 7. Construction of p-IPS-lacZα-IMP-glpK Plasmid

[0117] 1) Using primers 21027b-zt-F and 21027b-zt-R, amplify with p-IPS-IMP-glpK as the template. Verify by agarose gel electrophoresis, digest the template with DpnⅠ and then purify and recover to obtain the linearized p-IPS-IMP-glpK vector. The amplification system is: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each of dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA Polymerase (2.5 U / μl) 1 μl, distilled water 19 μl, and the total volume is 50 μl.

[0118] 2) Using primers 176-pd-F and 176-pd-R, amplify with plasmid pMal-c4X as the template. Verify by agarose gel electrophoresis, digest the template with DpnⅠ and then purify and recover to obtain the lacZα fragment.

[0119] 3) The linearized p-IPS-IMP-glpK vector and the lacZα fragment are ligated by one-step cloning. The ligation product is transformed into Escherichia coli DH5α. The transformed bacterial solution is spread on an LB plate containing kanamycin resistance (final concentration 50 mg / L) and cultured overnight at 37°C. Pick the transformants and verify with primers 21027b-yz-F and 21027b-yz-R. The correct PCR product band size is 1000 bp. Sequence the PCR product. The transformants with correct sequencing results are inoculated into an LB medium containing kanamycin resistance (final concentration 50 mg / L) for culture, bacteria preservation, plasmid extraction, and obtain the p-IPS-lacZα-IMP-glpK plasmid.

[0120] Example VIII. Construction of an RBS screening library using the p-IPS-lacZα-IMP-glpK plasmid as the template

[0121] 1) When synthesizing primers, the types of provided bases can be increased to obtain a primer library with random sequences, such as D(A, G, T), B(G, C, T), N(A, G, C, T). Use this primer library to amplify the p-IPS-lacZα-IMP-glpK plasmid, and purify the PCR product to obtain a library p-IPS-lacZα-IMP-glpK* with mutations in the RBS region.

[0122] The amplification system is as follows: 25 μl of 2×Phanta Max Buffer (Vazyme), 1 μl of dNTP (10 mM for each dNTP), 20 ng of DNA template, 2 μl of each primer (10 μM), 1 μl of Phanta Max Super-Fidelity DNA Polymerase (2.5 U / μl), and 19 μl of distilled water, with a total volume of 50 μl.

[0123] The amplification conditions are as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 8 minutes (30 cycles); extension at 72°C for 5 minutes (1 cycle).

[0124] 2) The expression of the gene on the p-IPS-lacZα-IMP-glpK plasmid is achieved through a trc promoter, a lactose binding site, and an RBS. The connection order of the gene elements is trc promoter, lactose binding site, and RBS-IPS-lacZα-IMP-glpK. When constructing the library, the trc promoter and the lactose binding site are kept unchanged. Among the 20 bases that make up the RBS, the 9th to 13th bases are the conserved region in the RBS. Here, the first 8 bases before the conserved region are selected for mutagenesis library construction, as Figure 1 shown.

[0125] 3) Design a pair of primers jk-F / ji-R to construct the mutant library. The first half of the forward primer jk-F has the same sequence as the trc promoter-lactose binding site sequence, the middle sequence is 8 consecutive degenerate bases (A, G, C, T) of N, and the second half sequence is the conserved region of the RBS. The full sequence of the forward primer jk-F is: GAATTGTGAGCGGATAACAANNNNNNNNAGGAAACAGACC. The reverse primer jk-R sequence pairs with the bases in the trc promoter-lactose binding site region.

[0126] 4) Use primers jk-F and jk-R to amplify with the p-IPS-lacZα-IMP-glpK plasmid as the template, verify by agarose gel electrophoresis, digest the template with DpnⅠ, and then purify and recover to obtain the mutant library of p-IPS-lacZα-IMP-glpK.

[0127] The amplification system is as follows: 25 μl of 2×Phanta Max Buffer (Vazyme), 1 μl of dNTP (10 mM for each dNTP), 20 ng of DNA template, 2 μl of each primer (10 μM), 1 μl of Phanta Max Super-Fidelity DNA Polymerase (2.5 U / μl), and 19 μl of distilled water, with a total volume of 50 μl.

[0128] The amplification conditions were as follows: pre-denaturation at 95°C for 3 minutes (1 cycle); denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 8 minutes (30 cycles); extension at 72°C for 5 minutes (1 cycle).

[0129] Example 9. Blue-white color screening of RBS

[0130] 9.1 Transformation

[0131] 1) Prepare chemically competent cells from the BW25113ΔlacZαΔpgiΔzwfΔpykF strain obtained in Example 4.

[0132] 2) Transform the mutant library p-IPS-lacZα-IMP-glpK* into the BW25113ΔlacZαΔpgiΔzwfΔpykF strain, and spread it on an LB plate containing IPTG, X-Gal, and kanamycin (final concentrations of 0.5 mM, 40 μg / ml, and 50 mg / L respectively), and culture overnight at 37°C.

[0133] 3) The next day, evenly distributed single colonies appeared on the plate.

[0134] 4) Invert the plate and place it in a 4°C refrigerator, and let it stand for 24 h to observe the blue color development.

[0135] 5) At the same time, transform the plasmid p-IPS-lacZα-IMP-glpK into the BW25113ΔlacZαΔpgiΔzwfΔpykF strain as a control.

[0136] 9.2 Colorimetric screening

[0137] 1) Compare the color development degree of the single colonies on the plate by means of a color comparison card, and finally screen and obtain 5 colonies with darker colors

[0138] 2) Number the 5 colonies with darker colors as M1, M2, M3, M4, M5, number the colony of the original plasmid p-IPS-lacZα-IMP-glpK as the control M6, and number the colonies with lighter colors as M7.

[0139] 3) Inoculate the M1-M7 strains into test tubes and then extract the plasmids. Send the plasmids for sequencing. Use the primer RBS-seqF for a forward sequencing reaction. The RBS sequences of M1-M7 are as follows:

[0140] Strain RBS Name Corresponding RBS Sequence M1 M1-RBS TCGTCGAG M2 M2-RBS GCTTAAGG M3 M3-RBS GCGTATCC M4 M4-RBS CAGGACAC M5 M5-RBS GCAGATGC M6 M6-RBS TTTCACAC M7 M7-RBS TCATTCGA

[0141] 4) The β-Gal activity of the above strains was determined. The determination method refers to (Wigley, W., Stidham, R., Smith, N. et al. Protein solubility and folding monitored in vivo by structural complementation of a genetic marker protein. Nat Biotechnol 19, 131–136 (2001). https: / / doi.org / 10.1038 / 84389).

[0142] Strain β-Gal Activity (U / OD600) 1 M6 (WT) 10.2 2 M1 42.2 3 M2 46.7 4 M3 52.3 5 M4 66.1 6 M5 60.2 8 M7 8.7

[0143] Example Ten: Fermentation of M1, M2, M3, M4, M5, M6, and M7 Transformants

[0144] 1) The M1, M2, M3, M4, M5, M6, and M7 strains were respectively inoculated into test tubes containing 10 mL of LB medium with kanamycin (50 mg / L) and cultured at 37 °C for 8 - 10 h.

[0145] 2) The bacterial liquid in the test tubes was transferred to 100 mL LB shake flasks containing kanamycin (50 mg / L) with an inoculation amount of 2%, and cultured at 37 °C for 8 - 10 h.

[0146] 3) The bacterial liquid in the shake flasks was used as the seed liquid and inoculated into the fermenter with an inoculation amount of 5%. It was cultured at 37 °C. When cultured for 10 h, the inducer IPTG was added, and the fermentation ended at 96 h.

[0147] 4) The composition of the initial medium in the fermenter is as follows:

[0148] Glucose 5 - 10 g / L; glycerol 10 - 20 g / L; potassium dihydrogen phosphate 7 g / L; magnesium sulfate heptahydrate 2 g / L; ammonium sulfate 2 - 10 g / L; yeast powder 1 - 5 g / L; citric acid 2 - 8 g / L; antifoaming agent PPE 0.5 mL / L; trace element mother liquor 1 mL / L; add water to make up the volume to 2 L;

[0149] Among them, the composition of the trace element mother liquor: Weigh 5 g of FeCl3, 2.5 g of CoCl·6H2O, 0.15 g of MnCl2·4H2O, 1.5 g of CuCl2·2H2O, 3 g of H3BO3, 2.5 g of NaMnO4·2H2O, 13 g of Zn(CH3COO)2·2H2O, and add water to make up the volume to 1 L.

[0150] The feeding medium is a mixture of glucose and glycerol with a ratio of 5:1. During the fermentation process, the pH is maintained at 6.8, the aeration rate is 1 vvm, the stirring rate is set at 500 revolutions per minute, and the dissolved oxygen is associated with the feeding. Feeding starts when DO is greater than 35%.

[0151] Example 11. Construction of an RBS-optimized inositol high-yielding strain

[0152] 1. Mutant primers RBS4-F and RBS4-R, RBS5-F and RBS5-R were designed according to the M4-RBS and M5-RBS sequences.

[0153] 2. Using plasmid p-IPS-IMP-glpK as a template, PCR amplifications were carried out using primers RBS4-F and RBS4-R, RBS5-F and RBS5-R respectively. The PCR products were treated with DpnⅠ and purified to obtain plasmids p4-iig and p5-iig. Plasmids p4-iig, p5-iig and p-IPS-IMP-glpK were chemically transformed into the chassis strain and spread on an LB plate with kanamycin resistance (final concentration 50 mg / L), and cultured at 37 °C for 8 - 10 h.

[0154] The amplification system was: 2×Phanta Max Buffer (Vazyme) 25 μl, dNTP (10 mM each of each dNTP) 1 μl, DNA template 20 ng, primers (10 μM) 2 μl each, Phanta Max Super-Fidelity DNA Polymerase (2.5 U / μl) 1 μl, distilled water 19 μl, with a total volume of 50 μl.

[0155] The amplification conditions were: pre-denaturation at 95 °C for 3 minutes (1 cycle); denaturation at 95 °C for 15 seconds, annealing at 56 °C for 15 seconds, extension at 72 °C for 8 minutes (30 cycles); extension at 72 °C for 5 minutes (1 cycle).

[0156] 3. The clones obtained on the plate were subjected to colony PCR using primers piig-yz-F and piig-yz-R. The correct PCR product band size was 1000 bp. The correct transformants were picked and inoculated into test tubes for culture, and the plasmids were extracted and sequenced. To verify whether the RBS region had been mutated as expected, one reaction was sequenced using the forward primer RBS-seqF, and recombinant strains of M4-RBS, M5-RBS and M6-RBS were obtained, and the corresponding strains were named OH-MI4, OH-MI5 and OH-MI6.

[0157] The colony PCR amplification conditions were: pre-denaturation at 95 °C for 3 minutes (1 cycle); denaturation at 95 °C for 15 seconds, annealing at 56 °C for 15 seconds, extension at 72 °C for 1 minute (30 cycles); extension at 72 °C for 5 minutes (1 cycle).

[0158] The strains OH-MI4, OH-MI5, and OH-MI6 were fermentatively verified according to the fermentation method in Example 10. The fermentation results are as Figure 4 shown. The strain OH-MI4 showed good inositol production ability. The strain OH-MI4 was deposited for patent on November 14, 2022, with the deposit number CCTCC NO: M20221796, and the taxonomic name is Escherichia coli BW25113. The depository is the China Center for Type Culture Collection, and the deposit address is Wuhan University, Wuhan, Hubei, China.

[0159] The above are only the preferred embodiments of the present invention, and the protection scope of the present invention is not limited to the above embodiments. All technical solutions falling within the idea of the present invention belong to the protection scope of the present invention. It should be noted that for those of ordinary skill in the art, several improvements and refinements made without departing from the principle of the present invention should be regarded as within the protection scope of the present invention.

[0160] Sequence 1 (optimized IPS):

[0161]

[0162] Sequence Two (Optimized IMP Sequence):

[0163] ATGCACCCGATGTTAAATATTGCCGTTCGTGCCGCCCGCAAAGCCGGTAATCTGATTGCCAAAAATTATGAGACCCCGGACGCCGTTGAAGCCTCCCAGAAAGGTTCCAATGACTTTGTTACCAATGTGGATAAGGCCGCAGAGGCTGTTATTATTGATACCATTCGCAAAAGCTATCCGCAGCACACCATCATTACCGAAGAAAGTGGTGAATTAGAGGGTACAGACCAAGATGTTCAGTGGGTTATTGACCCTTTAGATGGAACCACCAACTTTATTAAAAGACTGCCGCACTTTGCAGTCAGCATTGCAGTTAGAATTAAAGGACGGACCGAAGTGGCCGTGGTTTATGATCCAATGCGTAACGAACTTTTTACCGCGACCCGCGGTCAGGGCGCCCAGTTAAACGGTTATCGTTTACGGGGCAGTACCGCACGTGATCTGGATGGCACGATTTTAGCAACCGGGTTTCCTTTTAAAGCAAAACAATATGCAACCACCTATATTAACATCGTTGGTAAACTGTTTAACGAATGTGCAGATTTTCGCCGTACCGGGTCTGCGGCACTGGACCTGGCATATGTTGCAGCAGGTAGAGTAGATGGTTTTTTTGAGATTGGTCTGCGGCCGTGGGATTTCGCCGCCGGAGAACTGTTAGTTCGTGAAGCAGGCGGTATTGTTAGCGATTTTACCGGTGGTCATAATTATATGTTAACCGGGAATATTGTGGCAGGTAATCCTAGAGTTGTTAAAGCGATGCTGGCAAATATGC

[0164] GGGATGAACTGAGCGATGCACTGAAACGGTAA Sequence Three RBS between IPS and IMP GAAGGAGATATACAT

[0165] Sequence Four (Amino Acid Sequence of the Linker Peptide):

[0166] GSAGSAAGSGAS

[0167] Sequence Five (Base Sequence of Linker Peptide):

[0168] GGATCCGCTGGCTCCGCTGCTGGTTCTGGCGCAAGC

Claims

1. A ribosome binding sequence, which contains the following nucleotide sequence: M1-RBS: TCGTCGAG; M2-RBS: GCTTAAGG; M3-RBS: GCGTATCC; M4-RBS: CAGGACAC; M5-RBS: GCAGATGC; M6-RBS: TTTCACAC; M7-RBS: TCATTCGA; Preferably, the nucleotide sequence represented by M4-RBS.

2. An expression cassette containing the ribosome binding sequence according to claim 1.

3. Use of the ribosome binding sequence according to claim 1 in constructing an inositol-producing bacterium.

4. A method for constructing an inositol-producing bacterium using the ribosome binding sequence according to claim 1, characterized in that The ribosome binding sequences of inositol-1-phosphate synthase gene ips, inositol monophosphatase gene imp and glycerol kinase gene glpK contain the following nucleotide sequences: M1-RBS: TCGTCGAG; M2-RBS: GCTTAAGG; M3-RBS: GCGTATCC; M4-RBS: CAGGACAC; M5-RBS: GCAGATGC; M6-RBS: TTTCACAC; M7-RBS: TCATTCGA; Preferably, the ribosome binding sequence contains the nucleotide sequence shown by M4-RBS.

5. According to the method for constructing an inositol-producing bacterium according to claim 4, the ips, imp and glpK genes are expressed in tandem.

6. According to the method for constructing an inositol-producing bacterium according to claim 4, the order of tandem expression of the ips, imp and glpK genes is ips, imp, glpK.

7. According to the method for constructing an inositol-producing bacterium according to claim 4, characterized in that It also includes knocking out one or more of the following genomes, and the genes include glucose phosphate isomerase gene, glucose-6-phosphate dehydrogenase gene and pyruvate kinase gene.

8. An inositol-producing recombinant strain obtained by the method according to any one of claims 4-7.

9. According to the inositol-producing recombinant strain according to claim 8, characterized in that The deposit number is CCTCC NO: M20221796.

10. A method for screening a ribosome binding sequence of a gene: including constructing a strain lacking the lacZα gene, establishing a ribosome binding sequence library, transferring the ribosome sequence screening library into the strain lacking the lacZα gene, inoculating the transformant into a medium containing X-gal, and screening the ribosome binding sequence according to the color change, characterized in that The ribosome binding sequence library is to recombine the ribosome binding sequence with the target gene to construct a target gene expression cassette, and fuse the target gene with the lacZα gene. Preferably, the fusion of the ribosome binding sequence is carried out by PCR method. More preferably, the target gene is the key gene for inositol production, inositol-1-phosphate synthase gene ips and / or inositol monophosphatase gene imp.