Application of watermelon chitinase gene ClChitin in resistance to fusarium wilt

Abstract

The invention discloses application of a watermelon chitinase gene ClChitin in resisting fusarium wilt, and belongs to the technical field of gene engineering. The invention discloses an application of a watermelon chitinase gene ClChitin in resisting fusarium wilt. The nucleotide sequence of the watermelon chitinase gene ClChitin is shown as SEQ ID NO. 1. The invention also discloses an application of the watermelon chitinase gene ClChitin in resisting fusarium wilt. The watermelon chitinase gene ClChitin is over-expressed in the germplasm 'YL' by utilizing a watermelon genetic transformation system, the resistance of a transgenic plant to fusarium wilt can be remarkably improved, and help is provided for watermelon fusarium wilt resistance regulation gene function analysis and new variety breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and more specifically to the application of the watermelon chitinase gene ClChitin in resisting fusarium wilt disease. Background Art

[0002] Watermelon (Citrullus lanatus L.), as an important global crop, is widely planted in many countries. China is a major watermelon producer. By 2022, the national watermelon planting area reached 1.384052 million hm 2 , and the total output was 60.3862 million t (FAO 2022). The main soil-borne disease affecting watermelon planting and production is fusarium wilt. In the production areas where the disease occurs, the watermelon yield has been significantly reduced year by year or even no harvest. Due to the characteristics of long survival time, wide transmission route and short disease cycle of watermelon fusarium wilt, it is very difficult to completely eradicate it with the current control measures. In addition, the existing germplasm resources resistant to fusarium wilt are relatively scarce. Most of the watermelon varieties popularized and planted cannot resist the infection of fusarium wilt, and conventional breeding takes a long time, has high costs and mainly focuses on improving the flavor and quality of watermelon. Therefore, carrying out research on watermelon disease-resistant genes and using molecular breeding methods to cultivate new disease-resistant varieties have very important research significance and economic value for improving watermelon yield and quality.

[0003] Members of the chitinase gene family have been identified in many plants, such as barley, Arabidopsis thaliana, rice, sorghum, melon, corn, cucumber, tomato, Chinese cabbage and soybean. Many studies have shown that chitinase is considered a class of PR proteins. In many species, it not only participates in plant growth and development, but also plays an important role in the interaction between plants, microorganisms and stresses and the regulation of plant growth and development. Chitinase exerts a defensive effect by hydrolyzing the main structural components of insects and fungi, and it can be indirectly induced by activating the systemic acquired resistance (SAR) or HR of plants. In addition, chitinase participates in the SA or HR-mediated effector-triggered immunity (ETI) pathway, as well as the pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) of plants, because its hydrolysis substrate chitin is a well-known PAMP. In addition, chitinase breaks the glycosidic bond connecting the C1 and C4 carboxyl positions of two N-acetyl-D-glucosamine monomers in chitin to release chitooligosaccharides, and chitooligosaccharides can act as inducers to stimulate the expression of chitinase genes in the feedback loop.

[0004] In previous reports, the introduction of exogenous chitinase genes could improve the disease resistance of watermelons. However, the research on how to use endogenous chitinase genes in watermelons to improve their disease resistance and stress resistance has not been deeply carried out.

[0005] Therefore, providing the application of watermelon chitinase gene ClChitin in resisting fusarium wilt is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides the application of watermelon chitinase gene ClChitin in resisting fusarium wilt.

[0007] In order to achieve the above object, the present invention adopts the following technical scheme:

[0008] The application of watermelon chitinase gene ClChitin in resisting fusarium wilt, wherein the nucleotide sequence of the watermelon chitinase gene ClChitin is shown in SEQ ID NO.1.

[0009] Furthermore, the application of a biological material overexpressing watermelon chitinase gene ClChitin in resisting fusarium wilt, wherein the biological material is any one of the following:

[0010] A: An expression cassette capable of overexpressing watermelon chitinase gene ClChitin with the nucleotide sequence shown in SEQ ID NO.1;

[0011] B: A recombinant vector containing the expression cassette described in A;

[0012] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0013] Furthermore, the application of watermelon chitinase gene ClChitin in watermelon breeding, wherein the nucleotide sequence of the watermelon chitinase gene ClChitin is shown in SEQ ID NO.1.

[0014] Furthermore, the application of watermelon chitinase gene ClChitin in breeding watermelon germplasm resistant to fusarium wilt, wherein the nucleotide sequence of the watermelon chitinase gene ClChitin is shown in SEQ ID NO.1.

[0015] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses the application of watermelon chitinase gene ClChitin in resisting fusarium wilt. By overexpressing watermelon chitinase gene ClChitin in germplasm 'YL' using the watermelon genetic transformation system, the resistance of transgenic plants to fusarium wilt can be significantly improved, which provides help for the functional analysis of watermelon fusarium wilt resistance regulatory genes and the breeding of new varieties. Brief Description of the Drawings

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or in the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on the provided drawings.

[0017] Figure 1 The attached figure shows the expression analysis of ClChitin in the transgenic lines of the present invention; ** indicates significant at the p < 0.01 level;

[0018] Figure 2 The attached figure shows the disease phenotypes of some plants after inoculating the wild type WT and transgenic lines of the present invention with Fusarium wilt;

[0019] Figure 3 The attached figure shows the disease phenotypes (a) and incidence rates (b) of all plants after inoculating the wild type WT and transgenic lines of the present invention with Fusarium wilt. Detailed implementation manners

[0020] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0021] The CDS sequence of ClChitin:

[0022] ATGGCTGCCCACAAAATTATCACAACCCTTTCCATCATCTTCCTCCTAGCCTCCATATTCCGATCTTCCGACGCCGCCGGAATCACCATCTATTGGGGCCAAAATGGTAATGAAGGCTCTCTTGCCTCCACTTGCGCTACCGGAAACTACCACATCGTCAACATAGCATTTCTCTCCTCCTTCGGTAGCGGCCGAACTCCGGTCCTCAACCTTGCTGGCCATTGCAACCCTAATAACAATGGTTGCGCCTTCTTGAGCAACCAAATCAAATCTTGCCAAAGCCGAGGCATCAAAGTCCTCCTCTCCATCGGCGGCGGCGCGGGGAGTTATTCACTCTCCTCTGCCAACGATGCAAGACAAGTTGCAAATTTCATTTGGAACAACTACCTCGGCGGTCAGTCGAGCTCACGACCACTCGGCAATGCCGTTTTGGATGGTGTCGATTTCGATATCGAAGCTGGCTCTGGCCAATTTTGGGACGTACTAG CTCGAGAACTGAAGAACAAAGGGCGAGTTATTCTCGCCGCCGCACCGCAGTGTCCGATCCCCGACGCGCACTTGGACGCCGCCATTAAAACAGGTTTGTTTGATTTCGTTTGGGTTCAATTCTACAACAACCCGCCATGTATGTATGCAAATGGAAACCCCAACAATCTCCTGAATTCTTGGAACCGGTGGACGGGTTTTCCGGTCGGGAAGCTGTACATGGGGCTACCGGCGGCACCTGCAGCCGCGCCGAGCGGCGGCTTTATTCCGGCGAATGTGCTCATTTCTCAGGTTCTTCCAAGGATTAAAACTTCCCCCAAGTATGGAGGAATTATGCTGTGGAGTAAGGCATTTGATAATGGCTACA GCAACGCCATTAAAGGAAGTCT TTGA; SEQ ID NO.1.

[0023] Example 1

[0024] 1) Selection of editing sites for gene ClChitin

[0025] Design primers PBI121-ClChitin-F and PBI121-ClChitin-R to amplify the full-length CDS sequence (excluding the stop codon) of the gene according to the CDS sequence of ClChitin (shown in SEQ ID NO.1).

[0026] The specific primer sequences are as follows:

[0027] PBI121-ClChitin-F:

[0028] GAGAACACGGGGGACTCTAGA ATGGCTGCCCACAAAATTATCAC ; SEQ ID NO.2;

[0029] PBI121-ClChitin-R:

[0030] AAGGGACTGACCACCCGGGGA AAGACTTCCTTTAATGGCGTTGC ; SEQ ID NO.3.

[0031] 2) Construction of overexpression vector

[0032] (1) PCR amplification of the CDS sequence of ClChitin:

[0033] Using the watermelon fusarium wilt-resistant germplasm 'M08' as the material, extract total RNA from leaves and reverse transcribe it into cDNA. Using cDNA as the template, PBI121-ClChitin-F and PBI121-ClChitin-R as primers, perform PCR amplification using the high-fidelity enzyme PrimeStarMax Premix (TaKaRa). The amplification system is: PrimeStar Max Premix (2×) 25 μL, template 2.5 μL, upstream and downstream primers 2.5 μL each, ddH2O 17.5 μL. The PCR reaction program is: 98°C for 10 s, 58°C for 5 s, 72°C for 15 s, 38 cycles; 72°C for 5 min.

[0034] (2) Vector digestion:

[0035] Digest the overexpression vector PBI121-GFP with the restriction endonucleases XbaI and BamHI (NEWENGLAND BioLabs). The digestion system is: PBI121-GFP 2 μg, CutSmart buffer 5 μL, XbaI and BamHI 1 μL each, and ddH2O is added to make up to 50 μL. Digest at 37°C for 2 h, and after electrophoresis detection, perform gel extraction.

[0036] Ligation of the PCR product to the vector: The products amplified by PCR were respectively ligated to the digested vector PBI121-GFP by homologous recombination. The ligation system was as follows: the molar ratio of the vector to the inserted fragment was approximately 1:2; 4 μL of 5× reaction buffer; 1 μL of NovoRec Plus recombinase; supplemented with ddH2O to 20 μL. Incubate at 50 °C for 10 min.

[0037] (3) Transformation of the recombinant plasmid:

[0038] Take 5 μl of the ligation product and transform it into Escherichia coli competent cells DH5ɑ by heat shock. Spread it on an LB solid culture plate containing 50 mg / L kanamycin and incubate overnight at 37 °C. Use primers 121JC_F and 121JC_R to perform positive detection on the colonies. After correct sequencing, extract the recombinant plasmid PBI121-GFP-ClChitin and transform it into Agrobacterium competent cells EHA105. After correct PCR verification, it is used for watermelon genetic transformation.

[0039] The specific primer sequences are as follows:

[0040] 121JC_F: GCAAGACCCTTCCTCTATATAAGG; SEQ ID NO.4;

[0041] 121JC_R: GCTGAACTTGTGGCCGTTTACG; SEQ ID NO.5.

[0042] The steps of Agrobacterium transformation are as follows:

[0043] Take 1 μl of the recombinant plasmid and add it to Agrobacterium EHA105 competent cells. Insert it into an ice box for 5 min, then quickly freeze it in liquid nitrogen for 5 min, and place it in a 37 °C water bath for 5 min. Add 400 μl of LB medium without antibiotics to each tube for resuscitation, and transfer it to a shaker at 200 rpm and 28 °C for shaking culture. Take 100 μl of the resuscitated bacterial liquid and spread it on an LB solid medium containing antibiotics (50 mg / L kanamycin). Let it dry at room temperature. After the bacterial liquid is fully absorbed, invert the culture dish and incubate it in an incubator at 28 °C for 2 - 3 days.

[0044] Example 2

[0045] 1) Watermelon genetic transformation:

[0046] Take the seeds of the plump watermelon germplasm 'YL'. After soaking them in distilled water at 50 - 55°C for about 30 min, remove the seed coats. In a laminar flow hood, wash the extracted kernels with 75% alcohol for about 30 s, wash twice with sterile water, then soak and disinfect them with 3% sodium hypochlorite for 15 min, and then wash 5 - 7 times with sterile water and air-dry before sowing them in MS solid medium. Incubate them in the dark at 25°C for 3 d.

[0047] After the seeds germinate, take them out, cut off both ends of the cotyledons, and divide the remaining cotyledon parts into 8 pieces for easy infection. During this period, pick a single colony of EHA105 containing the recombinant plasmid with correct PCR verification into LB liquid medium containing 50 mg / L kanamycin and 20 mg / L rifampicin. When the bacterial liquid concentration is shaken to OD 600 = 0.8, resuspend the bacterial liquid with MS culture medium (MS 5194.43 g / L, sucrose 30 g / L, 6 - BA 1.5 mg / L) to make its final concentration OD 600 = 0.2. Soak the cut cotyledons in the resuspended bacterial liquid for 15 min, take them out and air-dry, and then conduct co-culture in co-culture medium (CM: MS 5194.43 g / L, sucrose 30 g / L, G325 13 g / L, 6 - BA 1.5 mg / L) padded with filter paper. Incubate them in the dark at 25°C for 3 d.

[0048] After 3 d of co-culture, take out the cotyledon pieces and wash away the excess Agrobacterium liquid on the surface with sterile water (wash about 5 - 7 times) until the sterile water is clear. Take them out and air-dry, and then place them on recovery medium (RM: MS 5194.43 g / L, sucrose 30 g / L, G325 13 g / L, 6 - BA 1.5 mg / L, 200 mg / L Timentin) for recovery culture. Incubate them at 28°C for 7 d.

[0049] After 7 days, the subcultured cotyledons were transferred to an MS medium (selection medium SM) containing 1.5 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta for selection culture. They were subcultured at 28 °C for 3 - 4 weeks, with subculture every 7 days. Then, the explants with obvious bud points were transferred to a bud elongation medium (containing 4.43 g / L MS524, 30 g / L sucrose, 3 g / L G3251, 1 g / L inositol, 500 μL / L SH organic solution, 0.01 mg / L NAA, 0.1 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta). The culture conditions were 28 °C, 8 h / d in the dark, 16 h / d under light, and the light intensity was 8000 Lx. The selected buds were cut off (note that the cut should not contain callus) and transferred to an MS medium containing 0.5 mg / L IBA and 200 mg / L Timentin for rooting culture, and cultured at 28 °C until roots grew.

[0050] The SH organic solution contains 10 g / L nicotinic acid, 10 g / L VB1, and 1 g / L VB6.

[0051] When the regenerated seedlings had grown roots and had 4 - 5 true leaves, they were taken out of the culture bottle, and the medium on the roots was slowly rinsed off with clear water. Then they were transplanted into a matrix that had been pre-sterilized by high-temperature and high-pressure. After thoroughly watering, they were cultured while keeping warm and moist. After 3 - 4 days, when water droplets were seen on the lid of the plug tray, the lid was gradually opened for acclimatization.

[0052] 2) Detection of transgenic watermelon plants:

[0053] The DNA of the watermelon regenerated seedlings with GFP fluorescence was extracted using the CTAB method. Steps: Take a small part of young and tender leaves and quickly grind them into powder in liquid nitrogen, and place them in a 1.5 ml centrifuge tube; add 800 μl of preheated CTAB extraction buffer, and water bath at 65 °C for 30 min; add an equal volume of chloroform-isoamyl alcohol, where the volume ratio of chloroform to isoamyl alcohol is 24:1. After mixing evenly, centrifuge at 8000 r / min for 10 min; transfer the supernatant to a new centrifuge tube, add 2 / 3 volume of isopropanol, and gently mix by inverting up and down; centrifuge at 10000 r / min for 10 min; pour off the supernatant, rinse the precipitate twice with 75% (v / v) ethanol, pour it off and then suck dry the remaining liquid. After drying for 3 min, dissolve it with 100 μl of ddH2O (containing 0.1% RNase) and store it at 4 °C for standby.

[0054] Using the extracted DNAs as templates, PCR amplification was performed with 121JC_F and 121JC_R. The positive control was the recombinant plasmid, and the negative control was the DNA of non-transgenic plants. The amplification system was: 2×Taq PCR StarMix with loading Dye 10 μL, template 1 μL, 1 μL each of the upstream and downstream primers, and 7 μL of ddH2O. The PCR reaction program was: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 1 min, for 30 cycles; 72°C for 5 min. The PCR products were recovered according to the band size and subjected to TA cloning. After positive detection by colony PCR, the clones were selected and sent for sequencing and alignment confirmation. A total of three gene overexpression plants were obtained and named ClChitin OE-1, OE-2, and OE-3.

[0055] Extract the total RNA from the leaves of the three overexpression plants and reverse transcribe it into cDNA. Using ClChitin-qPCR-F and ClChitin-qPCR-R as primers, detect the expression of ClChitin, the target gene, in the transgenic lines.

[0056] The specific primer sequences are as follows:

[0057] ClChitin-qPCR-F: GACGCCGCCATTAAAACAGG; SEQ ID NO.6;

[0058] ClChitin-qPCR-R: TGGCGTTGCTGTAGCCATTA; SEQ ID NO.7.

[0059] After detection, the expression of ClChitin in the transgenic lines ClChitin OE-1, OE-2, and OE-3 was increased by at least 3-fold ( Figure 1 ).

[0060] 3) Phenotypic observation of watermelon transgenic plants after inoculation with Fusarium wilt:

[0061] Plant the T1 generations of the CK wild type (WT), overexpression plants ClChitin OE-1, OE-2, and OE-3 in the solar greenhouse and manage them normally. When the seedlings grow to about four leaves and one heart, perform artificial inoculation with Fusarium wilt. The steps are as follows:

[0062] The physiological race 1 of Fusarium oxysporum f.sp. niveum (Fon 1) was inoculated on PDA medium and cultured in the dark at 28 °C for 2 weeks. A small amount of mycelium was scraped in a laminar flow hood and added to potato dextrose broth (PAL: containing 5 g of potato powder, 15 g of dextrose, 10 g of peptone and 5 g of sodium chloride per liter), and cultured on a shaker at 28 °C and 150 rpm for 1 week. The spore suspension was filtered through gauze, and the spore precipitate was retained after centrifugation, and the concentration was adjusted to 1×10 6 . The seedlings were gently removed from the substrate, washed with clean water, and a part of the root tips were cut off, and then immersed in the above spore solution for 15 min ("root-dip inoculation method"). After root-dipping, the seedlings were transplanted into the sterilized substrate. The control group seedlings were immersed in clean water for 15 min, and the seedlings of the control group and the experimental group were photographed at 0, 3, 7 and 12 d respectively. At 12 d, the incidence of each strain was counted. Data analysis was performed using IBM SPSS Statistics 19 and Microsoft Excel 2016.

[0063] As Figure 2 shown, at 3 days after inoculation, there were no obvious changes in the seedlings of the wild type WT and transgenic lines. However, 7 days after inoculation, the WT seedlings showed leaf wilting and plant withering, while the transgenic line seedlings showed significantly less severe wilting; at 12 days after inoculation, most of the WT seedlings had died, while on the contrary, there were individual deaths in the transgenic line seedlings.

[0064] At 12 days after inoculation, according to the disease incidence of all plants (leaf wilting in the early stage of inoculation and death in the later stage both belong to disease incidence) ( Figure 3 ), the incidence of each strain (three replicates, about 20 seedlings per replicate) was counted. It was found that the incidence of the wild type WT was as high as 78.75%, while the incidences of the transgenic lines ClChitin OE-1, OE-2 and OE-3 were 61.43%, 58.10% and 51.06% respectively, indicating that the overexpression of ClChitin can significantly improve the resistance of plants to Fusarium wilt.

[0065] In summary, the present invention provides a method for creating watermelon germplasm resistant to Fusarium wilt by gene overexpression. By overexpressing the chitinase gene ClChitin, watermelon materials resistant to Fusarium wilt can be quickly obtained, which can provide technical support for the directional improvement of the resistance of excellent watermelon germplasm.

[0066] The foregoing description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of watermelon chitinase gene ClChitin in resistance to wilt disease, characterized in that: The nucleotide sequence of the watermelon chitinase gene ClChitin is shown in SEQ ID NO.

1.

2. Application of biomaterials overexpressing watermelon chitinase gene ClChitin in resistance to wilt disease, characterized in that: The biological material is any one of the following: A: an expression cassette capable of overexpressing the watermelon chitinase gene ClChitin having a nucleotide sequence as shown in SEQ ID NO.1; B: a recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

3. Application of watermelon chitinase gene ClChitin in watermelon breeding, characterized in that: The nucleotide sequence of the watermelon chitinase gene ClChitin is shown in SEQ ID NO.

1.

4. Application of watermelon chitinase gene ClChitin in breeding watermelon germplasm resistant to wilt disease, characterized in that: The nucleotide sequence of the watermelon chitinase gene ClChitin is shown in SEQ ID NO.1.

Images