Tea tree CsGAMYB gene and application thereof in regulation and control of growth and development of leaves

By studying the CsGAMYB gene of tea trees and its interaction with miR159b, the problem of unknown function of miR159b in tea trees was solved. It was found that miR159b promotes leaf development through negative regulation of CsGAMYB, realizing the regulation of tea tree leaf growth and development.

CN120158459AActive Publication Date: 2025-06-17HUAZHONG AGRI UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510465163.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-15
Publication Date
2025-06-17
Estimated Expiration
2045-04-15

AI Technical Summary

Technical Problem

The prior art has not yet clarified the function of miR159b in tea trees and its role in regulating leaf growth and development.

Method used

By extracting and analyzing the tea tree CsGAMYB gene and its interaction with miR159b, the recombinant plasmid pBinRed3-CsGAMYB was constructed and heterologously expressed in Arabidopsis, and the shearing effect of miR159b on CsGAMYB and its effect on leaf development were studied.

Benefits of technology

The results show that miR159b negatively regulates the expression of CsGAMYB, promotes the development of plant leaves, significantly increasing the length, width, area and petiole length of leaves, while the overexpression of CsGAMYB inhibits the development of leaves.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158459A_ABST
    Figure CN120158459A_ABST
Patent Text Reader

Abstract

The invention discloses a tea tree CsGAMYB gene and application of the tea tree CsGAMYB gene in regulation and control of leaf growth and development. The CDS sequence of the tea tree CsGAMYB gene is as shown in SEQ ID NO.1. And the gene for interfering the expression of the CsGAMYB gene is a precursor sequence of the tea tree miR159b gene. In an arabidopsis thaliana miR159b overexpression strain, the leaf length, the leaf width, the leaf area and the leaf stalk length are obviously increased; in an arabidopsis thaliana CsGAMYB overexpression strain, the leaf length, the leaf width, the leaf area and the leaf stalk length are remarkably reduced; through observation of a microscope, lower epidermal cells of leaves are obviously less than WT in miR159b overexpression plants and obviously more than WT in CsGAMYB overexpression plants, overexpression of CsGAMYB in the plants inhibits growth of the cells and leads to reduction of the thickness, area, length and width of the leaves, and overexpression of miR159b can restore development of the leaves of the plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to a CsGAMYB gene of tea tree and its application in regulating leaf growth and development. Background Art

[0002] Tea tree is an important economic crop in China. Tea products made from its leaves are deeply loved by consumers because of their diverse appearances, rich tastes, and the presence of ingredients beneficial to human health such as catechins and theanine. Leaves are important vegetative organs for plants to carry out transpiration, photosynthesis, and gas exchange. Tea tree is an important leaf-based economic crop, and the development of leaves directly affects the yield and quality of tea. Therefore, exploring the key genes regulating tea tree leaf development and deeply analyzing its related molecular regulatory mechanisms can provide important gene resources for improving tea quality and lay a theoretical foundation for the targeted variety breeding and molecular breeding of tea tree.

[0003] A large number of studies have shown that miRNA plays a very important role in various processes of plant growth and development. MiR159 is a relatively conserved miRNA family in plants and has been proven to be involved in the regulation of organ growth and development in various plants, but the function of miR159b in tea tree is still unclear. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of a CsGAMYB gene of tea tree in regulating leaf growth and development.

[0005] To achieve the above purpose, the technical solutions designed by the present invention are as follows:

[0006] The present invention provides a CsGAMYB gene of tea tree, and the nucleotide sequence of the CDS sequence of the CsGAMYB gene is as shown in SEQ ID NO.1.

[0007] The present invention also provides a recombinant plasmid pBinRed3-CsGAMYB, and the recombinant plasmid pBinRed3-CsGAMYB is inserted with the above CsGAMYB gene in the vector pBinRed3.

[0008] The present invention also provides an Agrobacterium strain containing the above recombinant plasmid pBinRed3-CsGAMYB, and the Agrobacterium strain is GV3101.

[0009] The present invention also provides an application of the above CsGAMYB gene in regulating leaf growth and development.

[0010] Application of any one of the following in cultivating a new variety of Arabidopsis thaliana with well-developed leaf growth and development, including

[0011] (1) The above-mentioned CsGAMYB gene;

[0012] (2) The above-mentioned recombinant plasmid pBinRed3-CsGAMYB;

[0013] (3) The above-mentioned Agrobacterium strain.

[0014] The present invention also provides an application of the precursor sequence of the tea tree miR159b gene in interfering with the expression of the CsGAMYB gene in participating in leaf growth and development. The nucleotide sequence of the precursor sequence of the tea tree CsmiR159b gene is shown in SEQ ID NO.2.

[0015] Furthermore, the plant is a tea tree, Arabidopsis thaliana or tobacco.

[0016] Still further, the interference is the cleavage of the CsGAMYB gene by the miR159b gene.

[0017] The present invention also provides an application of the precursor sequence of the above-mentioned tea tree miR159b gene in cultivating a new variety of Arabidopsis thaliana that promotes leaf growth and development.

[0018] Furthermore, the application is to ligate the precursor sequence of the tea tree miR159b gene to a vector, transform it into Arabidopsis thaliana through Agrobacterium-mediated transformation, and screen, culture and obtain transgenic lines.

[0019] Advantages of the present invention:

[0020] Through degradome data, the present invention discovers that the target gene of tea tree miR159b is CsAMYB. The fluorescence quantitative results show that the expression levels in 9 tissues of tea tree (buds, the first leaf, the third leaf, tender stems, mature leaves, old leaves, lateral roots, flowers and fruits) show opposite trends, which conforms to the rule of miRNA negatively regulating target genes in plants. The 5’RLM-RACE experiment confirms that the cleavage site of miR159b on CsGAMYB is between the 11th and 12th bases at the 5′ end of the target site region; the transient expression experiment of tobacco leaves also confirms the cleavage effect of miR159b on CsGAMYB.

[0021] In this invention, qRT-PCR was used to analyze the expression patterns of Csn-miR159b and CsGAMYB in the buds (B), first leaves (FL), third leaves (TL), tender stems (TS), mature leaves (ML), old leaves (OL), flowers (F) and fruits (S) of 'FDDB' tea plants. The results showed that the expression level of miR159b was the highest in the first leaves and gradually decreased with the development of the leaves. The expression of CsGAMYB gradually increased with the development of the leaves, reached the highest level in the third leaves, and then gradually decreased with the development of the leaves.

[0022] In summary: miR159b and CsGAMYB may regulate the development of tea plant leaves. In this invention, overexpression vectors of miR159b and CsGAMYB were constructed and heterologously transformed into wild-type Arabidopsis thaliana. By stably overexpressing the miR159b and CsGAMYB genes in Arabidopsis thaliana, it was found that after overexpressing CsGAMYB, the overall development of the plants was slow, mainly manifested as short leaves; while the miR159b overexpressing plants developed normally with thick leaves. This indicates that the overexpression of CsGAMYB inhibits the development of plant leaves. By statistically analyzing the petiole length, leaf length, leaf width and leaf area of the 7th rosette leaf of wild-type, miR159b and CsGAMYB overexpressing lines (biological replicates greater than 10 plants). The results showed that compared with the wild-type, the leaf length, leaf width, leaf area and petiole length of the miR159b overexpressing plants increased significantly, while those of the CsGAMYB overexpressing plants decreased significantly. This shows that miR159b promotes the development of plant leaves by negatively regulating the expression of CsGAMYB. Description of the Drawings

[0023] Figure 1 It is a figure showing the positive identification results of miR159b (left figure) and CsGAMYB (right figure) overexpressing lines in Arabidopsis thaliana;

[0024] Figure 2 It is a phenotypic figure of miR159b and CSGAMYB transgenic Arabidopsis thaliana;

[0025] Figure 3 It is a figure showing the results of the 5’RLM-RACE experiment;

[0026] In the figure, the red arrow is the degradation site of CsGAMYB, and the numbers represent the proportion of CsGAMYB cleaved at the miR159b target site in the sequencing samples;

[0027] Figure 4 It is a figure showing the interaction map of CsGAMYB and miR159b verified by the tobacco transient system;

[0028] In the figure, A is a diagram showing the construction of the Agrobacterium-mediated tobacco transient transformation vector:

[0029] (a) No load, (b) Precursor sequence of miRNA, (c) Target gene locus, (d) Mutation site of target gene, (e) Perfect complementary site of miRNA target gene;

[0030] B is the GFP fluorescence signal map of different combinations under the in vivo imager. Specific implementation mode

[0031] The present invention will be further described in detail below in conjunction with specific embodiments for the understanding of those skilled in the art.

[0032] Example 1 Screening genes miR159b and CsGAMYB related to the growth and development of tea tree leaves

[0033] 1. Extraction of genomic DNA from tea tree

[0034] The total DNA of tea tree was extracted using the CTAB extraction method, and the steps are as follows:

[0035] 1) Weigh 0.5 g of sample material, add 1 mL of washing solution, invert and mix well, centrifuge at 12000 r / min for 5 min, and discard the supernatant;

[0036] 2) Add 800 μL of CTAB lysis solution (CTAB extraction solution), stir evenly with a pipette tip or gently pipette and mix well, incubate in a metal bath at 65 °C for 30 min, and add 800 μL of chloroform:isoamyl alcohol:ethanol = 80:4:16 in the fume hood, turn it over and shake gently to make it into an emulsion;

[0037] 3) Centrifuge at 12000 r / min for 10 min;

[0038] 4) Pipette the supernatant into a new 2 mL centrifuge tube, add an equal volume of isopropanol in the fume hood, centrifuge at 12000 r / min for 5 min, and discard the supernatant;

[0039] 5) Add 75% ethanol to wash the DNA, centrifuge at 12000 r / min for 5 min, and discard the supernatant;

[0040] 6) Open the centrifuge tube, dry it with a Class 3 blower in the ultra-clean workbench, and the DNA remains slightly moist;

[0041] 7) Add 50 - 100 μL of ddH2O, dissolve it fully at 37 °C, and measure the concentration;

[0042] 8) Prepare the working solution, dilute the working solution to 200 ng / μL. Store the working solution and the mother solution in a -20 °C refrigerator.

[0043] 2. Extraction of RNA from tea tree

[0044] Extract total RNA by a modified simple CTAB-LiCl method as follows:

[0045] 1) Add two steel beads to a 2 mL centrifuge tube, tighten the cap, and pre-cool it in liquid nitrogen in advance. Take 0.1 g of plant material, put it into the centrifuge tube, and grind it into powder at 50 Hz for 1 min using a liquid nitrogen grinder;

[0046] 2) Quickly add 900 μL of CTAB extraction buffer and 45 μL of β-mercaptoethanol. Vortex thoroughly, incubate in a water bath at 65 °C for 30 min, and invert the tube gently every 10 min for mixing;

[0047] 3) Centrifuge at 12,000 r / min for 10 min at 4 °C. Transfer the supernatant to a new 2 mL centrifuge tube, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), mix gently, and place in a 4 °C refrigerator for 10 min. Repeat this step once;

[0048] 4) Centrifuge at 12,000 r / min for 15 min at 4 °C. Transfer the supernatant, add 1 / 3 volume of LiCl (8 mol / L) and 1% β-mercaptoethanol, mix well, and incubate overnight at -20 °C;

[0049] 5) Centrifuge at 13,000 r / min for 40 min at 4 °C, discard the supernatant. Wash the pellet twice with 75% ethanol, dry the remaining ethanol in a fume hood, and add 30 μL of RNase-free H2O;

[0050] 6) Measure the concentration of RNA using a micro-spectrophotometer, and detect the quality of RNA by electrophoresis on a 1% agarose gel. Store the remaining RNA in an ultra-low temperature freezer at -80 °C.

[0051] 3. Amplification of miR159b and CsGAMYB:

[0052] (1) Design primers

[0053] Primer Name Primer Sequence (5’-3’) miR159b-F CCTCTCAAGTGACCAGAAATAGC miR159b-R TGAAATCAAGGGATTAGAGTGG CsGAMYB-F ATGAGTCACATGACAAATGA CsGAMYB-R TCAAGGAAGTTCAGACATCT

[0054] (2) Using the above-mentioned tea tree genomic DNA as a template, amplify the miR159b precursor sequence as shown in SEQ ID NO.2 respectively:

[0055] CCTCTCAAGTGACCAGAAATAGCAAGTCTGCAAGGGAAAAAAAAAAGGTTAAACGAAAAAGTAGAAGAATAGTCAGTACTCAGTACCCAGATTCATACAAATACATGTACGGTCAAATCAAATATCTAAGATTCAAGATCACATAGGGAGTGTTGAGTGAAGCTTATTAGTAAAAAGTAAAAAGTTGATAATTAAAAAAAGTAAAAATCAAAAGCATTTCTCCTCAAGATTCATATATTCAGTATTTTTTGATTATTTTTGCATAATAAATTATAAAAAGAAGTTGCACCAAACAATATTTGTACATGAATGGATGGTGAAGGGGAGAGAGAGATAGATGTAGAGCTCCCTTCAATCCAAAACAAGATCCAACTTAGGGTTAATGCAGCTCCTGACATATGCAAGCCACAAATCTATCCAATTAGTAAACCAAAACAAACAAAGATTGGATAGGAATGAGGGATCCATAGTTCAGCAGCTCAATCTTCCCGGTATGATCCTCTATTGGACTTCAAGGAGCTCCACTCTAATCCCTTGATTTCA;

[0056] The mature sequence of miR159b is shown in SEQ ID NO.3:

[0057] TAGAGCTCCCTTCAATCCAAA;

[0058] The ORF sequence of CsGAMYB is shown in SEQ ID NO.1:

[0059]

[0060] Example 2 Functional Verification of Tea Plant miR159b and CsGAMYB Genes

[0061] 1. Cultivation of Overexpressing Arabidopsis thaliana Lines

[0062] (1) Using the above tea plant miR159b and CsGAMYB genes as templates, primers were designed with homologous recombination adapters (Tsingke) added to the 5' end, and fragments containing the miR159b precursor (SEQ ID NO.2) and the full-length ORF of CsGAMYB were amplified respectively. The primer sequences are shown in the following table.

[0063] Primer Name Primer Sequence (5’-3’) miR159b-F1 GAGAACACGGGGGACTCTAGACCTCTCAAGTGACCAGAAATAGC miR159b-R1 CGATCGGGGAAATTCGAGCTCTGAAATCAAGGGATTAGAGTGG CsGAMYB-F1 TCCTCGGCCGAATTCCTCGAGTGGAGCTCCCTTCACTCCAAT CsGAMYB-R1 TTCTTCTCCTTTACTTCTAGAATTGGAGTGAAGGGAGCTCCA

[0064] The MIR gene of miR159b and the target gene CsGAMYB were inserted into the pBinRed3 vector digested with EcoRI and Xhol by homologous recombination to obtain recombinant plasmids of miR159b and CsGAMYB respectively.

[0065] (2) The recombinant plasmids were transferred into the Agrobacterium tumefaciens strain GV3101 by chemical transformation, and two recombinant Agrobacterium strains containing the recombinant plasmid miR159b and the recombinant plasmid CsGAMYB were screened respectively.

[0066] (3) The inflorescences of healthy Arabidopsis thaliana that had grown for about one month and were in good condition were infected with the recombinant Agrobacterium strains containing the recombinant plasmid miR159b and the recombinant plasmid CsGAMYB respectively. Every four days, the infection was repeated 4 - 5 times. The mature seeds were collected, dried in an oven at 28°C, and the T0 generation seeds with red fluorescence were obtained by screening with an ultraviolet lamp.

[0067] 2. Detection of the Expression Levels of miR159b and CsGAMYB in Overexpressing Arabidopsis thaliana Lines by RT-PCR:

[0068] Total RNA was extracted from the leaves of transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana using a plant RNA extraction kit, and reverse transcription was carried out using a reverse transcription kit (Simgen). The reverse transcription primer for CsGAMYB was a random primer, and the reverse transcription primer for miR159b was a specific stem-loop primer designed according to the sequence. The internal reference gene for fluorescence quantitative CsGAMYB was GAPDH, and the internal reference gene for miR159b was U6.

[0069] Using 2×Sybr Green qPCR Mix (PC6102, Aidlab), on the AB StepOne Plus real-time PCR system. The analysis was carried out according to the following procedure: denaturation at 94°C for 3 min; denaturation at 94°C for 10 sec, annealing at 60°C for 34 sec (40 cycles); annealing at 95°C for 15 sec, annealing at 65°C for 1 min; then reaching 95°C at a rate of 0.3°C / sec, and then annealing at 95°C for 15 sec. 2 -ΔΔCt The 2−ΔΔCt method was used to calculate the relative expression level, and each PCR reaction was independently repeated at least 3 times. The primer sequences are shown in the following table.

[0070] Primer Name Primer Sequence (5’-3’) CsU6-F CGGGGACATCCGATAAAATTG CsU6-R GGACCATTTCTCGATTTGTGC CsGAPDH-F TTGGCATCGTTGAGGGTCT CsGAPDH-R CAGTGGGAACACGGAAAGC miR159b-stem GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGAGC MiR159b-F2 CGTAATTTGGATTGAAGGGA MiR159b-R2 GTGCAGGGTCCGAGGT CsGAMYB-F2 CCTTCACTCCAATATCCAGAAACT CsGAMYB-R2 TTGTACTTAGAGTCTTCGCCTCGT

[0071] The results showed that the expression levels of miR159b and CsGAMYB in transgenic Arabidopsis thaliana containing miR159b and CsGAMYB respectively were both significantly increased ( Figure 1 ), indicating that the miR159b and CsGAMYB genes of tea plants were successfully transferred into Arabidopsis thaliana and stably expressed.

[0072] 3. Heterologous expression of miR159b and CsGAMYB affects leaf development in Arabidopsis thaliana

[0073] (1) After overexpressing CsGAMYB in Arabidopsis thaliana, the overall development of the plants was slow, mainly manifested as short leaves; while the plants overexpressing miR159b developed normally with thick leaves.

[0074] The petiole length, leaf length, leaf width and leaf area of the 7th rosette leaf of wild type, miR159b and CsGAMYB overexpression lines were statistically analyzed (biological replicates greater than 10 plants).

[0075] The results showed that compared with the wild type, the leaf length, leaf width, leaf area and petiole length of miR159b overexpression plants were significantly increased, while those of CsGAMYB overexpression plants were significantly decreased.

[0076] (2) Microscopic observation of the cross-sectional leaf thickness

[0077] When the plants grew to 28 d, the 7th rosette leaves of WT, miR159b and CsGAMYB were taken. Small pieces of 5 mm×5 mm were cut from each leaf, avoiding the main vein. The cut samples were immediately fixed in FAA fixative, vacuum infiltrated for 20 - 30 min, paraffin sectioned, and 4-μm-thick leaf cross-sections were made after staining. Observation and photography were carried out under an optical microscope (BM-1000).

[0078] WT, miR159b, and CsGAMYB overexpression plants that had grown for 28 days after seed germination were selected, and the epidermal cells of the seventh rosette leaf were observed. Under the same magnification, region, and area of the field of view, the number of lower epidermal cells in the miR159b overexpression plants was significantly less than that in the WT, while the number of lower epidermal cells in the CsGAMYB overexpression plants was significantly more than that in the WT, indicating that miR159b promotes the expansion of leaf cells by negatively regulating the expression of CsGAMYB, resulting in an increase in leaf size.

[0079] To observe the differences in leaf thickness between the WT and overexpression plants, the same position of the seventh rosette leaf of Arabidopsis thaliana was selected for transverse sectioning in this example, and the leaf thickness photographed under a 10× electron microscope was measured using Image j software. Compared with the WT, the leaf thickness of the miR159b overexpression plants increased by more than 110 μm, while the leaf thickness of the CsGAMYB overexpression lines decreased by more than 120 μm.( Figure 2 )

[0080] The results showed that the overexpression of CsGAMYB inhibited the development of plant leaves: the overexpression of CsGAMYB in plants inhibited cell growth, resulting in a decrease in leaf thickness, area, length, and width, while the overexpression of miR159b could restore the development of plant leaves.

[0081] Example 3 Effects of miR159b cleavage of CsGAMYB on plants

[0082] 1. Verification of miR159b cleavage of CsGAMYB in tea plants

[0083] Using the 5’RLM-RACE technique, the FirstChoice RLM-RACE kit (Invitrogen, Thermo Fisher Scientific) was used to verify the cleavage of CsGAMYB by miR159b. Under the action of T4 RNA ligase, the designed 5’ adapter was ligated to the total RNA of tea plants (greater than 1000 ng), and then reverse transcribed into cDNA using random primers; the obtained cDNA was subjected to two rounds of PCR amplification using the 5’ adapter primer and the 3’ gene-specific primer and analyzed on an agarose gel. The obtained target band was purified using a DNA gel extraction kit (Code no.DR01, Aidlab, Beijing, China) and then cloned into the pTOPO-TA vector (Code no.CV14, Aidlab, Beijing, China), and transformed into DH5α chemically competent cells (Code no.G6016, Shanghai, China). The sequencing was used to determine whether the mRNA was the cleavage site of miRNAs. The 5’ adapter sequence used in the 5’RLM-RACE experiment and the information of the 3’ gene-specific primers are shown in the following table.

[0084] Primer Name Primer Sequence (5’-3’) 5’RACE-adapter GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA RACE outer primer GCTGATGGCGATGAATGAACACTG RACE inner primer CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG CsGAMYB-out AACCCCCATCCTGGACTCAAT CsGAMYB-in GAGCCAACATGACCCAAGTAAA

[0085] After sequencing the obtained gene fragments, 4 out of 10 sequencing results had the target bands, proving that in tea plants, miR159b can degrade CsGAMYB by complementary pairing with the target site ( Figure 3 ).

[0086] 2. Verification of the cleavage of CsGAMYB by miR159b in tobacco

[0087] Verify the cleavage effect of miR159b on CsGAMYB using tobacco transient expression experiments. The overexpression vector of Csn-miR159b uses the pBI121 vector with Kan resistance. The construction method is as follows: Using homologous recombination, insert the MIR gene containing the miR159b precursor sequence into the pBI121 vector digested with XbaI and SacI. The overexpression vector of the CsGAMYB target site uses the pMS4 vector with Spe resistance. The construction method is as follows: Synthesize two complementary target site sequences (21nt) respectively, and insert the double-stranded DNA formed after annealing the two oligonucleotide DNAs into the XhoⅠ and XbaⅠ restriction sites of the pMS4 vector using homologous recombination. Transform the recombinant plasmid into the Agrobacterium strain GV3101 by chemical transformation, and screen to obtain recombinant Agrobacterium strains containing the recombinant plasmids miR159b and CsGAMYB. Combine the Agrobacterium in pairs and infiltrate into the tobacco leaves from the back through a disposable needle. Under normal culture conditions, observe the expression of GFP fluorescence with a handheld ultraviolet analyzer (ZF-5) and a live imaging instrument (NightSHADE L985, Berthold) 3 days later. To ensure the rigor of the experiment and exclude other interferences, a mutant target gene site that cannot target CsGAMYB (negative control) and a target site that is completely complementary to the mature sequence of miR159b (positive control) were constructed respectively. The primers used for the construction of the MIR gene of miR159b and the CsGAMYB target site are shown in the following table.

[0088] Primer Name Primer Sequence (5’-3’) miR159b-HR-F GAGAACACGGGGGACTCTAGACCTCTCAAGTGACCAGAAATAGC miR159b-HR-R CGATCGGGGAAATTCGAGCTCTGAAATCAAGGGATTAGAGTGG CsGAMYB-HR-F TCCTCGGCCGAATTCCTCGAGTGGAGCTCCCTTCACTCCAAT CsGAMYB-HR-R TTCTTCTCCTTTACTTCTAGAATTGGAGTGAAGGGAGCTCCA

[0089] The results showed that only when the bacterial solutions containing the pBI121 empty vector and the CsGAMYB target site gene were co-injected into the tobacco leaves, strong fluorescence signals were expressed on the left side of the leaves. This conclusion was further verified through positive and negative control experiments: when miR159b could not cleave the mutant target site, the fluorescence signal was stronger; while when miR159b could completely cleave the complementary target site, the fluorescence signal weakened or even disappeared. It shows that miR159b binds complementarily to the target site of CsGAMYB and promotes its degradation ( Figure 4 ).

[0090] Other parts not described in detail are prior art. Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A tea plant CsGAMYB gene, characterized in that: The nucleotide sequence of the CDS sequence of the CsGAMYB gene is shown in SEQ ID NO.

1.

2. A recombinant plasmid pBinRed3-CsGAMYB, characterized in that: The recombinant plasmid pBinRed3-CsGAMYB is obtained by inserting the CsGAMYB gene according to claim 1 into the vector pBinRed3.

3. An Agrobacterium strain containing the recombinant plasmid pBinRed3-CsGAMYB according to claim 2, characterized in that: The Agrobacterium strain is GV3101.

4. Use of the CsGAMYB gene according to claim 1 in regulating leaf growth and development.

5. Use of any of the following in cultivating a new variety of Arabidopsis thaliana with good leaf growth and development, characterized in that: include (1) The CsGAMYB gene according to claim 1; (2) the recombinant plasmid pBinRed3-CsGAMYB according to claim 2; (3) The Agrobacterium strain according to claim 3.

6. An application of a precursor sequence of tea plant miR159b gene to interfere with CsGAMYB gene expression in leaf growth and development, characterized in that: The nucleotide sequence of the precursor sequence of the tea plant CsmiR159b gene is shown in SEQ ID NO.

2.

7. The use according to claim 6, characterized in that: The plant is tea tree, Arabidopsis thaliana or tobacco.

8. The use according to claim 6 or 7, characterized in that: The interference is the shearing of CsGAMYB gene by miR159b gene.

9. Use of the precursor sequence of the tea plant miR159b gene according to claim 6 in cultivating a new variety of Arabidopsis thaliana that promotes leaf growth and development.

10. The use according to claim 9, characterized in that: The application is to connect the precursor gene of the tea tree miR159b gene to a vector, transform it into Arabidopsis thaliana through Agrobacterium-mediated transformation, and screen, culture and obtain transgenic strains.

Citation Information

Patent Citations

  • Application of tea tree MYB transcription factor gene in regulation and control of tea tree caffeine biosynthesis

    CN113234737A

  • Application of tea tree CsGS2 gene in regulation of plant glutamine metabolism and promotion of plant leaf growth

    CN115896166A

  • Application of target gene of maize miR159a in resisting maize chlorotic mottle virus

    CN116855530A

  • Tea tree CsGRF7 gene and application thereof

    CN119193612A

  • Plant extract and uses thereof in agriculture

    WO2023017457A1