Application of BnBRC1 and BnGA5 genes in improvement of branching and plant height in plants

Through the CRISPR/Cas9 technology, the BG double-knocking strain system was constructed, which solved the technical problems of rape branching and plant height regulation, achieved a multi-branching and dwarf phenotype, enhanced the branching ability and plant height regulation of crops, and supported the cultivation and yield of new rape varieties.

CN120158460APending Publication Date: 2025-06-17LANZHOU UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510541789.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-28
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

The specific regulatory effect of Bn.BRC1 and BnGA5 genes on branching and plant height in rapeseed has not yet been clarified. It is difficult to effectively improve plant branching ability and reduce plant height by constructing transgenic plants to enhance yield and resist lodging.

Method used

Through CRISPR/Cas9 technology, the BG double-knocking strain line was constructed to regulate the branching and plant height of rapeseed, and achieve a multi-branching and dwarf phenotype.

Benefits of technology

Successfully conferring rapeseed with multi-branched and dwarfed phenotypes, enhancing the branching capacity and plant height regulation of crops, providing support for the principle of molecular biology, for cultivating new rapeseed varieties, increasing yields and reducing the risk of lodging.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158460A_ABST
    Figure CN120158460A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, in particular to application of BnBRC1 and BnGA5 genes in improvement of branches and plant heights in plants. The invention provides application of BnBRC1 and BnGA5 knockout genes in increasing the number of plant branches and reducing the plant height. The construction of BnBRC1 and BnGA5 (hereinafter referred to as BG double knockout) strains shows that compared with a wild type, the BG double knockout strains endow the rape with multi-branching and dwarfing phenotypes, and shows that the BnBRC1 and BnGA5 genes have a negative regulation effect on increasing the number of branches and have a positive regulation effect on increasing the plant height, and the BnBRC1 and BnGA5 genes have a positive regulation effect on increasing the plant height. The molecular biology principle support is provided for improving the branching capacity and reducing the plant height by constructing a transgenic plant, and the method can be used for cultivating a new rape variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to Bn.BRC1, BnGA5 the application of genes in improving branches and plant height in plants. Background Art

[0002] Branching and plant height are key factors in the development of plant architecture, and plant architecture plays an important role in the adaptability of plants and the yield of crops. In agricultural breeding, semi-dwarf varieties have advantages such as lodging resistance, high yield, and better adaptability to mechanical harvesting compared to other varieties. GA5(AT4G25420) As genes involved in gibberellin synthesis have been widely applied in rice, BRC1(AT3G18550) regulating plant branching, and there have also been a large number of studies on them as domestication genes in maize. However, the combined effect of the two on the plant architecture of rapeseed is not yet clear.

[0003] CRISPR (Clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated gene) is an immune mechanism derived from bacteria for degrading the DNA of invading viruses or other foreign DNA, mainly composed of CRISPR elements and Cas genes. In bacteria, CRISPR elements are a unique cluster of DNA repeat sequences, composed of some highly conserved repeat sequences (Repeats) and spacer sequences (Spacer) arranged alternately, and Cas genes are some highly conserved gene families located near the CRISPR sequence. Cas proteins have nuclease activity and can cleave DNA sequences.

[0004] When this immune system works, CRISPR the sequence is transcribed into CRISPR RNA (crRNA), which pairs with a partially complementary region of another transcribed trans-activating crRNA (tracrRNA) to form a binary complex. Then, this binary complex guides the Cas protein with nuclease activity to cleave the DNA sequence matching the crRNA, and then integrates it into the genome. When foreign DNA invades again, the nuclease cleavage activity is activated to achieve the cleavage evaluation and screening of foreign DNA: identifying and screening transgenic rapeseed. This includes evaluating the gene expression level, agronomic traits, disease and insect resistance, etc. of transgenic rapeseed.

[0005] Laboratory rapeseed transgenic technology can provide beneficial genes for rapeseed improvement and further enhance the agronomic traits of rapeseed. However, in practical applications, strict safety assessments and regulations are required to ensure that the impact of transgenic rapeseed on the environment and human health is within a controllable range. Summary of the Invention

[0006] The object of the present invention is to provide BnBRC1, BnGA5 The application of genes in improving branch and plant height in plants.

[0007] To achieve the above object of the invention, the present invention provides the following technical solutions: The present invention provides BnGA5 Genes or biological materials containing BnGA5 The genes in any of the following applications: a1. For regulating plant dwarfing; a2. For breeding dwarf plant varieties; a3. For improving the dwarf traits of plant germplasm resources.

[0008] Preferably, the biological material includes any one of the following: b1. A recombinant vector containing the BnGA5 gene; b2. A recombinant microorganism containing the recombinant vector described in b1.

[0009] Preferably, the recombinant vector is a gene knockout vector.

[0010] Preferably, the plant is rapeseed.

[0011] The present invention also provides the application of a recombinant vector containing BnBRC1 and BnGA5 genes in any of the following: c1. For regulating plant multi-branching and dwarfing; c2. For breeding multi-branching and dwarf plant varieties; c3. For improving the multi-branching and dwarf traits of plant germplasm resources.

[0012] Preferably, the recombinant vector is a gene knockout vector.

[0013] Preferably, the plant is rapeseed.

[0014] The present invention also provides a recombinant microorganism, and the recombinant microorganism contains the recombinant vector.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention shows through BG double-knockout line rapeseed that, compared with the wild type, BnBRC1, BnGA5The gene knockout lines endow rapeseed with multi-branched and dwarf phenotypes, indicating that Bn.BRC1, BnGA5 the gene plays a regulatory role in the branching ability and plant height of crops, which provides molecular biological principle support for increasing the branching ability of plants to increase yield and reducing the plant height to prevent lodging by constructing transgenic plants, and can be used to cultivate new rapeseed varieties. Description of the Drawings

[0016] Figure 1 For Example 1 BG Phenotype of double-knockout rapeseed.

[0017] Figure 2 For Example 1 zmpl - BG Map of the double-knockout vector.

[0018] Figure 3 BG Double-knockout rapeseed lines, brc ga5 cri - 1 Schematic diagram of the knockout target.

[0019] Figure 4 BG double-knockout rapeseed lines, brc ga5 cri - 2 Schematic diagram of the knockout target. Detailed Description of the Invention

[0020] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0021] Example 1

[0022] 1. Selection and mapping of major genes for branch number and plant height BRC1 Belongs to the TCP transcription factor family and is a member of the CYC / TB1 subfamily. Members of this family have a conserved TCP domain and are involved in the regulation of plant branching. The main function is lateral branch inhibition: BRC1 is the core gene for plant branching regulation and regulates the morphology of plants by inhibiting the growth of lateral buds. In Arabidopsis thaliana, BRC1 expression is regulated by photoperiod and hormones (such as gibberellin, strigolactone), and an increase in its activity will significantly reduce the number of lateral branches.

[0023] GA5 Belongs to the gibberellin synthase gene family, specifically the GA20-oxidase (GA20ox) family. Members of this family catalyze the key steps in the gibberellin biosynthesis pathway, GA5The encoded GA20-oxidase is responsible for converting inactive gibberellin precursors (GA12 or GA53) into active gibberellins (such as GA4), thereby regulating plant stem elongation, flowering time, and seed germination. Studies have found that mutations or expression changes in the GA20ox gene (such as GA5) can affect the adaptability of plants to extreme environments such as high altitude and low temperature. For example, the GA20ox1 gene of Arabidopsis thaliana in the Qinghai-Tibet Plateau enhances its survival ability in high-altitude environments by regulating silique density. The two work together to coordinate the balance between plant resource allocation and reproductive growth.

[0024] 2. Target Design and Detection Primers BnBRC1 Target 1 (shown in SEQ ID NO.1): cct(a)agcagaacggaccggcacag, acting on 3 genes simultaneously, BnaC01G0404000ZS 、 BnaC05G0413400ZS 、 BnaA01G0326500ZS , with potential effects on BnaC03G0429200ZS and BnaA03G0354000ZS , having a 1bp difference.

[0025] Target 2 (shown in SEQ ID NO.2): ggacaagagatcgtaggatgagg, acting on 2 genes simultaneously, BnaC03G0429200ZS and BnaA03G0354000ZS .

[0026] Target 3 (shown in SEQ ID NO.3): ccatcccttcttcctttgaacaa, acting on 2 genes simultaneously, BnaC01G0404000ZS and BnaA01G0326500ZS .

[0027] Target 4 (shown in SEQ ID NO.4); ttctcaattcgaattcgtccc(a)gg, acting on 4 genes simultaneously, BnaC01G0404000Z 、 BnaC03G0429200ZS 、 BnaA03G0354000ZS 、 BnaA01G0326500ZS .

[0028] BnGA5 Target 1 (shown in SEQ ID NO.7): cccgagcttgacgttcccctcat, editing 4 genes (BnaC07G0465100ZS, BnaC01G0190000ZS, BnaA01G0149400ZS, BnaA03G0486400ZS) simultaneously, Target 2 (shown in SEQ ID NO.8): cctgacgatgagaagccttgcct, simultaneously editing two genes BnaC01G0190000ZS and BnaA01G0149400ZS; Target 3 (shown in SEQ ID NO.9): CCGCCACTTTAGAAGCTTCTAGG, simultaneously editing two genes BnaC07G0465100ZS, 04 BnaA03G0486400ZS.

[0029] The present invention relates to BRC1 The relevant gene numbers in NCBI are as follows: BnaC01G0404000ZS: XM_048744546 / XM_013835496 BnaC05G0413400ZS: XM_013825330 BnaC03G0429200ZS: XM_048753163 / XM_013810702 BnaA03G0354000ZS: XM_013885631 / XM_013885629 BnaA01G0326500ZS: XM_048738303 The present invention relates to GA5 The relevant gene numbers in NCBI are as follows: BnaC07G0465100ZS: XM_022706052 BnaC01G0190000ZS: XM_048744191 BnaA01G0149400ZS: XM_013885711 BnaA03G0486400ZS: XM_022706052 3. Prepare two 50 μL systems and perform amplification reactions according to the reaction systems and procedures in Table 1 and Table 2 below. After amplification, perform electrophoresis on a 1.5% agarose gel at a voltage of 5 v / cm for 20 minutes. Cut out the electrophoretic fragments under ultraviolet light and place them in a system for solubilization and recovery. The recovery procedure can be found in the kit instructions of the specific manufacturer. Dissolve the recovered DNA with 30 μL of water in total volume (the recovered product is labeled as: rDNAt1). After detection without error, ligate it with the vector.

[0030] Table 1 PCR System

[0031] Table 2 PCR Program

[0032] 4. Digest with restriction enzymes and ligate. After the reaction is completed, transform the ligation product into competent cells.

[0033] Table 3 Restriction enzyme ligation system

[0034] Table 4 Reaction conditions

[0035] 5. Transformation Transform 8 μL of the ligation product into Escherichia coli competent cells, spread on a kanamycin-resistant plate, and culture at 37 °C for 12 hours, followed by colony PCR identification.

[0036] 6. Colony PCR identification Pick 10 colonies and inoculate them into 1.5 mL EP tubes and perform PCR identification simultaneously. The specific primers are: BG-T1+: atgaggggaacgtcaagctc (as shown in SEQ ID NO.5) BG-T6-: cccttcttcctttgaacaa (as shown in SEQ ID NO.6) Table 5 PCR system and procedure

[0037] Table 6 PCR procedure

[0038] Perform 10 PCR reactions with a 25 μL system. The target band is about 1.2 kb. Take the bacterial solutions corresponding to 3 positive bands, take 100 μL for sample submission for sequencing, and inoculate the remaining 400 μL of the bacterial solution into 10 mL of kanamycin-resistant LB, shake the tube, and after the sequencing results are obtained, take one tube corresponding to the correct sequencing for plasmid extraction.

[0039] 7. Agrobacterium-mediated genetic transformation of rapeseed (1) Preparation before sowing Wash the covered square box for sowing, prepare 1000 μL blue pipette tips, 50 mL centrifuge tubes, prepare M0 medium, prepare deionized water, send them for autoclaving, and pour the sterile M0 medium into the covered square box for later use.

[0040] (2)Sowing Soak rapeseed seeds (variety: Zhongshuang 11) in 75% alcohol for 1 min, then pour out the alcohol; wash once with sterile water and pour out the water; sterilize with 50% 84 disinfectant for 10 min, and wash the seeds 5 times with sterile water; then use sterile forceps to sow the treated seeds onto M0 medium, sowing 25 seeds per petri dish, and then put the petri dish into a sterile culture box and culture at 24 °C in the dark for 6 d.

[0041] (3)Preparation before infection Wash the large square dishes, glass dishes, 50 mL centrifuge tubes, and 200 μL pipette tips for infection, prepare the culture medium, send it for autoclaving, pour the culture medium into the glass dishes, seal and set aside.

[0042] (4)Activation and preparation of Agrobacterium One day before infection, add antibiotics to 100 mL of liquid LB medium that has been sterilized (add corresponding antibiotics according to the resistance of the Agrobacterium strain (kanamycin (volume ratio 1:1000) and rifampicin (volume ratio 1:500))), inoculate the Agrobacterium strain obtained in step 4, and culture with shaking at 28 °C and 220 rpm for 16 h.

[0043] (5)Infection and co-culture of explants Divide the Agrobacterium liquid culture (OD value of 0.8) obtained in step (4) equally into two 50 mL sterile centrifuge tubes (operate in a laminar flow hood), balance and centrifuge at 3000 rpm for 20 min after balancing, pour out the supernatant, gently wash the cells with 1 mL of suspension (DM) (already added with AS acetosyringone), then pour out, add 1 mL of DM, aspirate and suspend with a pipette, shake well, and place on ice for later use after preparation; At the same time, use sterile forceps and a scalpel to vertically cut the hypocotyls of the seedlings under the above dark culture, cut in DM liquid, and the optimal length of the explants is 1.0 cm; put the cut explants into a dish containing the target bacterial liquid with the prepared concentration for infection for 15 min, with about 150 explants per dish, shake once every 10 min, for a total of 5 times; after infection, gently clamp out the explants with sterile forceps, place them on sterile filter paper to remove the excess surface bacterial liquid, and then use sterile forceps to place the explants on M1 medium and co-culture at 24 °C in the dark for 48 h.

[0044] (6)Selection culture After co-culture, transfer the explants to M2 medium for selection culture for 20 d, and the culture conditions are: light culture at 24 °C, 16 h during the day / 8 h at night. The conditions for differentiation culture and rooting culture are the same as this stage.

[0045] (7)Differentiation culture Transfer the explants after selective culture to M3 medium for differentiation culture, and subculture every 20 days until budding occurs.

[0046] (8)Rooting culture After the buds have differentiated, use sterile forceps and a scalpel to cut the buds from the callus, and then transfer them to M4 medium for rooting. Vitrified young buds need to be cultured for a period of time before they can return to normal and then root.

[0047] (9)Transplanting and soil cultivation Transfer the rooted rapeseed plants to sterilized soil, vernalize them in an incubator at 4°C under 2000 lux light conditions for 15 days, and then transfer them to a greenhouse with a light environment of 22°C and 13000 lux (16-hour light / 8-hour dark cycle) for cultivation.

[0048] 8. Design amplification primer pairs for the sequences adjacent to the target sites to detect the edited seedlings, and the identification results are shown in Figure 3 and Figure 4 . brc1ga5 - cri - 1 and brc1ga5 - cri - 2 are two edited lines, among which brc1ga5 - cri - 1 successfully knocked out two BnBRC1 genes and one BnGA5 gene, while brc1ga5 - cri - 1 successfully knocked out two BnBRC1 genes and another BnGA5 gene.

[0049] 9. Phenotype observation Select 10 pots of appropriate samples each from the double-knock transgenic rapeseed BG lines with similar growth conditions brc1ga5 - cri - 1 , brc1ga5 - cri - 2 and the wild-type ZS11 control line to observe the developmental phenotypes. The results are as shown in Figure 1 . BG The double-knock transgenic lines have phenotypes of more branches and dwarfing compared to the wild-type control lines. In practical production, the characteristic of more branches has the potential to increase yield; the dwarfing trait is more resistant to lodging and is more suitable for planting in high-altitude areas. In terms of yield, BG the double-knock rapeseed has a higher yield and has the potential value of increasing the population yield. From the brc1ga5 - cri - 1 / 2 phenotypes of the knockout lines, knocking out two BRC1 and one GA5 genes can produce the phenotypes of dwarfing and more branches, and perhaps more knockouts can obtain obvious phenotypes of dwarfing and more branches.

[0050] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. BnGA5 Gene or contains BnGA5 The use of genetic biological materials in any of the following: a1. Used to regulate plant dwarfing; a2. Used for breeding dwarf plant varieties; a3. Used to improve the dwarfing traits of plant germplasm resources.

2. The use according to claim 1, characterized in that: The biological material includes any of the following: b1. Containing the BnGA5 Recombinant vectors of genes; b2. A recombinant microorganism containing the recombinant vector described in b1.

3. The use according to claim 2, characterized in that: The recombinant vector is a gene knockout vector.

4. The use according to any one of claims 1 to 3, characterized in that: The plant is rapeseed.

5. Contains BnB and BnGA5 Application of the recombinant vector of the gene in any of the following: c1. Used to regulate plant branching and dwarfing; c2. Used for breeding multi-branched and dwarf plant varieties; c3. Used to improve the multiple branching and dwarfing traits of plant germplasm resources.

6. The use according to claim 5, characterized in that: The recombinant vector is a gene knockout vector.

7. The use according to claim 5 or 6, characterized in that: The plant is rapeseed.

8. A recombinant microorganism, characterized in that The recombinant microorganism contains the recombinant vector according to claim 5 or 6.

Citation Information

Cited By

  • Molecular marker combination remarkably related to effective branch number of rape, primer and application of molecular marker combination

    CN120624718A