Camellia sinensis CsGAMYB gene and application thereof in regulation of leaf growth and development

By overexpressing the CsGAMYB gene of tea tree and the recombinant plasmid pBinRed3-CsGAMYB in Arabidopsis thaliana, the expression of miR159b was regulated, solving the problem of regulating the growth and development of tea leaves, achieving significant changes in leaf size and thickness, and improving tea quality and yield.

CN120158459BActive Publication Date: 2026-02-03HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510465163.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-15
Publication Date
2026-02-03
Estimated Expiration
2045-04-15

AI Technical Summary

Technical Problem

The function of miR159b in tea plants is still unclear, affecting the regulation of tea quality and yield. Existing technologies are insufficient to effectively regulate the growth and development of tea leaves.

Method used

The CsGAMYB gene and its recombinant plasmid pBinRed3-CsGAMYB from the tea plant were provided and transformed into Arabidopsis thaliana via Agrobacterium-mediated transformation to interfere with the precursor sequence of the miR159b gene in the tea plant to regulate leaf growth and development.

Benefits of technology

By regulating the expression of miR159b and CsGAMYB, the size and thickness of Arabidopsis leaves were significantly affected, demonstrating that overexpression of CsGAMYB inhibits leaf development, while overexpression of miR159b promotes leaf thickening, providing a means to regulate the growth and development of tea leaves.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158459B_ABST
    Figure CN120158459B_ABST
Patent Text Reader

Abstract

The application discloses a tea tree CsGAMYB gene and application thereof in regulation of leaf growth and development, wherein the CDS sequence is shown as SEQ ID NO. 1. A gene interfering with CsGAMYB gene expression is a precursor sequence of a tea tree miR159b gene. In an Arabidopsis thaliana miR159b overexpression strain, leaf length, leaf width, leaf area and petiole length are significantly increased; in an Arabidopsis thaliana CsGAMYB overexpression strain, leaf length, leaf width, leaf area and petiole length are significantly reduced; through microscope observation, lower epidermal cells of the leaf are obviously less than WT in the miR159b overexpression plant, and obviously more than WT in the CsGAMYB overexpression plant, overexpression of CsGAMYB in the plant inhibits cell growth, leading to reduction of leaf thickness, area, length and width, and overexpression of miR159b can restore development of the plant leaf.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a tea tree CsGAMYB gene and its application in regulating leaf growth and development. Background Technology

[0002] Tea is an important economic crop in my country. Tea products made from its leaves are popular with consumers due to their diverse appearance, rich flavor, and high content of catechins and theanine, which are beneficial to human health. Leaves are vital nutrient organs for plants, performing transpiration, photosynthesis, and gas exchange. As a leaf-based economic crop, the development of tea leaves directly affects the yield and quality of tea. Therefore, identifying key genes regulating tea leaf development and deeply analyzing their related molecular regulatory mechanisms can provide important genetic resources for improving tea quality and lay a theoretical foundation for targeted variety breeding and molecular breeding of tea.

[0003] Numerous studies have shown that miRNAs play a vital role in various processes of plant growth and development. MiR159 is a relatively conserved miRNA family in plants and has been shown to participate in the regulation of organ growth and development in a variety of plants. However, the function of miR159b in tea plants remains unclear. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide an application of the CsGAMYB gene in tea trees in regulating leaf growth and development.

[0005] To achieve the above objectives, the technical solution designed by the present invention is as follows:

[0006] This invention provides a CsGAMYB gene for tea plants, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides a recombinant plasmid pBinRed3-CsGAMYB, wherein the recombinant plasmid pBinRed3-CsGAMYB is formed by inserting the above-mentioned CsGAMYB gene into the vector pBinRed3.

[0008] The present invention also provides an Agrobacterium strain containing the above-mentioned recombinant plasmid pBinRed3-CsGAMYB, wherein the Agrobacterium strain is GV3101.

[0009] The present invention also provides an application of the above-mentioned CsGAMYB gene in regulating leaf growth and development.

[0010] The following are applications in cultivating new Arabidopsis thaliana varieties with good leaf growth and development, including

[0011] (1) The CsGAMYB gene mentioned above;

[0012] (2) The above-mentioned recombinant plasmid pBinRed3-CsGAMYB;

[0013] (3) The above-mentioned Agrobacterium strain.

[0014] The present invention also provides an application of the precursor sequence of the tea plant miR159b gene interfering with the expression of the CsGAMYB gene in leaf growth and development, wherein the nucleotide sequence of the precursor sequence of the tea plant CsmiR159b gene is shown in SEQ ID NO.2.

[0015] Furthermore, the plant is tea tree, Arabidopsis thaliana, or tobacco.

[0016] Furthermore, the interference is the cleavage of the CsGAMYB gene by the miR159b gene.

[0017] The present invention also provides an application of the above-mentioned tea plant miR159b gene precursor sequence in the cultivation of new Arabidopsis thaliana varieties that promote leaf growth and development.

[0018] Furthermore, the application involves ligating the precursor sequence of the tea plant miR159b gene into a vector, transforming it into Arabidopsis thaliana via Agrobacterium-mediated transformation, and then screening, culturing, and obtaining transgenic lines.

[0019] The beneficial effects of this invention are:

[0020] This invention, through degradome data, discovered that the target gene of miR159b in tea is CsAMYB. Quantitative fluorescence analysis showed that the expression levels in nine tissues of tea (bud, first leaf, third leaf, young stem, mature leaf, old leaf, lateral root, flower, and fruit) exhibited opposite trends, consistent with the pattern of miRNA negatively regulating target genes in plants. The 5' RLM-RACE experiment confirmed that the cleavage site of miR159b on CsAMYB is between the 11th and 12th bases at the 5' end of the target site region; transient expression experiments in tobacco leaves also confirmed the cleavage effect of miR159b on CsAMYB.

[0021] This invention analyzed the expression patterns of Csn-miR159b and CsGAMYB in tea plants using qRT-PCR in 'FDDB' buds (B), first leaf (FL), third leaf (TL), young stem (TS), mature leaf (ML), old leaf (OL), flower (F), and fruit (S). The results showed that miR159b expression was highest in the first leaf and gradually decreased with leaf development. CsGAMYB expression gradually increased with leaf development, reaching its highest level in the third leaf, and then gradually decreased with further leaf development.

[0022] In summary, miR159b and CsGAMYB may regulate tea leaf development. This invention constructed overexpression vectors for miR159b and CsGAMYB and heterologously transformed them into wild-type Arabidopsis. Stable overexpression of miR159b and CsGAMYB genes in Arabidopsis revealed that CsGAMYB overexpression resulted in slow overall plant development, primarily manifested as short leaves; while miR159b overexpression plants exhibited normal development and thicker leaves. This indicates that CsGAMYB overexpression inhibits leaf development. The petiole length, leaf length, leaf width, and leaf area (biological replicates greater than 10) of the 7th rosette leaf were statistically analyzed in wild-type, miR159b overexpression, and CsGAMYB overexpression lines. The results showed that compared to the wild-type, miR159b overexpression plants exhibited significantly increased leaf length, leaf width, leaf area, and petiole length, while CsGAMYB overexpression plants showed significantly decreased leaf size. This demonstrates that miR159b promotes plant leaf development by negatively regulating the expression of CsGAMYB. Attached Figure Description

[0023] Figure 1 The images show the positive identification results of Arabidopsis thaliana miR159b (left) and CsGAMYB (right) overexpression lines.

[0024] Figure 2 Phenotypic diagrams of miR159b and CSGAMYB transgenic Arabidopsis thaliana;

[0025] Figure 3 Figure 1 shows the experimental results of 5'RLM-RACE.

[0026] In the figure, the red arrows indicate the degradation sites of CsGAMYB, and the numbers represent the proportion of CsGAMYB that broke at the miR159b target site in the sequencing sample.

[0027] Figure 4 Interaction diagram of CsGAMYB and miR159b for transient tobacco system verification;

[0028] In the figure, A represents the construction diagram of the Agrobacterium-mediated transient transformation vector for tobacco:

[0029] (a) Empty vector, (b) precursor sequence of miRNA, (c) target gene site, (d) mutation site of target gene, (e) complete complementation site of miRNA target gene.

[0030] B shows the GFP fluorescence signal of different combinations under a live imaging system. Detailed Implementation

[0031] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0032] Example 1: Screening for genes miR159b and CsGAMYB related to tea leaf growth and development

[0033] 1. Extraction of tea plant genomic DNA

[0034] Total DNA from tea plants was extracted using the CTAB extraction method, and the steps are as follows:

[0035] 1) Weigh 0.5g of sample material, add 1mL of washing solution, invert to mix, centrifuge at 12000r / min for 5min, and discard the supernatant;

[0036] 2) Add 800 μL of CTAB lysis buffer (CTAB extract), stir well with a pipette tip or gently aspirate to mix well, in a 65°C metal bath for 30 min, then add 800 μL of chloroform:isoamyl alcohol:ethanol = 80:4:16 in a fume hood, and gently shake to make it emulsified;

[0037] 3) Centrifuge at 12000 r / min for 10 min;

[0038] 4) Transfer the supernatant to a new 2mL centrifuge tube, add an equal volume of isopropanol in a fume hood, centrifuge at 12000r / min for 5min, and discard the supernatant;

[0039] 5) Add 75% ethanol to wash the DNA, centrifuge at 12000 r / min for 5 min, and discard the supernatant;

[0040] 6) Open the centrifuge tube and dry it in a clean bench with the fan on level 3. The DNA should still be slightly moist.

[0041] 7) Add 50-100 μL ddH2O, dissolve completely at 37℃, and measure the concentration;

[0042] 8) Prepare the working solution by diluting it to 200 ng / μL. Store the working solution and the stock solution at -20°C.

[0043] 2. Extraction of RNA from tea trees

[0044] A simplified CTAB-LiCl method for extracting total RNA, with appropriate modifications, is described below:

[0045] 1) Add two steel balls to a 2mL centrifuge tube, seal it tightly, and pre-cool it in liquid nitrogen. Take 0.1g of plant material, put it into the centrifuge tube, and grind it into powder using a liquid nitrogen mill at 50Hz for 1min;

[0046] 2) Quickly add 900 μL of CTAB extraction solution and 45 μL of β-mercaptoethanol. Shake thoroughly to mix, incubate in a 65°C water bath for 30 min, and invert once every 10 min to mix.

[0047] 3) Centrifuge at 12000 rpm for 10 min at 4℃. Transfer the supernatant to a new 2 mL centrifuge tube, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), mix gently, and incubate at 4℃ for 10 min. Repeat this step once.

[0048] 4) Centrifuge at 12000 r / min for 15 min at 4℃. Aspirate the supernatant, add 1 / 3 volume of LiCl (8 mol / L) and 1% β-mercaptoethanol, mix well, and incubate at -20℃ overnight;

[0049] 5) Centrifuge at 4℃, 13000 r / min for 40 min, and discard the supernatant. Wash the precipitate twice with 75% ethanol, dry it in a fume hood to remove any remaining ethanol, and add 30 μL of RNase-free H2O;

[0050] 6) The concentration of RNA was determined using a micro spectrophotometer, and the quality of RNA was detected by electrophoresis on a 1% agarose gel. The remaining RNA was stored in an ultra-low temperature freezer at -80°C.

[0051] 3. Amplification of miR159b and CsGAMYB:

[0052] (1) Design primers

[0053] Primer name Primer sequence (5'-3') miR159b-F CCTCTCAAGTGACCAGAAATAGC miR159b-R TGAAATCAAGGGATTAGAGTGG CsGAMYB-F ATGAGTCACATGACAAATGA CsGAMYB-R TCAAGGAAGTTCAGACATCT

[0054] (2) Using the above-mentioned tea plant genomic DNA as a template, the precursor sequence containing miR159b was amplified as shown in SEQ ID NO.2:

[0055] CCTCTCAAGTGACCAGAAATAGCAAGTCTGCAAGGGAAAAAAAAAAGGTTAAACGAAAAAGTAGAAGAATAGTCAGTACTCAGTACCCAGATTCATACAAATACATGTACGGTCAAATCAAATATCTAAGATTCAAGATCACATAGGGAGTGTTGAGTGAAGCTTATTAGTAAAAAGTAAAAAGTTGATAATTAAAAAAAGTAAAAATCAAAAGCATTTCTCCTCAAGATTCATATATTCAGTATTTTTTGATTATTTTTGCATAATAAATTATAAAAAGAAGTTGCACCAAACAATATTTGTACATGAATGGATGGTGAAGGGGAGAGAGAGATAGATGTAGAGCTCCCTTCAATCCAAAACAAGATCCAACTTAGGGTTAATGCAGCTCCTGACATATGCAAGCCACAAATCTATCCAATTAGTAAACCAAAACAAACAAAGATTGGATAGGAATGAGGGATCCATAGTTCAGCAGCTCAATCTTCCCGGTATGATCCTCTATTGGACTTCAAGGAGCTCCACTCTAATCCCTTGATTTCA;

[0056] The mature sequence of miR159b is shown in SEQ ID NO.3:

[0057] TAGAGCTCCCTTCAATCCAAA;

[0058] The ORF sequence of CsGAMYB is shown in SEQ ID NO.1:

[0059]

[0060] Example 2: Functional verification of the miR159b and CsGAMYB genes in tea plants

[0061] 1. Cultivation of Arabidopsis thaliana overexpression lines

[0062] (1) Using the above-mentioned tea plant miR159b and CsGAMYB genes as templates, primers were designed with homologous recombination adapters (Tsingke) added to the 5' end to amplify the fragment containing the miR159b precursor (SEQ ID NO.2) and the full-length ORF of CsGAMYB, respectively. The primer sequences are detailed in the table below.

[0063] Primer name Primer sequence (5'-3') miR159b-F1 GAGAACACGGGGGACTCTAGACCTCTCAAGTGACCAGAAATAGC miR159b-R1 CGATCGGGGAAATTCGAGCTCTGAAATCAAGGGATTAGAGTGG CsGAMYB-F1 TCCTCGGCCGAATTCCTCGAGTGGAGCTCCCTTCACTCCAAT CsGAMYB-R1 TTCTTCTCCTTTACTTCTAGAATTGGAGTGAAGGGAGCTCCA

[0064] The miR159b MIR gene and its target gene CsGAMYB were inserted into the pBinRed3 vector after being double-digested with EcoRI and Xhol using homologous recombination, resulting in recombinant plasmids of miR159b and CsGAMYB, respectively.

[0065] (2) The recombinant plasmid was transformed into Agrobacterium strain GV3101 by chemical transformation, and two recombinant Agrobacterium strains containing recombinant plasmid miR159b and recombinant plasmid CsGAMYB were screened to obtain two recombinant Agrobacterium strains.

[0066] (3) Inflorescences of healthy Arabidopsis thaliana plants that had grown for about a month were infected with recombinant Agrobacterium strains containing recombinant plasmid miR159b and recombinant plasmid CsGAMYB, respectively. The infection was repeated 4-5 times every four days. Mature seeds were collected, dried in an oven at 28℃, and then selected by ultraviolet light to obtain T0 generation seeds with red fluorescence.

[0067] 2. The expression levels of miR159b and CsGAMYB in Arabidopsis thaliana overexpression lines were detected by RT-PCR:

[0068] Total RNA was extracted from leaves of transgenic and wild-type Arabidopsis thaliana using a plant RNA extraction kit, and reverse transcription was performed using a reverse transcription kit (Simgen). The reverse transcription primers for CsGAMYB were random primers, while the reverse transcription primers for miR159b were stem-loop primers designed based on the sequence. The internal reference gene for quantitative real-time CsGAMYB was GAPDH, and the internal reference gene for miR159b was U6.

[0069] Using 2×Sybr Green qPCR mixture (PC6102, Adley), on an AB StepOne Plus real-time PCR system, the following procedure was followed: denaturation at 94°C for 3 min; annealing at 94°C for 10 sec, then at 60°C for 34 sec (40 cycles); annealing at 95°C for 15 sec, then at 65°C for 1 min; then reaching 95°C at a rate of 0.3°C / sec, followed by annealing at 95°C for 15 sec. -ΔΔCt The method is used to calculate relative expression levels. Each PCR reaction must be independently repeated at least three times. Primer sequences are shown in the table below.

[0070] Primer name Primer sequence (5'-3') CsU6-F CGGGGACATCCGATAAAATTG CsU6-R GGACCATTTCTCGATTTGTGC CsGAPDH-F TTGGCATCGTTGAGGGTCT CsGAPDH-R CAGTGGGAACACGGAAAGC miR159b-stem GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGAGC MiR159b-F2 CGTAATTTGGATTGAAGGGA MiR159b-R2 GTGCAGGGTCCGAGGT CsGAMYB-F2 CCTTCACTCCAATATCCAGAAACT CsGAMYB-R2 TTGTACTTAGAGTCTTCGCCTCGT

[0071] The results showed that the expression levels of miR159b and CsGAMYB were significantly increased in transgenic Arabidopsis containing miR159b and CsGAMYB, respectively. Figure 1 This indicates that the miR159b and CsGAMYB genes from tea plants have been successfully transferred into Arabidopsis thaliana and are stably expressed.

[0072] 3. Heterologous expression of miR159b and CsGAMYB affects Arabidopsis leaf development.

[0073] (1) After overexpressing CsGAMYB in Arabidopsis thaliana, the plants developed slowly, mainly with short leaves; while the plants overexpressing miR159b developed normally with thick leaves.

[0074] The petiole length, leaf length, leaf width, and leaf area of ​​the 7th rosette leaf were statistically analyzed in wild-type, miR159b, and CsGAMYB overexpression lines (with more than 10 biological replicates).

[0075] The results showed that, compared with the wild type, the leaf length, leaf width, leaf area and petiole length of the miR159b overexpressing plants were significantly increased, while those of the CsGAMYB overexpressing plants were significantly reduced.

[0076] (2) Microscopic observation of the thickness of cross-section of the leaf

[0077] When the plants reach 28 days old, take the 7th rosette leaf of WT, miR159b and CsGAMYB, cut a 5mm x 5mm piece from each leaf, avoiding the main vein, and immediately place the cut sample into FAA fixative for fixation. Vacuum permeation for 20-30 minutes, paraffin section, stain and prepare 4μm thick leaf cross sections, observe and photograph under an optical microscope (BM-1000).

[0078] We selected WT, miR159b, and CsGAMYB overexpressing plants that had grown for 28 days after seed germination, and observed the epidermal cells of the 7th rosette leaf. Under the same magnification, area, and field of view, the number of lower epidermal cells in the leaves was significantly less in the miR159b overexpressing plants than in the WT plants, while the number of cells in the CsGAMYB overexpressing plants was significantly more than in the WT plants. This indicates that miR159b promotes leaf cell expansion and increases leaf size by negatively regulating CsGAMYB expression.

[0079] To observe the difference in leaf thickness between WT and overexpression plants, this example selected the same position on the 7th rosette leaf of Arabidopsis thaliana for cross-section, and measured the leaf thickness under a 10× electron microscope using Imagej software. Compared to WT, the leaf thickness of miR159b overexpression plants increased by more than 110 μm, while the leaf thickness of CsGAMYB overexpression lines decreased by more than 120 μm. Figure 2 )

[0080] The results showed that CsGAMYB overexpression inhibited plant leaf development: CsGAMYB overexpression in plants suppressed cell growth, leading to a reduction in leaf thickness, area, length and width, while miR159b overexpression restored plant leaf development.

[0081] Example 3: Effects of miR159b on the shearing of CsGAMYB on plants

[0082] 1. Verify miR159b's cleavage effect on CsGAMYB in tea plants.

[0083] The cleavage of CsGAMYB by miR159b was verified using the FirstChoice RLM-RACE kit (Invitrogen, Thermo Fisher Scientific) with 5' RLM-RACE technology. The designed 5' adapter was ligated to total RNA (greater than 1000 ng) from tea plants using T4 RNA ligase, followed by reverse transcription to cDNA using random primers. The resulting cDNA was amplified by two rounds of PCR using 5' adapter primers and 3' gene-specific primers, and analyzed on agarose gels. The target band was purified using a DNA gel extraction kit (Code no. DR01, Aidlab, Beijing, China) and cloned into the pTOPO-TA vector (Code no. CV14, Aidlab, Beijing, China), which was then transformed into DH5α chemocompetent cells (Code no. G6016, Shanghai, China). Sequencing was used to determine whether the mRNA was a cleavage site for miRNAs. The 5' adapter sequence and 3' specific primer information used in the 5'RLM-RACE experiment are shown in the table below.

[0084] Primer name Primer sequence (5'-3') 5'RACE-adapter GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA RACE outer primer GCTGATGGCGATGAATGAACACTG RACE inner primer CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG CsGAMYB-out AACCCCCATCCTGGACTCAAT CsGAMYB-in GAGCCAACATGACCCAAGTAAA

[0085] After sequencing the obtained gene fragments, 4 out of 10 sequencing results contained the target band, demonstrating that miR159b can degrade CsGAMYB in tea plants through complementarity with the target site. Figure 3 ).

[0086] 2. Verification of miR159b's cleavage of CsGAMYB in tobacco

[0087] The cleavage effect of miR159b on CsGAMYB was verified using transient expression experiments in tobacco. The Csn-miR159b overexpression vector was the pBI121 vector with Kan resistance. Construction method: The MIR gene containing the miR159b precursor sequence was inserted into the pBI121 vector after double digestion with XbaI and SacI using homologous recombination. The CsGAMYB target site overexpression vector was the pMS4 vector with Spe resistance. Construction method: Two complementary target site sequences (21nt) were synthesized, and the double-stranded DNA formed after annealing the two oligonucleotide DNA sequences was inserted between the XhoI and XbaI restriction sites of the pMS4 vector using homologous recombination. The recombinant plasmids were chemically transformed into the Agrobacterium strain GV3101, and recombinant Agrobacterium strains containing both recombinant plasmids miR159b and CsGAMYB were screened. The Agrobacterium strains were then combined in pairs and injected into tobacco leaves from the back using a disposable needle. Under normal culture conditions, GFP fluorescence expression was observed 3 days later using a handheld UV analyzer (ZF-5) and a live-cell imaging system (NightSHADE L985, Berthold). To ensure the rigor of the experiment and eliminate other interferences, mutant target gene sites that could not target CsGAMYB (negative control) and target sites that were completely complementary to the mature miR159b sequence (positive control) were constructed. Primers used for constructing the miR159b MIR gene and CsGAMYB target sites are shown in the table below.

[0088] Primer name Primer sequence (5'-3') miR159b-HR-F GAGAACACGGGGGACTCTAGACCTCTCAAGTGACCAGAAATAGC miR159b-HR-R CGATCGGGGAAATTCGAGCTCTGAAATCAAGGGATTAGAGTGG CsGAMYB-HR-F TCCTCGGCCGAATTCCTCGAGTGGAGCTCCCTTCACTCCAAT CsGAMYB-HR-R TTCTTCTCCTTTACTTCTAGAATTGGAGTGAAGGGAGCTCCA

[0089] The results showed that only when bacterial cultures containing both the pBI121 empty vector and the CsGAMYB target site gene were co-injected into tobacco leaves did the left side of the leaf exhibit strong fluorescence signal expression. Positive and negative control experiments further validated this conclusion: when miR159b could not cleave the mutant target site, the fluorescence signal was strong; while when miR159b could completely cleave the complementary target site, the fluorescence signal weakened or even disappeared. This indicates that miR159b binds complementary to the CsGAMYB target site and promotes its degradation. Figure 4 ).

[0090] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a precursor sequence of the tea plant miR159b gene in the cultivation of Arabidopsis thaliana varieties that promote leaf growth and development, characterized in that: The nucleotide sequence of the precursor sequence of the tea plant CsmiR159b gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that: The application involves linking the precursor gene of the tea plant miR159b gene to a vector, transforming it into Arabidopsis thaliana via Agrobacterium-mediated transformation, and then screening, culturing, and obtaining transgenic lines.